CN112575067B - Method for detecting structure-specific nuclease FEN1 by using DNA ligation reaction and rolling circle amplification combined biosensor - Google Patents
Method for detecting structure-specific nuclease FEN1 by using DNA ligation reaction and rolling circle amplification combined biosensor Download PDFInfo
- Publication number
- CN112575067B CN112575067B CN202011472708.9A CN202011472708A CN112575067B CN 112575067 B CN112575067 B CN 112575067B CN 202011472708 A CN202011472708 A CN 202011472708A CN 112575067 B CN112575067 B CN 112575067B
- Authority
- CN
- China
- Prior art keywords
- fen1
- fluorescence
- reaction
- concentration
- rolling circle
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for detecting a structure-specific nuclease FEN1 by a biosensor combining a DNA ligation reaction and rolling circle amplification, which comprises the steps of mixing and incubating a dumbbell-shaped DNA probe with a 5' end sequence fragment, a test sample and a reaction buffer solution, then adding T4DNA ligase and the reaction buffer solution into the solution, incubating, then dropping a primer and RCA mixture into the obtained sample to start the RCA reaction, measuring the fluorescence of the obtained sample, finally detecting the fluorescence values of the test sample with different concentrations, drawing a relation graph between the concentration and the fluorescence intensity, detecting the fluorescence value of the sample to be detected, and substituting the relation graph to calculate the concentration of the FEN 1. The FEN1 detection method has the advantages of high sensitivity, strong selectivity and low cost, and can realize high-efficiency detection of FEN1 in tumors.
Description
Technical Field
The invention relates to a method for detecting a certain target object by a biosensor, in particular to a method for detecting structure-specific nuclease FEN1 by the biosensor by combining DNA ligation reaction and rolling circle amplification.
Background
The key role of biomarkers in diagnosis and prognosis has been generally accepted, and the advantage of accurate detection is also of great significance in the development of sophisticated medicine. FEN1 (Flap endinecrase 1) plays an important role in the process of DNA replication and repair, and cancer cells are vigorous in vitality, and tend to rapidly replicate in a human body, resulting in over-expression of DNA polymerase and thus FEN 1. Therefore, the specific detection of FEN1 can accurately locate cancer cells for subsequent treatment, and has great significance. However, currently, the development of an analysis technique for detecting FEN1 is still weak, and various conventional detection methods including Western blot and ELISA cannot meet clinical requirements, so that the invention of a new detection technique capable of improving performance and reducing cost is highly required.
From the programmability of functional nucleic acid and DNA nanotechnology, the conformation and function of DNA can be reasonably designed for recognition, catalysis and calculation. Among them, the important application is that the performance of the biosensor is greatly improved by using amplification technologies such as Rolling Circle Amplification (RCA), exponential isothermal amplification (EXPAR), recombinase Polymerase Amplification (RPA), and the like.
Disclosure of Invention
The purpose of the invention is as follows: the invention aims to provide a method for detecting structure-specific nuclease FEN1 by using a biosensor combining DNA ligation reaction and rolling circle amplification, which can specifically identify a target object FEN1 and enhance the sensitivity and accuracy of detection.
The technical scheme is as follows: the method for detecting the structure-specific nuclease FEN1 by the DNA ligation reaction and rolling circle amplification combined biosensor comprises the following steps:
(a) Mixing the dumbbell-shaped DNA probe with the 5' end sequence fragment, a test sample and a reaction buffer solution, and incubating for 20-40min at 35-40 ℃;
(b) Adding T4DNA ligase and the reaction buffer solution in the step (a) into the final solution obtained in the step (a), and incubating for 35-45min at the temperature of 20-25 ℃;
(c) Dropping the primer and rolling circle amplification mixture into the final solution obtained in (b) to start the rolling circle amplification reaction;
(d) Performing rapid and high-throughput detection on the final solution obtained in the step (c) on a plate reader, and performing excitation and emission between 450 and 550 nm;
(e) Measuring the fluorescence of the final solution obtained in (c) with a fluorescence spectrometer;
(f) Repeating the steps, detecting the fluorescence values of the test samples with different concentrations, and calculating the relationship between the FEN1 concentration and the fluorescence intensity by drawing a relational graph;
(g) And (e) taking the sample to be detected as a test sample, performing the steps (a) - (e), comparing the measured fluorescence value with the relation graph obtained in the step (f), and calculating the concentration of the FEN1 in the sample to be detected.
The method, the dumbbell-shaped DNA probe with the free end in the step (a) has the sequence:
italicized letters indicate the free 5' terminal sequence, and underlined letters indicate the binding region of the primer.
The method, wherein the concentration range of the dumbbell-shaped DNA probe in the step (a) is 5-15nM.
The method comprises the step (a) that the reaction buffer solution contains KCl, tris-HCl and (NH) 4 ) 2 SO 4 、MgSO 4 The solution of (1).
The method, the concentration range of the T4DNA ligase in the step (b) is 3-7U/mu L.
In the method, the sequence of the primer in the step (c) is as follows:
the method, wherein the RCA mixture in step (c) comprises phi29DNA polymerase, dNTPs, phi29 reaction buffer and SGI.
The method, in step (d), is characterized by exciting and emitting at 497nm and 530nm respectively.
The method, wherein the fluorescence spectrometer measures fluorescence at a wavelength λ =497nm in step (e).
The reaction principle of the present invention is shown in FIG. 1.
Has the advantages that: compared with the prior art, the invention has the following remarkable advantages: (1) The method makes full use of the characteristics of 5' groups left after FEN1 cuts sequence segments, ensures that T4DNA ligase can connect adjacent 3'5' groups to generate closed dumbbell-shaped DNA, thereby performing rolling circle amplification and signal amplification and improving the sensitivity of FEN1 detection. (2) The method integrates a signal amplification technology in the FEN1 detection for the first time, combines functional nucleic acid editing with a biomarker, realizes the improvement of sensitivity, and the detection limit of the method reaches the level of femtollar. (3) The whole process of the biosensor mainly comprises sample addition and constant temperature culture, and has the advantages of simplicity, convenience and practicability; in addition, all enzymes, reagents and oligonucleotides have a mature source, thereby avoiding instability caused by self-synthesis of nanomaterials. (4) The method not only provides a better method for realizing FEN1 identification and signal amplification, but also provides a more effective research means for FEN 1-related oncology research.
Drawings
FIG. 1 is a schematic diagram of the present invention;
FIG. 2A is a graph of the relationship between ligation time and fluorescence of the total reaction; FIG. 2B is a graph showing the relationship between RCA reaction time and fluorescence of the total reaction;
FIG. 3A is a fluorescence spectrum of a sensing system with different concentrations of FEN1 added; FIG. 3B is a linear relationship between FEN1 concentration and fluorescence signal; FIG. 3C shows the selectivity of the method to FEN 1; FIG. 3D is a comparison of the quantification of FEN1 in tumor samples given by this method and a commercial ELISA kit.
Detailed Description
Drugs and reagents: oligonucleotides were synthesized and purified by biological engineering (shanghai, china). T4DNA ligase, phi29DNA polymerase, dNTP, SYBR Green I (SGI) and chemical reagents for buffer preparation were obtained from Biotechnology engineering (Shanghai, china). FEN1 is provided by BBI (Shanghai, china). Ultrapure water was prepared by the Milli-Q system of Millipore (Mass.) and pretreated with diethyl pyrocarbonate (DEPC, BBI, shanghai, china) in water to inactivate DNase and RNase before use in DNA-related experiments. Tumor samples given by the commercial ELISA kit are provided by biomanik.
Example 1
Condition optimization experiment of the detection method of the invention
The specific method comprises the following steps:
1) Mixing 10 mul of designed dumbbell-shaped DNA probe with 5' end sequence fragment and 10nM concentration, 10 mul of test sample and 30 mul of reaction buffer solution, and incubating for 20-40min at 35-40 ℃. Then, 1. Mu.L, 5U/. Mu. L T4DNA ligase and 1 Xreaction buffer were added to the solution and incubated at 22 ℃ for 40min. The reaction buffer solution is: 15mKCl, 30mM Tris-HCl,15mM (NH) 4 ) 2 SO 4 、3mM MgSO 4 pH 8.8. 10. Mu.L of the test sample is a solution which may contain the target, and the solvent is water or a buffer.
2) Primers and 5. Mu.L of LRCA mix (2U phi29DNA polymerase, 1mMdNTPs,1 XPhi 29 reaction buffer and 1 XPQI) were added dropwise to the sample obtained in 1) to initiate the rolling circle amplification RCA reaction. Primer sequences and 1) template sequences are shown in the following table:
TABLE 1 DNA sequence of this method
Italicized letters indicate the free 5' terminal sequence and underlined letters indicate the binding region of the primer.
3) And then carrying out rapid and high-flux detection on a Synergy H-1 plate reader, and respectively carrying out excitation and emission at 497nm and 530 nm. The resulting sample was measured for fluorescence using an F-7100 fluorescence spectrometer at a wavelength of λ =497nm and the fluorescence value was recorded.
The optimal reaction time was confirmed by observing the fluorescence intensity by changing the T4 ligase ligation time and the RCA reaction time in step 1) and step 2), respectively. The specific operation is as follows: (1) 5pM FEN1 was incubated with dumbbell DNA with 5' sequence fragment for 30 minutes, followed by the addition of 5U T4DNA ligase and incubation at 22 ℃ for various time intervals. Thereafter, the RCA reaction was performed by adding the RCA premix, and incubated at 37 ℃ for 30 minutes. (2) 5pM FEN1 was incubated with dumbbell DNA with 5' sequence fragment for 30 minutes, followed by addition of 5U T4DNA ligase and incubation at 22 ℃ for 40 minutes. Thereafter, RCA reactions were performed by adding the RCA premix and incubating at 37 ℃ for various time intervals. The change in fluorescence was recorded and observed. The relationship between the T4 ligase ligation time and the fluorescence intensity is shown in FIG. 2A, and it can be seen that the optimal ligation time is around 40min. The relationship between the time of the RCA reaction and the fluorescence intensity is shown in FIG. 2B, and it can be seen that the optimum RCA reaction time was about 30 min.
Example 2
The test sample in step 1) of example 1 was changed to FEN1 of a different concentration without changing other conditions, and steps 1) to 3) of example 1 were repeated to detect fluorescence. The specific configuration method of FEN1 with different concentrations is as follows: the FEN1 standard substance was diluted with the reaction buffer to obtain FEN1 solutions having concentrations of 0, 20, 100, 500, 1000, 2000, 3000, 5000, 8000 fM.
The fluorescence spectra of the sensing system at corresponding different concentrations of FEN1 were plotted as shown in fig. 3A. The linear relationship between the FEN1 concentration and the fluorescence signal was plotted as shown in FIG. 3B. Fitting is performed according to linearity, the resulting linear range is 20-8000fM, and the detection limit is 15fM according to the calculation rule of signal-to-noise ratio = 3.
Example 3
Selectivity test of the detection method of the invention
The test samples in step 1) of example 1 are replaced by T3 DNA ligase, exo III, bst DNA pol, BSA, HAS, histone and IFN-gamma with corresponding concentrations, other conditions are not changed, and steps 1) -3) of example 1 are repeated to detect fluorescence, so that the selective result of detecting the target FEN1 by the method of the invention is obtained, as shown in FIG. 3C. It can be seen from fig. 3C that the method of the present invention has good selectivity to the target FEN 1.
Example 4
Comparison of the quantitative results of FEN1 in tumor samples given by the method of the present invention and commercial ELISA kits, the detection method was performed according to the instructions provided by the Biomatik kit, as shown in FIG. 3D.
Example 5
Recovery rate test of the detection method of the present invention
And (3) changing the sample into a HeLa cell, adding the same amount of target molecules into the sample, carrying out sample adding detection, and repeating the steps 1) -3) in the example 1 under the same other conditions to obtain the recovery rate of the method in the actual sample, wherein the results are shown in a table 2. It can be seen that the recovery rate of the present detection method is good.
TABLE 2 detection results of HeLa cells detected by the sensor prepared by the present invention
Claims (7)
1. A method for detecting a structure-specific nuclease FEN1 by a biosensor combined with DNA ligation reaction and rolling circle amplification is characterized by comprising the following steps:
(a) Mixing the dumbbell-shaped DNA probe with the 5' end sequence fragment, a test sample and a reaction buffer solution, and incubating for 20-40min at 35-40 ℃; the sequence of the dumbbell-shaped DNA probe with the 5 'end sequence segment is TTAACGACCATTCA from 5' to 3AACGCACTGATGGTTGCCAACCACAAACGGCAA; TTAACG is a free 5' terminal sequence, the underlined letters indicate the binding region of the primer;
(b) Adding T4DNA ligase and the reaction buffer solution in the step (a) into the final solution obtained in the step (a), and incubating for 35-45min at the temperature of 20-25 ℃;
(c) Dropping the primer and rolling circle amplification mixture into the final solution obtained in the step (b) to start the rolling circle amplification reaction; the sequence of the primer is CAGTGCGTT from 5 'to 3';
(d) Performing rapid and high-throughput detection on the final solution obtained in the step (c) on a plate reader, and performing excitation and emission between 450 and 550 nm;
(e) Measuring the fluorescence of the final solution obtained in (c) with a fluorescence spectrometer;
(f) Repeating the steps, detecting the fluorescence values of the test samples with different concentrations, and calculating the relationship between the FEN1 concentration and the fluorescence intensity by drawing a relational graph;
(g) Taking a sample to be tested as a test sample, performing the steps (a) - (e), comparing the measured fluorescence value with the relation graph obtained in the step (f), and calculating the concentration of FEN1 in the sample to be tested;
the method is for non-disease diagnostic purposes.
2. The method according to claim 1, wherein the concentration of the dumbbell DNA probe in step (a) is in the range of 5 to 15nM.
3. The method of claim 1, wherein the reaction buffer in step (a) is a reaction buffer containing KCl, tris-HCl, (NH) 4 ) 2 SO 4 、MgSO 4 The solution of (1).
4. The method according to claim 1, wherein the concentration of T4DNA ligase in step (b) is in the range of 3-7U/. Mu.L.
5. The method of claim 1, wherein the RCA mixture in step (c) comprises phi29DNA polymerase, dNTPs, phi29 reaction buffer, and SGI.
6. The method according to claim 1, wherein in step (d) the excitation and emission are performed at 497nm and 530nm, respectively.
7. The method of claim 1, wherein the fluorescence spectrometer measures fluorescence at a wavelength of λ =497nm in step (e).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011472708.9A CN112575067B (en) | 2020-12-15 | 2020-12-15 | Method for detecting structure-specific nuclease FEN1 by using DNA ligation reaction and rolling circle amplification combined biosensor |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011472708.9A CN112575067B (en) | 2020-12-15 | 2020-12-15 | Method for detecting structure-specific nuclease FEN1 by using DNA ligation reaction and rolling circle amplification combined biosensor |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112575067A CN112575067A (en) | 2021-03-30 |
| CN112575067B true CN112575067B (en) | 2023-03-28 |
Family
ID=75136223
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011472708.9A Active CN112575067B (en) | 2020-12-15 | 2020-12-15 | Method for detecting structure-specific nuclease FEN1 by using DNA ligation reaction and rolling circle amplification combined biosensor |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112575067B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109750088B (en) * | 2019-03-22 | 2022-06-21 | 重庆医科大学 | TdT-RCA-based sensor and application thereof in DNA methyltransferase detection |
| CN113355400B (en) * | 2021-04-06 | 2023-08-22 | 南京师范大学 | Cadmium ion detection method based on T3 DNA ligase |
| CN114410793B (en) * | 2022-02-16 | 2024-03-08 | 山东师范大学 | Method for detecting FEN1 activity by label-free fluorescence |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU9341701A (en) * | 1996-11-29 | 2002-01-17 | Third Wave Technologies, Inc. | Fen-1 endonucleases, mixtures and cleavage methods |
| WO2013003630A2 (en) * | 2011-06-28 | 2013-01-03 | Igor Kutyavin | Methods and compositions for enrichment of nucleic acids in mixtures of highly homologous sequences |
| CN108823315A (en) * | 2018-07-24 | 2018-11-16 | 重庆医科大学附属第二医院 | Detect the application that the reagent of fen1 gene expression dose is invaded in the reagent of transfer in preparation for diagnosing and predicting liver cancer |
-
2020
- 2020-12-15 CN CN202011472708.9A patent/CN112575067B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU9341701A (en) * | 1996-11-29 | 2002-01-17 | Third Wave Technologies, Inc. | Fen-1 endonucleases, mixtures and cleavage methods |
| WO2013003630A2 (en) * | 2011-06-28 | 2013-01-03 | Igor Kutyavin | Methods and compositions for enrichment of nucleic acids in mixtures of highly homologous sequences |
| CN108823315A (en) * | 2018-07-24 | 2018-11-16 | 重庆医科大学附属第二医院 | Detect the application that the reagent of fen1 gene expression dose is invaded in the reagent of transfer in preparation for diagnosing and predicting liver cancer |
Non-Patent Citations (4)
| Title |
|---|
| A dumbbell probe-mediated rolling circle amplification strategy for highly sensitive microRNA detection;Yuntao Zhou等;《Nucleic Acids Research》;20100114;第38卷(第15期);第1-5页 * |
| FEN1酶介导的功能核酸生物传感器的研;孙雨阁等;《生物技术通报》;20200430;第36卷(第4期);第208-224页 * |
| Label-free Imaging of Flap Endonuclease 1 in Living Cells by Assembling Original and Multifunctional Nanoprobe;Chenchen Wang等;《ACS Appl. Bio Mater》;20200103;1-26 * |
| Signal-Amplified Detection of the Tumor Biomarker FEN1 Based on Cleavage-Induced Ligation of a Dumbbell DNA Probe and Rolling Circle Amplification;Bingzhi Li等;《Anal. Chem》;20210202;第93卷;第3287−3294页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112575067A (en) | 2021-03-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112575067B (en) | Method for detecting structure-specific nuclease FEN1 by using DNA ligation reaction and rolling circle amplification combined biosensor | |
| CN109811072B (en) | CRISPR (clustered regularly interspaced short palindromic repeats) detection primer group for mycobacterium tuberculosis complex and application of CRISPR detection primer group | |
| CN102719526B (en) | MicroRNA quantitative detection analytic method by utilizing isothermal amplification to synthesize fluorescent nano silver cluster probe | |
| He et al. | A novel ratiometric SERS biosensor with one Raman probe for ultrasensitive microRNA detection based on DNA hydrogel amplification | |
| Deng et al. | Ultrasensitive detection of gene-PIK3CAH1047R mutation based on cascaded strand displacement amplification and trans-cleavage ability of CRISPR/Cas12a | |
| CN110804669A (en) | CRISPR (clustered regularly interspaced short palindromic repeats) detection primer group for mycoplasma pneumoniae and application thereof | |
| Li et al. | A simple and rapid method to assay SARS-CoV-2 RNA based on a primer exchange reaction | |
| Zhou et al. | A novel methyl-dependent DNA endonuclease GlaI coupling with double cascaded strand displacement amplification and CRISPR/Cas12a for ultra-sensitive detection of DNA methylation | |
| Song et al. | Ultrasensitive multiplexed miRNA detection based on a self-priming hairpin-triggered isothermal cascade reaction | |
| KR20180001893A (en) | Method for detection of target nucleic acids | |
| CN109593832A (en) | A kind of detection method of ARMS-ddPCR point mutation | |
| Wu et al. | A simple fluorescence biosensing strategy for ultrasensitive detection of the BCR–ABL1 fusion gene based on a DNA machine and multiple primer-like rolling circle amplification | |
| Yuan et al. | CATCH: high specific transcriptome-focused fusion gene variants discrimination | |
| Asa et al. | Highly sensitive, selective, and rapid detection of miRNA-21 using an RCA/G-quadruplex/QnDESA probing system | |
| Zhou et al. | Sensitive monitoring of RNA transcription levels using a graphene oxide fluorescence switch | |
| CN107723343B (en) | Method for quantitative analysis of gene | |
| CN116083575A (en) | Kit for detecting cervical cancer and application thereof | |
| US11618919B2 (en) | Ultrasensitive micro RNA quantification | |
| CN111850129B (en) | Primer pair, kit and method for detecting stability of NR21 locus of microsatellite | |
| WO2019084998A1 (en) | Kit for detecting kras, nras, or braf gene mutation | |
| US20150225798A1 (en) | Materials and Methods for Quality-Controlled Two-Color RT-QPCR Diagnostic Testing of Formalin Fixed Embedded and/or Fresh-Frozen Samples | |
| CN113373200B (en) | Method for detecting transcription factor NF-kappa B p50 by biosensor | |
| Liu et al. | Double blocking gap-filling-ligation coupled with cascade isothermal amplification for ultrasensitive quantification of N 6-methyladenosine | |
| CN110616261A (en) | Kit and method for detecting EGFR gene T790M mutation | |
| Xu et al. | One-pot isothermal amplification permits recycled activation of CRISPR/Cas12a for sensing terminal deoxynucleotidyl transferase activity |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |