CN112574315B

CN112574315B - Fc variants and fusion proteins thereof that alter effector function

Info

Publication number: CN112574315B
Application number: CN202011039915.5A
Authority: CN
Inventors: 路力生; 霍永庭; 刘云鹏; 李艳敏; 韩喆; 欧颖烨; 芦迪; 涂晶晶
Original assignee: Guangdong Fapon Biopharma Inc
Current assignee: Guangdong Fapon Biopharma Inc
Priority date: 2019-09-30
Filing date: 2020-09-28
Publication date: 2023-04-07
Anticipated expiration: 2040-09-28
Also published as: CN112574315A; WO2021063313A1

Abstract

The invention discloses an Fc variant for changing effector functions and a fusion protein thereof, wherein an Fc region comprises one or more amino acid changes and has changed effector functions; further, fusion proteins comprising Fc variants that alter effector function are disclosed, as well as methods of making such Fc variants or fusion proteins, nucleic acids encoding such Fc variants or fusion proteins, expression vectors comprising said nucleic acids, host cells comprising said Fc variants or fusion proteins, nucleic acids or expression vectors, pharmaceutical compositions comprising such Fc variants or fusion proteins, and uses of such Fc variants or fusion proteins.

Description

Fc variants and fusion proteins thereof that alter effector function

Technical Field

The present invention relates to the field of biopharmaceuticals, and in particular to an Fc variant for altering effector function, which comprises one or more amino acid changes in the Fc region, which has altered effector function; further, the invention relates to fusion proteins comprising Fc variants that alter effector function.

Background

The Fc region of an antibody interacts with a number of Fc receptors and ligands and performs a series of important functions, called effector functions. The Fc receptor for IgG antibodies is called Fc γ R, for IgE Fc ε R, for IgA Fc α R, and so on. Three subclasses of Fc γ R have been identified: fc γ RI (CD 64), fc γ RII (CD 32), and Fc γ RIII (CD 16). Another type of Fc receptor is the neonatal Fc receptor (FcRn).

The effector functions mediated by the Fc region of antibodies can be divided into two categories: (1) Effector functions that function upon binding of the antibody to the antigen (these functions involve participation in the complement cascade or Fc receptor (FcR) -loaded cells); and (2) effector functions that function independently of antigen binding (these functions provide persistence in the blood circulation and the ability to cross cellular barriers by endocytosis).

In recent years, various fusion proteins are often prepared from an antibody Fc region, an Fc segment of the fusion protein can be combined with Fc gamma Rs receptors expressed on various immune leukocytes, so that Fc segment-mediated cytotoxicity (ADCC) and complement-dependent cytotoxicity (CDC) effects are generated, targeted killing of functional protein receptor positive cells can influence the activity of the fusion protein, and gene mutation designed for weakening the affinity between the Fc segment of the therapeutic fusion protein and the Fc gamma Rs receptors usually causes the reduction of the affinity between the fusion protein and the FcRn receptors and the half-life of the fusion protein in vivo.

Disclosure of Invention

The present invention is directed to solving, at least to some extent, one of the technical problems in the related art. To this end, in a first aspect of the present invention, there is provided an Fc variant aimed at reducing the affinity between Fc and Fc receptors expressed on various immune leukocytes, namely Fc γ Rs (mainly including FcR gamma I, fcR gamma IIa, fcR gamma IIb and FcR gamma IIIa), thereby reducing or eliminating Fc fragment-mediated cytotoxicity (ADCC) or binding complement C1 q-mediated complement-dependent cytotoxicity (CDC) effects, and maintaining constant or enhanced affinity to neonatal Fc receptor (FcRn), without affecting in vivo half-life.

According to an embodiment of the invention, wherein the Fc variant comprises an amino acid substitution at least one position selected from positions 233, 235, 237, 238, 265, 297, 327, 434 according to EU numbering.

According to an embodiment of the invention, the Fc is preferably an IgG Fc, wherein the IgG Fc is one of IgG1 Fc, igG2 Fc, igG3Fc, igG4 Fc, preferably an IgG1 Fc, more preferably a human IgG1 Fc.

According to an embodiment of the invention, wherein the amino acid substitution is selected from at least one of E233P, L235A, G237A, P238A, D265A, N297A, a327Q, and N434A.

According to an embodiment of the invention, wherein the amino acid substitutions are selected from at least three of E233P, L235A, G237A, P238A, D265A, N297A, a327Q, and N434A.

According to an embodiment of the invention, the amino acid substitution is selected from: E233P, P238A, D265A; N297A, L235A, N434A; and three amino acid substitutions of A327Q, G237A, L235A.

In a second aspect of the invention, the invention provides an Fc variant fusion protein, in particular, the invention relates to the following embodiments:

embodiment 1. A fusion protein having the structure shown in the following formula:

a-peptide linker-B or B-peptide linker-A (I)

Wherein A is IL-10, IL-6, or IL-12, and the peptide linker is (GS) _n Wherein n is an integer from 1 to 10 and B is an Fc variant.

Embodiment 2. The fusion protein of embodiment 1, wherein the A is IL-10, preferably human IL-10.

Embodiment 3. The fusion protein of any one of embodiments 1-2, wherein IL-10 is linked to the N-terminus or C-terminus of the IgG variant via the peptide linker.

Embodiment 4 the fusion protein of embodiment 1, wherein the IgG Fc variant is one of IgG1 Fc, igG2 Fc, igG3Fc, igG4 Fc variants, preferably an IgG1 Fc variant, more preferably a human IgG1 Fc variant.

Embodiment 5. The fusion protein of any one of embodiments 1-4, wherein the amino acid sequence of IL-10 is SEQ ID NO:17.

embodiment 6. The fusion protein of any one of the preceding embodiments, wherein the Fc variant is modified such that the modified Fc variant impairs the affinity of the fusion protein to Fc γ R compared to wild-type Fc.

Embodiment 7 the fusion protein of embodiment 6, wherein the Fc variant comprises an amino acid substitution at least one position selected from the group consisting of positions 233, 235, 237, 238, 265, 297, 327, 434 according to EU numbering.

Embodiment 8 the fusion protein of embodiment 7, wherein the amino acid substitution is selected from at least one of E233P, L235A, G237A, P238A, D265A, N297A, a327Q, and N434A.

Embodiment 9 the fusion protein of embodiment 6 or 7, wherein the amino acid substitutions are selected from at least three of E233P, L235A, G237A, P238A, D265A, N297A, a327Q, and N434A.

Embodiment 10 the fusion protein of embodiment 9, wherein the amino acid substitution is selected from the group consisting of: E233P, P238A, D265A; N297A, L235A, N434A; and three amino acid substitutions of A327Q, G237A, L235A.

Embodiment 11 the fusion protein of embodiment 10, wherein the amino acid sequence of the fusion protein is SEQ ID NO 2, SEQ ID NO 4, or SEQ ID NO 6.

In a third aspect of the invention, the invention provides a nucleic acid encoding any one of the Fc variants or any one of the Fc variant fusion proteins described above.

According to an embodiment of the invention, the nucleotide sequence of the nucleic acid is SEQ ID NO 1, SEQ ID NO 3, SEQ ID NO 5, SEQ ID NO 20, SEQ ID NO 21 or SEQ ID NO 22.

In a fourth aspect of the invention, the invention provides a pharmaceutical composition comprising any one of the Fc variants or any one of the Fc variant fusion proteins described above and a pharmaceutically acceptable carrier.

According to a fifth aspect of the invention, there is provided the use of any one of the pharmaceutical compositions described above in the manufacture of a medicament for the treatment of cancer in an individual in need thereof.

According to an embodiment of the invention, wherein the cancer is a solid tumor.

According to an embodiment of the invention, wherein the solid tumor is colon cancer, melanoma, rectal cancer, breast cancer.

According to an embodiment of the invention, wherein the individual is a human.

Definition of

Unless otherwise defined below, terms are used herein as generally used in the art.

The term "Fc" or "Fc region" is used herein to define a C-terminal region of an antibody heavy chain that contains at least a portion of a constant region. The term includes native sequence Fc regions and variant Fc regions. The IgG Fc region comprises IgG CH2 and IgG CH3 domains. The "CH2 domain" of the human IgG Fc region typically extends from about the amino acid residue at position 231 to about the amino acid residue at position 340. Unless otherwise specified herein, the numbering of amino acid residues in the Fc region or constant region is according to the EU numbering system, also known as the EU index, as described in Kabat et al, sequences of Proteins of Immunological Interest,5th Ed.public Health service, national Institutes of Health, bethesda, MD,1991.

Fc as described herein includes wild-type Fc as well as modified Fc, e.g., igG Fc that, when compared to wild-type IgG Fc, impairs the affinity of the fusion protein described herein to Fc γ R. Affinity can be determined using methods known in the art or disclosed herein.

Amino acid "substitution" refers to the replacement of one amino acid with another in a polypeptide. In one embodiment, the amino acid is substituted with another amino acid having similar structural and/or chemical properties, such as a conservative amino acid substitution. "conservative" amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues involved. For example, non-polar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine; polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine; positively charged (basic) amino acids include arginine, lysine, and histidine; and negatively charged (acidic) amino acids include aspartic acid and glutamic acid. Non-conservative substitutions may require the exchange of a member of one of these classes for a member of another class. For example, an amino acid substitution can also result in the replacement of one amino acid with another amino acid having a different structural and/or chemical property, e.g., the replacement of an amino acid from one group (e.g., polar) with another amino acid from a different group (e.g., basic). Amino acid substitutions can be made using genetic or chemical methods well known in the art. Genetic methods may include site-directed mutagenesis, PCR, gene synthesis, and the like. For example, E233P indicates that E at position 233 in Fc is replaced by P, and P238A indicates that P at position 238 in Fc is replaced by A.

"IgG class antibody" refers to an antibody having the structure of a naturally occurring immunoglobulin G (IgG) molecule. The antibody heavy chain of an IgG class antibody has the domain structure VH-CH1-CH2-CH3. The antibody light chain of an IgG class antibody has the domain structure VL-CL. An IgG class antibody consists essentially of two Fab fragments and one Fc domain connected via an immunoglobulin hinge region. IgG class antibodies include, for example, igG1, igG2, igG3, and IgG4.IgG1 Fc, igG2 Fc, igG3Fc, igG4 Fc represent Fc or Fc regions of IgG1, igG2, igG3 and IgG4, respectively. The IgG Fc in the fusion protein herein may be IgG1 Fc, igG2 Fc, igG3Fc, igG4 Fc, preferably IgG1 Fc, more preferably human IgG1 Fc.

As used herein, the term "fusion protein" refers to a fusion polypeptide molecule comprising an IL-10, IL-6 or IL-12 molecule and the Fc portion of IgG1, wherein the components of the fusion protein are linked to each other by peptide bonds, either directly or via a peptide linker.

The term "peptide linker" is a peptide comprising one or more amino acids, typically about 2-20 amino acids. Peptide linker is the peptide linkerKnown in the art or described herein. Suitable, non-immunogenic peptide linkers include, for example, (GS) _n A linker, wherein n is an integer from 1 to 10. In one embodiment, n is1 to 6, preferably 4.

By "fusion" is meant that the components are linked by peptide bonds, either directly or via one or more peptide linkers.

"affinity" or "binding affinity" refers to the strength of the sum of non-covalent interactions between a single binding site of a molecule and its binding partner. Unless otherwise indicated, "binding affinity" as used herein refers to an intrinsic binding affinity that reflects the 1:1 interaction between members of a binding pair. The affinity of a molecule X for its partner Y can generally be in terms of the dissociation constant (K) _D ) Expressed as dissociation and association rate constants (K, respectively) _Dissociation And K _{Bonding of} ) The ratio of (a) to (b). As such, equal affinities may comprise different rate constants, as long as the ratio of rate constants remains the same. Affinity can be measured by common methods known in the art, including those described herein. One particular method for measuring affinity is Surface Plasmon Resonance (SPR).

"Polynucleotide" or "nucleic acid" are used interchangeably herein to refer to a polymer of nucleotides of any length, and includes DNA and RNA. The nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and/or their analogs, or any substrate that can be incorporated into the polymer by DNA or RNA polymerase or by synthetic reaction. Polynucleotides may comprise modified nucleotides, such as methylated nucleotides and analogs thereof. The nucleotide sequence may be interrupted by non-nucleotide building blocks. The polynucleotide may comprise modifications made post-synthetically, such as conjugation to a label.

The term "modification" refers to any manipulation of the peptide backbone (e.g., amino acid sequence) or post-translational modification (e.g., glycosylation) of a polypeptide. Modifications also include substitutions, deletions or insertions of amino acids in the amino acid sequence.

"native IL-10" (also referred to as "wild-type IL-10") means a naturally occurring IL-10, as opposed to a "modified IL-10" which has been modified from the naturally occurring IL-10, for example in order to alter one or more of its properties, such as stability. The modified IL-10 molecule may, for example, comprise a modification in the amino acid sequence, such as an amino acid substitution, deletion or insertion. "native IL-6" (also referred to as "wild-type IL-6") means naturally occurring IL-6, as opposed to "modified IL-6", which has been modified from naturally occurring IL-6, for example, in order to alter one or more of its properties, such as stability. The modified IL-6 molecule may, for example, comprise a modification in the amino acid sequence, such as an amino acid substitution, deletion or insertion. "native IL-12" (also referred to as "wild-type IL-12") means a naturally occurring IL-12, as opposed to "modified IL-12", which has been modified from a naturally occurring IL-12, for example, in order to alter one or more of its properties, such as stability. The modified IL-12 molecules can, for example, contain modifications in the amino acid sequence, such as amino acid substitutions, deletions, or insertions.

As used herein, the term "vector" refers to a nucleic acid molecule capable of propagating another nucleic acid to which it is linked. The term includes vectors which are self-replicating nucleic acid structures and vectors which integrate into the genome of a host cell into which they are introduced. Certain vectors are capable of directing the expression of a nucleic acid to which they are operably linked. Such vectors are referred to herein as "expression vectors".

The terms "host cell," "host cell line," and "host cell culture" are used interchangeably and refer to a cell into which an exogenous nucleic acid has been introduced, including the progeny of such a cell. Host cells include "transformants" and "transformed cells," which include the originally transformed cell and progeny derived therefrom (regardless of the number of passages). Progeny may not be identical to the parent cell in nucleic acid content, but may contain mutations. Included herein are mutant progeny that have the same function or biological activity as screened or selected in the originally transformed cell. Host cells are any type of cell system that can be used to produce the fusion proteins of the invention. Host cells include cultured cells, for example, mammalian culture cells such as CHO cells, BHK cells, NS0 cells, SP2/0 cells, YO myeloma cells, P3X63 mouse myeloma cells, PER. C6 cells or hybridoma cells, yeast cells, bacterial cells such as E.coli, insect cells and plant cells, etc., and also include cells contained in transgenic animals, transgenic plants or cultured plants or animal tissues.

An "effective amount" of an agent refers to an amount necessary to effect a physiological change in the cell or tissue to which it is administered.

A "therapeutically effective amount" of an agent, e.g., a pharmaceutical composition, refers to an amount (in a necessary dose and for a necessary time) effective to achieve the desired therapeutic or prophylactic result. A therapeutically effective amount of an agent, for example, eliminates, reduces, delays, minimizes, or prevents the adverse effects of the disease.

An "individual" or "subject" is a mammal. Mammals include, but are not limited to, domesticated animals (e.g., cows, sheep, cats, dogs, and horses), primates (e.g., human and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats). In particular, the individual or subject is a human.

The term "pharmaceutical composition" refers to a preparation in a form that allows the biological activity of the active ingredient contained therein to be effective, and that is free of other ingredients that have unacceptable toxicity to the subject to whom the formulation will be administered.

"pharmaceutically acceptable carrier" refers to an ingredient in a pharmaceutical composition other than the active ingredient that is not toxic to the subject. Pharmaceutically acceptable carriers include, but are not limited to, buffers, excipients, stabilizers, or preservatives.

As used herein, "treatment" refers to an attempt to alter the natural course of disease in a treated individual, and may be a clinical intervention performed for prophylaxis or during the course of clinical pathology. Desirable effects of treatment include, but are not limited to, preventing occurrence or recurrence of disease, alleviating symptoms, reducing any direct or indirect pathological consequences of the disease, preventing metastasis, slowing the rate of disease progression, ameliorating or palliating the disease state, and regression or improved prognosis.

Drawings

FIG. 1 is a map of plasmids pcDNA3.4A (a), pcDNA3.4A-R0354 (b), pcDNA3.4A-R0355 (c), pcDNA3.4A-R0356 (d), pcDNA3.4A-R0359VCHE (e), pcDNA3.4A-R0359VCLE (f), and pcDNA3.4A-R0330 (g).

FIG. 2 Gene sequences of Signal peptide, R0354, R0355, R0356, R0359, and R0330 molecules.

FIG. 3 amino acid sequences of R0354, R0355, R0356, R0359 (consisting of R0359VCHE and R0359 VCLE), and R0330 and human IL-10.

FIG. 4 purity analysis and chromatogram: a) Affinity eluate SE-HPLC purity; b) SE-HPLC purity after affinity elution pH treatment; c) SE-HPLC purity of the eluted fraction after fine purification; d) Chromatography of pooled eluted fractions.

FIG. 5 increase of IL-10R in CD8+ T cells after activation.

FIG. 6. Secretion of INF γ by CD8+ T cells is promoted from IL-10 producing fusion protein molecules.

Figure 7. Anti-tumor activity in mice: a) Mouse colon cancer (CT 26 WT) anti-tumor model; b) Mouse colon cancer (CT 26 WT) tumor survival curve; c) Mouse melanoma (B16-F1) anti-tumor model; d) Mouse colon cancer (MC 38) anti-tumor model.

Detailed Description

In order to make the aforementioned objects, features and advantages of the present invention comprehensible, embodiments accompanied with figures are described in detail below. In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention. The present invention may be embodied in many different forms without departing from the spirit or essential characteristics thereof, and it should be understood that various changes in form and details can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

Fc variants

In one embodiment of the present invention, an Fc variant is disclosed, said Fc variant being an IgG Fc, wherein the IgG Fc is one of an IgG1 Fc, an IgG2 Fc, an IgG3Fc, an IgG4 Fc, preferably an IgG1 Fc, more preferably a human IgG1 Fc.

In one embodiment of the invention, wherein the IgG Fc comprises an amino acid substitution at least one position selected from positions 233, 235, 237, 238, 265, 297, 327, 434 according to EU numbering.

In one embodiment of the invention, wherein the amino acid substitution is selected from at least one of E233P, L235A, G237A, P238A, D265A, N297A, a327Q, and N434A.

In one embodiment of the invention, wherein the amino acid substitutions are selected from at least three of E233P, L235A, G237A, P238A, D265A, N297A, a327Q, and N434A.

In one embodiment of the invention, the amino acid substitution is selected from the group consisting of: E233P, P238A, D265A; N297A, L235A, N434A; and three amino acid substitutions of A327Q, G237A, L235A.

It will also be appreciated by those skilled in the art that some Fc region site mutations do not affect Fc receptor affinity, for example, common Fc variants also contain a deletion at position K447, or K447A mutation for linking other proteins to the C-terminus of Fc, and that Fc region 447 deletion or mutation does not affect the affinity of the Fc variant for Fc γ receptors and/or FcRn, and in addition to the above embodiments, fc variants containing a deletion or mutation at position 447 or other mutation sites that do not affect the affinity of Fc γ receptors are also within the scope of the present invention.

Fusion proteins

The Fc fusion protein can be prepared in various forms, and the Fc variant of the present invention can be prepared into any form of fusion protein, or can be fused with other various types of proteins, and the embodiment of the fusion protein disclosed in the present invention is only an example, and does not limit the scope of the present invention.

In one embodiment of the present invention, a fusion protein is disclosed, which has the structure shown in the following formula:

a-peptide linker-B or B-peptide linker-A (I)

Wherein A is IL-10, IL-6 or IL-12, and the peptide linker is (GS) _n Wherein n is an integer of 1 to 10, and B is IgG Fc.

In one embodiment of the invention, A may also be an active fragment of IL-10, IL-6 or IL-12.

In a further embodiment of the invention, the IgG1 Fc comprises three amino acid substitutions selected from the group consisting of: E233P, P238A, D265A; N297A, L235A, N434A; and a327Q, G237A, L235A.

In embodiments of the invention, IL-10 may be a native IL-10 from an animal, e.g., a mammal, e.g., a human, or a modified IL-10 obtained by substituting, inserting one or more amino acids into IL-10. The IL-10 active fragment is IL-10, which refers to a peptide chain obtained by cutting off one or more amino acids from the natural IL-10 or modified IL-10 from the N-terminus or C-terminus or from the N-terminus and C-terminus, wherein the peptide chain retains the functional activity of IL-10. The active fragment can be obtained by a person skilled in the art by conventional methods, such as by chemical synthesis or recombinant expression methods to obtain fragments of IL-10, and measuring whether the IL-10 fragment has the activity of the original IL-10 by methods known in the art or disclosed herein.

The polynucleotide and nucleic acid coding regions of the invention may be associated with additional coding regions that encode signal peptides that direct the secretion of the polypeptide encoded by the polynucleotide of the invention. For example, if secretion of the fusion is desired, DNA encoding a signal sequence can be placed upstream of the nucleic acid encoding the fusion protein of the invention or a fragment thereof. According to the signal hypothesis, proteins secreted by mammalian cells have a signal peptide or secretory leader sequence that is cleaved from the mature protein upon initiation of export of the growing protein chain across the rough endoplasmic reticulum. One of ordinary skill in the art knows that polypeptides secreted by vertebrate cells typically have a signal peptide fused to the N-terminus of the polypeptide that is cleaved from the translated polypeptide to produce the secreted or "mature" form of the polypeptide. The signal peptide may be a universal signal peptide, for example, an IgG universal signal peptide. For example, the coding sequence for the signal peptide can be ATGGGATGGTCATGCATAATACTCTTTCTTGTGGCTACTGCTACCGGGGTTCACTCT (SEQ ID NO: 11).

In an embodiment of the invention, a-peptide linker-B denotes a peptide linker connecting the carboxy terminus (C terminus, or 3 'terminus) of a and the amino terminus (N terminus, or 5' terminus) of B, respectively, and B-peptide linker-a denotes a peptide linker connecting the carboxy terminus (C terminus, or 3 'terminus) of B and the amino terminus (N terminus, or 5' terminus) of a, respectively.

In another embodiment, n is from 1 to 6, for example 1,2,3,4,5,6, preferably n is 4.

In another embodiment, the IgG1 Fc is a human IgG1 Fc. Although the Fc of IgG class antibodies confers favorable pharmacokinetic properties to the fusion protein, including a long serum half-life (due to better accumulation in the target tissue and favorable tissue-to-blood distribution ratio), it can at the same time cause unwanted targeting of the fusion protein to Fc receptor expressing cells, not the cells of interest. Furthermore, activation of the Fc receptor signaling pathway can cause cytokine release leading to (pro-inflammatory) cytokine receptor activation and serious side effects when administered systemically. The fusion protein not only retains the immune anti-tumor activity of IL-10, but also optimally combines the Fc segment site-specific gene mutation, weakens the affinity between the IL-10-Fc fusion protein and Fc receptors expressed on various immune leukocytes, namely Fc gamma Rs (mainly comprising FcR gamma I, fcR gamma IIa, fcR gamma IIb and FcR gamma IIIa), thereby reducing or eliminating Fc segment mediated cytotoxicity (ADCC) or combining complement C1q mediated Complement Dependent Cytotoxicity (CDC), thereby not generating cytotoxicity, avoiding killing effector T cells and finally effectively improving the anti-tumor effect of IL-10. Examples of in vitro assays to assess ADCC activity of molecules of interest are described in U.S. Pat. nos. 5,500,362; hellstrom et al, proc Natl Acad Sci USA 83,7059-7063 (1986) and Hellstrom et al, proc Natl Acad Sci USA 82,1499-1502 (1985); U.S. Pat. Nos. 5,821, 337; bruggemann et al J Exp Med 166,1351-1361 (1987). To assess complement activation, CDC assays can be performed (see, e.g., gazzano-Santoro et al J Immunol Methods 202,163 (1996); cragg et al, blood 101,1045-1052 (2003); and Cragg and Glennie, blood 103,2738-2743 (2004)).

In a preferred embodiment, IL-10 is human IL-10 or hIL-10.

In a preferred embodiment, IL-6 is human IL-6 or IL-6.

In a preferred embodiment, IL-12 is human IL-12 or IL-12.

In a preferred embodiment, the IgG1 Fc comprises three amino acid substitutions E233P, P238A, D265A; N297A, L235A, N434A; or a327Q, G237A, L235A. Wherein the numbering is the amino acid numbering of Fc, said numbering being according to the EU numbering system.

In another preferred embodiment, the amino acid sequence of the fusion protein is SEQ ID NO 2, SEQ ID NO 4, or SEQ ID NO 6.

Nucleic acids

In one embodiment, the invention relates to a nucleic acid encoding an Fc variant or fusion protein of the invention. It is well known to those skilled in the art that nucleic acids encoding a fusion protein can vary widely due to the degeneracy of the genetic code. The nucleic acid sequence may be optimized by the skilled person with respect to the host cell such that the nucleic acid sequence is expressed at an optimized level, e.g. a higher level, in the host cell. To achieve expression of, for example, a fusion protein, the nucleic acid sequence encoding the fusion protein may also be operably linked to regulatory elements such as promoters, introns, enhancers, and the like, such that these regulatory elements perform their respective functions in the host cell. The fusion protein may also comprise a signal peptide to enable secretion of the encoded fusion protein into the culture broth, whereby a supernatant is obtained by centrifugation and the fusion protein is further purified from the supernatant. Nucleic acids comprising fusion protein coding sequences, regulatory elements and signal peptide coding sequences are also within the scope of the nucleic acids of the invention.

In a preferred embodiment, the nucleotide sequence of the nucleic acid is SEQ ID NO 1, SEQ ID NO 3, SEQ ID NO 5, SEQ ID NO 20, SEQ ID NO 21, or SEQ ID NO 22.

In one embodiment, the invention relates to an expression vector comprising a nucleic acid encoding an Fc variant or fusion protein of the invention.

The expression vector may be a plasmid, part of a virus or may be a nucleic acid fragment. Expression vectors comprise an expression cassette in which a polynucleotide encoding a fusion protein (fragment) (i.e., a coding region) is cloned in operable linkage with a promoter and/or other transcriptional or translational control elements. A gene product, e.g., a coding region for a polypeptide, is operably linked when it is associated with one or more regulatory sequences in a manner such that expression of the gene product is under the influence or control of the regulatory sequences. Two DNA fragments (e.g., a polypeptide coding region and a promoter associated therewith) are "operably linked" if induction of promoter function results in transcription of mRNA encoding the desired gene product and if the nature of the linkage between the two DNA fragments does not interfere with the ability of the expression regulatory sequences to direct expression of the gene product or interfere with the ability of the DNA template to be transcribed. Thus, if a promoter is capable of effecting transcription of a nucleic acid encoding a polypeptide, the promoter region will be operably linked to the nucleic acid. The promoter may be a cell-specific promoter that directs substantial transcription of DNA only in predetermined cells. In addition to promoters, other transcriptional control elements such as enhancers, operators, repressors, and transcriptional termination signals can be operably linked to the polynucleotide to direct cell-specific transcription. Various transcriptional control regions are known to those skilled in the art. These include, but are not limited to, transcriptional control regions that function in vertebrate cells, such as, but not limited to, promoter and enhancer segments from cytomegalovirus (e.g., immediate early promoter, linked to intron-a), simian virus 40 (e.g., early promoter), and retroviruses (e.g., rous (Rous) sarcoma virus). Other transcriptional control regions include those derived from vertebrate genes such as actin, heat shock proteins, bovine growth hormone, and rabbit Yang protein, as well as other sequences capable of controlling gene expression in eukaryotic cells. Additional suitable transcriptional control regions include tissue-specific promoters and enhancers and inducible promoters (e.g., tetracycline-inducible promoters). Similarly, a variety of translational control elements are known to those of ordinary skill in the art. These include, but are not limited to, ribosome binding sites, translation initiation and termination codons, and elements derived from viral systems (specifically, internal ribosome entry sites or IRES, also known as CITE sequences). The expression cassette may also comprise other features, such as an origin of replication and/or chromosomal integration elements, such as retroviral Long Terminal Repeats (LTRs) or adeno-associated virus (AAV) Inverted Terminal Repeats (ITRs).

The polynucleotide and nucleic acid coding regions of the invention may be linked to additional coding regions encoding secretion peptides or signal peptides that direct secretion of the polypeptide encoded by the polynucleotide of the invention. For example, if secretion of the fusion protein is desired, a DNA encoding a signal sequence may be placed upstream of the nucleic acid encoding the fusion protein of the invention or a fragment thereof. According to the signal hypothesis, proteins secreted by mammalian cells have a signal peptide or secretory leader sequence that is cleaved from the mature protein upon initiation of export of the growing protein chain across the rough endoplasmic reticulum. One of ordinary skill in the art knows that polypeptides secreted by vertebrate cells typically have a signal peptide fused to the N-terminus of the polypeptide that is cleaved from the translated polypeptide to produce the secreted or "mature" form of the polypeptide. In certain embodiments, a native signal peptide, such as an immunoglobulin heavy or light chain signal peptide, or a functional derivative of such a sequence that retains the ability to direct secretion of a polypeptide to which it is operably linked, is used. Alternatively, a heterologous mammalian signal peptide or functional derivative thereof may be used. For example, the wild-type leader sequence may be substituted with the leader sequence of human Tissue Plasminogen Activator (TPA) or mouse β -glucuronidase.

DNA encoding short protein sequences that can be used to facilitate later purification (e.g., histidine tag) or to aid in labeling of the fusion protein can be incorporated into or at the end of the fusion protein (fragment) encoding polynucleotide.

In one embodiment, a host cell comprising one or more polynucleotides of the invention is provided. In certain embodiments, host cells comprising one or more vectors of the invention are provided. The polynucleotide and vector may incorporate any of the features described herein with respect to the polynucleotide and vector, respectively, alone or in combination. In one such embodiment, the host cell comprises (e.g. has been transformed or transfected with) a vector comprising a polynucleotide encoding (part of) a fusion protein of the invention. As used herein, the term "host cell" refers to any type of cell system that can be engineered to produce a fusion protein of the invention or a fragment thereof. Adapted for replication and support fusionHost cells for expression of the resultant proteins are well known in the art. Such cells may be transfected or transduced with a particular expression vector, as appropriate, and a large number of vector-containing cells may be cultured for seeding of a large-scale fermentor to obtain a sufficient amount of the fusion protein for clinical use. Suitable host cells include prokaryotic microorganisms such as E.coli, or various eukaryotic cells such as Chinese Hamster Ovary (CHO), insect cells, and the like. For example, polypeptides can be produced in bacteria, particularly when glycosylation is not required. After expression, the polypeptide can be isolated from the bacterial cell paste in a soluble fraction and can be further purified. In addition to prokaryotes, eukaryotic microorganisms such as filamentous fungi or yeast are suitable cloning or expression hosts for vectors encoding polypeptides, including fungal and yeast strains whose glycosylation pathways have been "humanized" resulting in production of polypeptides having partially or fully human glycosylation patterns. See Gerngross, nat Biotech22,1409-1414 (2004), and Li et al, nat Biotech 24,210-215 (2006). Host cells suitable for the expression (glycosylation) of polypeptides are also derived from multicellular organisms (invertebrates and vertebrates). Examples of invertebrate cells include insect cells. A number of baculovirus strains have been identified for use with insect cells, particularly for transfecting Spodoptera frugiperda (Spodoptera frugiperda) cells. Plant cell cultures may also be used as hosts. See, e.g., U.S. Pat. Nos. 5,959,177,6,040,498,6,420,548,7,125,978 and 6,417,429 (describing PLANTIB0DIES for antibody production in transgenic plants ^TM A technique). Vertebrate cells can also be used as hosts. For example, mammalian cell lines adapted to grow in suspension may be useful. Other examples of mammalian host cell lines that may be used are monkey kidney CV1 line transformed by SV40 (COS-7); human embryonic kidney line (293 or 293T cells, as described, e.g., in Graham et al, J Gen Virol 36,59 (1977)), baby hamster kidney cells (BHK), mouse Sertoli (TM 4) cells (TM 4 cells, as described, e.g., in Mather, biol Reprod 23,243-251 (1980)), monkey kidney cells (CV 1), african Green monkey kidney cells (VERO-76), human cervical cancer cells (HELA), kiwi kidney cells (MDCK), niu Shugan cells (BRL 3A), human lung cells (W138), human liver cells (HepG 2), small mouse cervical cancer cells (HELA)Murine mammary tumor cells (MMT 060562), TRI cells (as described, for example, in Mather et al, annals N.Y.Acad Sci 383,44-68 (1982)), MRC5 cells, and FS4 cells. Other mammalian host cell lines that may be used include Chinese hamster ovary (CH 0) cells, including dhfr ^- CHO cells (Urlaub et al, proc Natl Acad Sci USA77,4216 (1980)); and myeloma cell lines such as YO, NS0, P3X63, and Sp2/0. For a review of certain mammalian host cell lines suitable for protein production, see, e.g., yazaki and Wu, methods in Molecular Biology, vol.248 (B.K.C.Lo, ed., humana Press, totowa, NJ), pp.255-268 (2003). Host cells include cultured cells such as mammalian culture cells, yeast cells, insect cells, bacterial cells, plant cells, and the like, but also include cells contained in transgenic animals, transgenic plants, or cultured plants or animal tissues. In one embodiment, the host cell is a bacterial cell, preferably a cell of the genus Escherichia, particularly preferably an E.coli cell.

Fc variants or fusion proteins prepared as described herein can be purified by techniques known in the art, such as high performance liquid chromatography, ion exchange chromatography, gel electrophoresis, affinity chromatography, size exclusion chromatography, and the like. The actual conditions for purifying a particular protein will depend in part on factors such as net charge, hydrophobicity, hydrophilicity, etc., and will be apparent to those skilled in the art. For affinity chromatography purification, fusion protein-bound antibodies, ligands, receptors or antigens can be used. The purity of the fusion protein can be determined by any of a variety of well-known analytical methods, including gel electrophoresis, high pressure liquid chromatography, and the like.

Compositions, formulations and routes of administration

In a further aspect, the invention provides a pharmaceutical composition comprising any of the Fc variants or fusion proteins provided herein. In one embodiment, a pharmaceutical composition comprises any of the Fc variants or fusion proteins provided herein and a pharmaceutically acceptable carrier.

Therapeutic methods and compositions

Any of the fusion proteins provided herein can be used in a method of treatment.

For use in a method of treatment, the fusion proteins of the invention will be formulated, administered and administered in a manner consistent with good medical practice. Factors considered in this context include the particular condition being treated, the particular mammal being treated, the clinical condition of the individual patient, the cause of the condition, the site of delivery of the agent, the method of administration, the timing of administration, and other factors known to medical practitioners.

In one aspect, a fusion protein of the invention is provided for use as a medicament. In other aspects, fusion proteins of the invention are provided for use in treating a disease. In certain embodiments, fusion proteins of the invention are provided for use in a method of treatment. In one embodiment, the invention provides a fusion protein as described herein for use in treating a disease in an individual in need thereof. In certain embodiments, the invention provides a fusion protein for use in a method of treating an individual having a disease, the method comprising administering to the individual a therapeutically effective amount of the fusion protein. In certain embodiments, the disease to be treated is cancer. Exemplary cancers include colon cancer, melanoma, rectal cancer, and breast cancer. In certain embodiments, the method further comprises administering to the individual a therapeutically effective amount of at least one additional therapeutic agent, e.g., an anti-cancer agent. An "individual" according to any of the embodiments above is a mammal, preferably a human.

In a further aspect, the invention provides the use of a fusion protein of the invention in the manufacture or preparation of a medicament for the treatment of a disease in an individual in need thereof. In one embodiment, the medicament is for use in a method of treating a disease, the method comprising administering to an individual having a disease a therapeutically effective amount of the medicament. In certain embodiments, the disease to be treated is cancer. In a particular embodiment, the disease is colon cancer. In a particular embodiment, the disease is melanoma. In a particular embodiment, the disease is rectal cancer. In a particular embodiment, the disease is breast cancer. In one embodiment, the method further comprises administering to the individual a therapeutically effective amount of at least one additional therapeutic agent, such as an anti-cancer agent. An "individual" according to any of the above embodiments is a mammal, preferably a human.

In a further aspect, the invention provides a method for treating a disease in an individual, comprising administering to the individual a therapeutically effective amount of a fusion protein of the invention. In one embodiment, the individual is administered a composition comprising a fusion protein of the invention in a pharmaceutically acceptable form. In certain embodiments, the disease to be treated is cancer. In a particular embodiment, the disease is colon cancer. In a particular embodiment, the disease is melanoma. In a particular embodiment, the disease is rectal cancer. In a particular embodiment, the disease is breast cancer. In certain embodiments, the method further comprises administering to the individual a therapeutically effective amount of at least one additional therapeutic agent, e.g., an anti-cancer agent. An "individual" according to any of the embodiments above is a mammal, preferably a human.

In some embodiments, an effective amount of a fusion protein of the invention is administered to a cell. In other embodiments, a therapeutically effective amount of a fusion protein of the invention is administered to an individual to treat a disease.

For the prevention or treatment of disease, the appropriate dosage of the fusion protein of the invention (when used alone or in combination with one or more other additional therapeutic agents) will depend on the type of disease to be treated, the route of administration, the weight of the patient, the type of fusion protein, the severity and course of the disease, whether the fusion protein is administered for prophylactic or therapeutic purposes, previous or concurrent therapeutic intervention, the patient's clinical history and response to the fusion protein, and the discretion of the attending physician. The practitioner responsible for administration will determine at any event the concentration of the active ingredient in the composition and the appropriate dosage for the individual subject. Various dosing regimens are contemplated herein, including, but not limited to, single or multiple administrations at various time points, bolus administration, and pulse infusion.

The following examples merely represent several embodiments of the present invention, which are described in more detail and detail, but are not to be construed as limiting the scope of the present invention. It should be noted that various changes and modifications can be made by those skilled in the art without departing from the spirit of the invention, and these changes and modifications are all within the scope of the invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Example (b):

unless otherwise indicated, the percentage concentrations in the examples are mass volume percentage concentrations. For example, a 2% agarose gel indicates that 100ml of the gel contains 2g of agarose. 10% fetal bovine serum means that 10g fetal bovine serum is contained in a volume of 100 ml.

Therefore, a molecular construction method capable of obviously improving the immunity and anti-tumor activity of human interleukin-10 fusion protein medicines and an evaluation method thereof are developed, and the method comprises the following specific steps:

example 1: IL-10-hFc fusion protein molecule construction

The Fc segment of human IgG1 antibody is subjected to site-directed mutagenesis according to EU numbering mode to construct three plasmids, namely PCDNA3.4A-RO354, PCDNA3.4A-RO355 and PCDNA3.4A-RO356, wherein the molecular structures of three target fragments are as follows: and (3) RO354: igG general signal peptide-IL 10-GSGSGSGS-hIgG1 Fc (hinge region + CH2+ CH3, containing E233P, P238A, D265A mutations); and (3) RO355: igG general signal peptide-IL 10-GSGSGSGS-hIgG1 Fc (hinge region + CH2+ CH3, containing N297A, L235A, N434A mutations); and RO356: igG general signal peptide-IL 10-GSGSGSGS-hIgG1 Fc (hinge region + CH2+ CH3, containing A327Q, G237A, L235A mutations). The isotype controls PCDNA3.4A-R0359 and PCDNA3.4A-R0330 were constructed simultaneously. PCDNA3.4A-R0359 includes PCDNA3.4A-R0359VCHE and PCDNA3.4A-R0359VCLE, the molecular structure is PCDNA3.4A-R0359VCHE, igG general signal peptide-anti-HIV VH-hIgG1.3CH (CH 1+ hinge region + CH2+ CH 3), PCDNA3.4A-R0359VCLE, igG general signal peptide-anti-HIV VL-hIgKC, and the polypeptide expressed by isotype control PCDNA3.4A-R0359 is R0359. The molecular structure of R0330 is as follows, igG general signal peptide-IL 10-GSGSGSGSGS-hIgG 1 Fc (hinge region + CH2+ CH3, containing L234A, L235E, G237A, and deleting K at 447 position, which is Fc variant of BaishiGuibao company, as the contrast of the invention);

the plasmid map constructed above is shown in FIG. 1, the nucleic acid sequence of each fusion protein is shown in FIG. 2, and the amino acid sequence is shown in FIG. 3.

The main instruments used in the experiment: PCR instrument (Tprofessional TR 20); an electrophoresis apparatus (DYY-TC); gel imager (Smart Gel N); a centrifuge (H1650-W); micro thermostats (HW-8C); clean bench (SDJ series); a constant temperature oscillator (H2-9211K); a constant temperature water bath (HH-4A);

the main reagent used in the experiment is pcDNA ^TM 3.4TOPO ^TM TA Cloning Kit (Invitrogen A14697); 5-alpha Competent E.coli (nett E. Coli) (NEB C2987I); DL2000 DNA Marker (TAKARA 3427A); q5 High Fidelity DHA Polymerase (High-Fidelity DNA Polymerase) (NEB M0491L); axyPrep DNA Gel Extraction Kit (Gel Extraction Kit) (AxyGEN AP-GX-50); hind III (NEB); ecoRI (NEB); t4 DNA ligase (TAKARA 2011A); endotoxin-free plasmid macroimprovement kit (TIANGEN DP);

experimental procedure

(1) Gene synthesis

The amino acid sequences of R0354, R0355, R0356, R0359 and R0330 were each subjected to humanized base optimization, and their encoding nucleotide sequences were synthesized artificially. The coding nucleic acid sequences of R0354, R0355, R0356, R0359 and R0330 are shown in SEQ ID NO.

(2) Vector selection

The PCDNA3.4A vector is selected according to the purpose of the plasmid to be constructed, the yield of the foreign gene expression product, the preparation difficulty of the vector DNA and the analysis result of the enzyme cutting sites of the vector and the target fragment. The vector was purchased from Invitrogen corporation, and the constructed plasmid map is shown in FIG. 1.

(3) Primer design

The primers are designed by SnapGene software (SnapGene Version 1.1.3), and the sequences of a pair of specific oligonucleotide primers for amplifying R0354, R0355 and R0356 are finally determined to be 1F 5'-CCGCAAGCTTGCCACCATGGGATGGTCATGCATAATACTC-3' (SEQ ID NO: 12); 1R 5' -CCGGAATTCTCATTACTTGCCGGGGCTCAGGCTCAG-3 (SEQ ID NO: 13), the length of the amplified product fragment is 1288bp; amplification of R0359VCHE A pair of specific oligonucleotide primer sequences 2F 5'-CCGCAAGCTTGCCACCATGGGATGGTCATGCATAATAC-3' (SEQ ID NO: 14); 2R 5'-CCGGAATTCTCATTACTTGCCAGGGGACAGAGACAGGGACTTC-3' (SEQ ID NO: 15), the length of the amplified product fragment is 1432bp; amplifying R0359VCLE with specific oligonucleotide primer sequence 2F 5'-CCGCAAGCTTGCCACCATGGGATGGTCATGCATAATAC-3';3R 5'-CCGGAATTCTCATTAACATTCACCGCGATTAAAGGACTTTGTC-3' (SEQ ID NO: 16), and the length of the amplified product fragment is 748bp; a pair of specific oligonucleotide primer sequences for amplifying R0330 is 1F 5'-CCGCAAGCTTGCCACCATGGGATGGTCATGCATAATACTC-3' (SEQ ID NO: 12); 4R 5'-CCGGAATTCTCATTAGCCAGGGGACAGAGACAGGGACTTC-3' (SEQ ID NO: 23), and the length of the amplified product fragment is 1270bp. (4) PCR amplification

Using a PCR instrument (Tprofessional TR 20), using a Q5 High Fidelity DNA Polymerase (High-Fidelity DNA Polymerase) (NEB M0491L) and using the synthesized sequence as a template, and using primers 1F/1R respectively; 2F/2R;2F/3R was subjected to PCR amplification.

Total volume of reaction: 50 μ L of PCR-containing 5 Xbuffer 10 μ L, high GC buffer 10 μ L, DNA template 0.5 μ L, Q5 High Fidelity DHA Polymerase 0.5 μ L, dNTP (25 mM) 4 μ L, and specific upper and lower primers (final concentration 200 nmol/L) each 1.5 μ L, and sterile double distilled water was added to a total volume of 50 μ L;

reaction conditions are as follows: pre-denaturation at 94 ℃ for 5 min followed by subsequent denaturation at 94 ℃ for 30 sec, followed by annealing at 55 ℃ for 30 sec and extension at 72 ℃ for 1 min 30 sec for 30 cycles.

(5) Amplification product purification

The amplification product obtained in step (4) was subjected to electrophoresis using agarose gel containing 2g of agarose per 100ml of gel by an electrophoresis apparatus (DYY-TC) to detect whether or not the fragment of interest was produced using DL2000 DNA Marker (TAKARA 3427A). The results were visualized by a Gel imager (Smart Gel N), and the PCR products were electrophoresed to show a single band with sizes of about 1.3Kb,1.4Kb,800bp, and 1.3Kb without bands, indicating that the PCR products were single and non-specific amplification did not occur. The purified product was recovered using Axygen agarose Gel recovery Kit (AxyPrep DNA Gel Extraction Kit, axyGEN AP-GX-50) to obtain the target DNA molecule.

(6) Restriction of vectors and fragments of interest

Performing double enzyme digestion on target DNA molecules and carrier molecules by Hind III (NEB) and EcoRI (NEB) to obtain corresponding sticky ends, and performing enzyme digestion reaction in water bath at 37 ℃ for 1h (the reaction system is Hind III 1 mu L, ecoRI 1 mu L, 10 multiplied by buffer solution 5 mu L, plasmid/DNA 10 mu L-12 mu L is less than or equal to 1 mu g, the total volume is 50 mu L (the sterile water is supplemented to the total volume), and the reaction condition is that the temperature is 37 ℃ and the enzyme digestion is performed for 1 hour); and (3) recovering the large fragment of the vector enzyme by 2% agarose gel electrophoresis, and directly recovering the enzyme-digested fragment of the target gene by using an Axygen agarose gel recovery kit.

(7) Ligation transformation

The large fragment recovered by digestion of the vector was ligated with the digestion fragment of the target gene, and reacted at 16 ℃ for 4 hours with T4 ligase (reaction system: 0.5. Mu.L of the digestion fragment of the vector; 3.8. Mu.L of the digestion fragment of the target gene; 0.5. Mu.L of the DNA ligase of T4; 0.5. Mu.L of 10 XT 4 DNA buffer). All the ligation products were mixed with 120ul DH5 α competent bacteria (NEB C2987I), ice-cooled for 30min, heat-shocked at 42 ℃ for 90s, immediately placed on ice for 2min, added with 450ul LB medium preheated to room temperature, cultured on a 37 ℃ constant temperature shaker (H2-9211K) for 60min, centrifuged with a centrifuge (H1650-W), mixed with a pipette, spread evenly on 100ug of ampicillin per ml LB plate, and cultured in an inverted incubator (HW-8C) at 37 ℃ overnight.

(8) Picking monoclonal bacteria PCR verification

And (3) selecting 9 single colonies, inoculating the single colonies into LB culture solution containing 100ug of ampicillin per ml, shaking and culturing at 250rpm and 37 ℃ for 5 hours at a constant temperature, amplifying the bacterial solution, selecting positive bacterial solution, and performing sequencing verification.

(9) Sequencing and result determination

Comparing the sequencing result with the designed sequence to obtain the sequences of three target genes and two isotype control sequences, and extracting the plasmid by using an endotoxin-free plasmid large-extraction kit (TIANGEN DP). The gene sequences of the five molecules are shown in FIG. 2.

Example 2 preparation and purification methods of fusion proteins R0330, R0354, R0355, R0356, and R0359

1) Preparation method of IL-10 fusion protein R0330/R0354/R0355/R0356/R0359

To obtain more proteins of interest, we used transient transfection to express proteins and constructed the corresponding 4 expression vector plasmids, PCDNA3.4A-RO354, PCDNA3.4A-RO355 PCDNA3.4A-RO356 and PCDNA3.4A-R0359; PEI (biosciences; MW 40000) was used to transfect Expi293 (ThermoFisher Scientific; A14635) for large-scale transient expression; samples were harvested by continuous culture for 7 days and centrifugation.

The experimental steps are as follows:

expi293 (ThermoFisher Scientific; A14635) cells one day prior to transient transfection were passaged, 1L shake flasks (conning; 431147) were inoculated with Dynamis medium (gibco; A2617502) at a density of 2E6, and placed in a cell culture shaker (Adolf Kuhner; ISF 4-XC) at 37 ℃;8% CO ₂ (ii) a Culturing at 120 rpm;

on the day of transfection, expi293 cells were counted using a cell counter (Countstar; IC 1000), diluted with fresh DY to adjust the cell density to 2.9E6; preparing for transfection; PEI: DNA =3:1; adding the DNA-PEI mixture to Expi293 cells, mixing well, placing in a cell culture shaker (Adolf Kuhner; ISF 4-XC) at 37 ℃;8% of CO ₂ (ii) a Culturing at 120 rpm.

4h after transfection, the double antibody (gibco; 15140122) and anticoagulant (gibco; 0010057) were added

Continuously culturing for 7 days, then collecting samples, and firstly carrying out low speed 1000rpm;10min; centrifuging at 4 deg.C (Hunan apparatus, H2050R), collecting cell supernatant, and centrifuging at 12000rpm again; 30min 4 deg.C; collecting the supernatant; the sample was transferred to a purification group for purification, as follows.

2) Purification method of IL-10 fusion protein R0354/R0355/R0356/R0359/R0330

Purpose of the experiment: separating and purifying from the cell fermentation supernatant to obtain target hIL-10-hFc fusion protein with SE-HPLC purity of more than 95%;

the purification method comprises the following steps: the affinity capture of MabSelect SuRe LX (Protein A), pH5.0 +/-0.1 regulation and chromodex PG200 molecular sieve purification are adopted.

Experimental materials: expi293 cell fermentation supernatant; buffer solution: and (3) buffer solution A:1 XPBS (10mM PB,150mM NaCl, pH7.2, guangzhou chemical Co., ltd., unless otherwise specified,the following reagents were all sourced from Guangzhou chemical Agents plant); buffer B (20mM NaAc, pH 3.4); CIP buffer (0.1M NaOH); neutralization buffer (1M Tris, pH8.0 (aMRescO, 0497-500G)); buffer solution: 0.5M HCitrate (national drug, hu test, 10007108); ultrafiltration concentration tubes (Millipore,

Ultra 15mL Centrifugal Filters，30KDa)。

experimental equipment chromatography packing 1 (GE Healthcare, mabSelect SuRe LX), chromatography column 1 (GE Healthcare, XK16/20, column Volume (CV), 26 ml); a chromatography system: GE Healthcare, AKTA pure150; portable pH meters (Horiba); microplate reader (Epoch, bioTek); a centrifuge (Xiang apparatus, H2050R); chromatography packing 2: bociclon, chromodex PG200, column 2: GE Healthcare, XK26/40, column volume (Colum volume, CV) 188.91ml.

The experimental steps are as follows:

the purification procedure for example of fusion protein R0354 is as follows:

1) Target molecule capture

After regeneration of a chromatography column 1 (GE Healthcare, XK16/20, column Volume (CV), 26 ml) loaded with chromatography packing 1 (GE Healthcare, mabSelect SuRe LX) in a chromatography system (GE Healthcare, AKTA pure 150), 10CV was equilibrated with buffer A, the UV detector (UV Monitor) was reset, and the Expi293 cell fermentation supernatant was loaded in a bubble-sensitive manner. Washing the column with buffer A for 20CV, stepwise eluting with 100% buffer B for 7CV, collecting 20 mAu-20mAu 280nm ultraviolet absorption components, adding 5% neutralization buffer to the collection tube to make the final pH value in the range of 6.0-7.0, washing in place (CIP), washing 3CV with CIP buffer flowing upwards (up-flow), keeping for 3min, and washing 5CV with buffer A flowing downwards (down-flow).

And performing affinity capture on supernatant obtained by centrifuging after cell fermentation according to the process. And analyzing the purity of each captured elution sample by adopting a SE-HPLC (molecular sieve-high performance liquid chromatography) method. The purity results are shown in FIG. 4 a.

2) pH adjustment

The affinity elution fraction was taken, and 0.5M HCitrate was added to adjust pH to 5.0. + -. 0.1, and after standing at Room Temperature (RT) for >1 hour, it was centrifuged at 3500rpm at 4 ℃ for 10min and filtered through a 0.2um filter, and purity analysis was performed by SE-HPLC. The purity results are shown in FIG. 4 b.

3) Fine purification

The pH adjusted samples were concentrated using ultrafiltration concentration tubes (Millipore,

ultra 15mL Centrifugal filters, 30KDa) to target volume to allow sample volume per load<5 percent of the volume of the chromatographic column, and then the molecular sieve fine purification is carried out according to the following flow:

after regeneration of a chromatography column 2 (GE Healthcare, XK26/40, column Volume (CV) 188.91 ml) containing chromatography packing 2 (cromogen PG 200) in a chromatography system, 2CV was equilibrated with buffer a to baseline, the uv detector was reset and the sample was loaded in a bubble-sensitive manner, the column 1.5CV was washed with buffer a, 20 mAu-20mAu 280nm uv absorbing components were collected, 2CV was washed in place (CIP, CIP buffer up-flow (up-flow) for 3min, then buffer a down-flow (down-flow) for 5CV, and then the column was finally stored in CIP buffer, whose chromatography pattern is shown in fig. 4 c.

The collected fractions were individually subjected to SE-HPLC, wherein the purity of the combined 4.B.3-4.C.1 fractions is shown in FIG. 4 d. Thus obtaining hIL-10-hFc fusion protein with the purity of more than 95%.

Example 3 identification of the affinity of the fusion proteins R0330, R0354, R0355, R0356 to Fc receptors by the Fortebio method

Experimental Material

Sample source: fusion proteins R0330, R0354, R0355, and R0356 were from the fusion proteins prepared in example 2. The molecular weight of the polypeptide is 90.24kDa,90.38kDa,90.34kDa and 90.62kDa in sequence.

Fc receptor: fcR gamma I, fcR gamma IIa, fcR gamma IIb, fcR gamma IIIa, and FcRn recombinant proteins were purchased from Acro Biosystems; control hIgG1 (403502, biolegend) and hIgG4 (403702, biolegend)

Buffer system: phosphate buffered saline (SBJ-0032, sen Bei Ga) containing 0.02% Tween 20 (44112-100G-F, merck) (PBST)

A regeneration liquid system: 10mM glycine (G8898-500G, merck)

Instrumentation and equipment

Molecular interaction analyzer ForteBIO (Octet OK) ^e ) (ii) a 96-well plates (Shanghai Jingan bioscience, J09602); anti-Penta-HIS (HIS 1K) (18-5120, fortebio) probe

Experimental methods

FcR gamma I was diluted to 2ug/ml with 1 × PBST buffer and solidified at this concentration to the molecular interaction analyzer ForteBIO (Octet OK) ^e ) On the Anti-Penta-HIS (HIS 1K) (18-5120, fortebio) probe, the receptor-corresponding analytes R0330, R0354, R0355, R0356, hIgG1 and hIgG4 were diluted to 66.67nM with 1 × PBST buffer, respectively. FcRn, fcR gamma IIa, fcR gamma IIb and FcR gamma IIIa were diluted to 3ug/ml with 1 × pbst, respectively, and immobilized at this concentration on the HIS1K probe, and the analytes R0330, R0354, R0355, R0356, hIgG1, hIgG4 for each receptor were diluted to 2 μ M with 1 × pbst buffer, respectively. The probes were equilibrated with PBST for 60s, bound to each receptor for 180s, and after equilibrating the probes with PBST for 90s again, bound to the corresponding analytes R0330, R0354, R0355, R0356, hIgG1, hIgG4 for 180s, and then dissociated for 300s in PBST, and after the probes were rejuvenated and neutralized in 10mM glycine, the next cycle of equilibration, binding, dissociation, and rejuvenated neutralization was performed in this manner. All cycle speeds were set to 1000rpm; the experimental temperature was 30 ℃.

Results and discussion

Compared with wild-type controls hIgG1 and hIgG4, the three molecules R0330, R0354, R0355 and R0356 did not bind to the four receptors FcR gamma I, fcR gamma IIa, fcR gamma IIb and FcR gamma IIIa, but did not have a significantly reduced affinity for FcRn, consistent with the expected results (see table 1).

Table 1: fortebio method for the evaluation of the affinity of R0330, R0354, R0355, R0356, hIgG1, hIgG4 for the FcR gamma I (Table 1 a), fcR gamma IIa (Table 1 b), fcR gamma IIb (Table 1 c), fcR gamma IIIa (Table 1 d) and FcRn (Table 1 e) receptors, respectively

TABLE 1a

Sample ID	Sample loading ID	k _a (1/Ms)	k _d (1/s)	K _D (M)
					R0354	FcR gamma I	4.18E+05	4.87E-03	1.17E-08
R0355	FcR gamma I	8.89E+05	1.00E-02	1.13E-08
					R0356	FcR gamma I	6.44E+04	1.67E-03	2.59E-08
R0330	FcR gamma I	1.07E+05	8.47E-04	7.93E-09
					hIgG1	FcR gamma I	3.41E+05	9.18E-04	2.69E-09
hIgG4	FcR gamma I	9.45E+06	4.96E-02	5.24E-09

TABLE 1b

Sample ID	Sample application ID	k _a (1/Ms)	k _d (1/s)	K _D (M)
					R0354	FcR gamma IIa	1.06E+03	3.67E-03	3.45E-06
R0355	FcR gamma IIa	1.52E+03	7.39E-03	4.87E-06
					R0356	FcR gamma IIa	2.03E+03	6.26E-03	3.08E-06
hIgG1	FcR gamma IIa	1.06E+04	3.67E-03	3.45E-07
					HIgG4	FcR gamma IIa	4.44E+04	5.45E-03	1.26E-07

TABLE 1c

Sample ID	Sample loading ID	k _a (1/Ms)	k _d (1/s)	K _D (M)
					R0354	FcR gamma IIb	1.63E+03	1.07E-02	6.56E-06
R0355	FcR gamma IIb	1.63E+04	2.25E-02	1.38E-06
					R0356	FcR gamma IIb	1.53E+04	2.15E-02	1.41E-06
R0330	FcR gamma IIb	8.41E+03	7.78E-04	9.24E-08
					hIgG1	FcR gamma IIb	3.47E+03	2.05E-03	5.91E-07
HIgG4	FcR gamma IIb	8.49E+03	2.15E-03	2.53E-07

TABLE 1d

TABLE 1e

Sample ID	Sample loading ID	k _a (1/Ms)	k _d (1/s)	K _D (M)
					R0354	FcRn	1.05E+04	4.47E-03	4.24E-07
R0355	FcRn	9.45E+03	1.87E-03	1.97E-07
					R0356	FcRn	3.94E+05	5.72E-02	1.45E-07
hIgG1	FcRn	3.38E+04	5.93E-03	1.75E-07
					HIgG4	FcRn	3.98E+04	5.53E-03	1.39E-07

Example 4: activation of CD8+ T cells and INF-gamma secretion assay

1) The purpose is as follows: the relationship between the degree of activation of CD8+ T cells and the expression of their IL-10 receptor (IL-10R) was explored

Experimental materials: PBMC of normal human origin (blood used in this experiment was a voluntary donation of blood from a company employee, no. 80), CD8+ T isolation kit (Miltenyi, cat: 130-096-495), DPBS (Hyclone, cat: SH 3002802), fetal Bovine Serum (FBS) (Gibco, cat: 10091-148), X-VIVO (LONZA, cat: 04-418Q), anti-CD 8 fluorescent Antibody (Biolegend, cat: 344732), anti-CD 45RO fluorescent Antibody (Biolegend, cat: 304220), anti-hIL-10R fluorescent Antibody (Biolegend, cat: 501404), PE Rat IgG1, isotype control Antibody (Isotype Ct rl) (Biolegend, cat: 400407), anti-CD3 murine monoclonal Antibody (mouse-producer), mouse-producing monoclonal Antibody (CD 24), conventional pipette consumables and the like.

The instrument equipment comprises: biological safety cabinets (ESCO, AC2-4S 1), centrifuges (Hunan instrument laboratory development Co., ltd., L530R), flow cytometers (Beckman Coulter, cytoflex), carbon dioxide incubators (Nippon Susan healthcare facility Co., ltd., MCO-18 AC)

Experimental methods

CD8+ T cell isolation and culture: freshly isolated PBMC from normal humans were taken at approximately 1X10 ⁸ CD8+ T cells were isolated according to the instructions of the CD8+ T isolation kit. anti-CD3 murine mAb was coated in 24-well plates at 1. Mu.g/mL in advance, and cells were adjusted to 3X 10 with X-VIVO medium containing 10% FBS ⁶ Each/mL, anti-CD28 murine mAb was added to a concentration of 1. Mu.g/mL. Finally, cells were cultured in 24-well plates at 37 ℃ in a carbon dioxide incubator at a volume of 1 mL/well.

Cell detection: CD8+ T cells cultured in a 24-well plate are collected on the 0 th day, the 3 rd day and the 6 th day respectively, after PBS is washed once, anti-CD 8 fluorescent antibody, CD45RO fluorescent antibody and anti-hIL-10R fluorescent antibody are added, anti-CD 8 fluorescent antibody, CD45RO fluorescent antibody, PE Rat IgG1 and kappa isotype control antibody are added into a control group, after the control group is incubated for 30min at 4 ℃, PBS is used for washing the cells once again, and the expression of IL-10R is detected by a flow cytometer.

The experimental results are as follows: non-activated CD8+ T cells (CD 8+, CD45 RO-) expressed IL-10R very little, and stimulated activated CD8+ T cells (CD 8+, CD45RO +) expressed IL-10R at a higher level on day three and increased on day 6 (see FIG. 4), with gray lines indicating isotype control for anti IL-10R antibody and black lines indicating anti IL-10R. CD8+ T isolated from PBMC were cultured for 6 days using anti-CD3 antibody (10. Mu.g/mL, precoated in 96-well plates) and anti-CD28 (1. Mu.g/mL, free). The expression of IL-10R in CD8+ T cells stimulated by the above method at

days

0,3 and 6 is shown: the number of CD8+ T cell IL-10R was less at day 1, the number of CD8+ T cell IL-10R was significantly increased at day 3, and the number of CD8+ T cell IL-10R was continuously and significantly increased at day 6.

Example 5: INF-gamma secretion assay for activated CD8+ T cells

2) The purpose is as follows: IL-10 fusion proteins promote secretion of activated CD8+ T cell INF-gamma

Experimental materials: PBMC of normal human origin (blood used in this experiment was a voluntary donation of blood from a company employee, numbered 110), CD8+ T isolation kit (Miltenyi, cat: 130-045-201), DPBS (Hyclone, cat: SH 3002802), FBS (Gibco, cat: 10091-148), X-VIVO (LONZA, cat: 04-418Q), CD8 fluorescent antibody (Biolegend, cat: 344732), anti-CD3 murine monoclonal antibody (Merck, SAB4700048-100 TST), anti-CD28 murine monoclonal antibody (Sino Biological, 11524-R007), INF γ detection kit (invitrogen, 88-7316-88), cell culture consumables such as 24-well plates, pipettes, and the like.

The instrument equipment comprises: biological safety cabinets (ESCO, AC2-4S 1), centrifuges (Hunan instrument laboratory development Co., ltd., L530R), flow cytometers (Beckman Coulter, cytoflex), carbon dioxide incubators (Nippon Song health medical instruments Co., ltd., MCO-18 AC), plate readers (Molecular devices, spectramax i3 x)

Experimental methods

CD8+ T cell isolation and culture: freshly isolated PBMC from normal humans were taken at approximately 1X10 ⁸ CD8+ T cells were isolated according to the instructions of the CD8+ T isolation kit. anti-CD3 murine mAb was coated in 24-well plates at 1. Mu.g/mL in advance, and cells were adjusted to 3X 10 with X-VIVO medium containing 10% FBS ⁶ Each/mL, anti-CD28 murine mAb was added to a concentration of 1. Mu.g/mL. Finally, the cells were cultured in a volume of 1 mL/well in a 24-well plate and the carbon dioxide incubator was continued at 37 ℃ for three days.

Cell detection: and (3) taking a small number of cells after separating the CD8+ T cells, performing CD8 phenotypic identification, and detecting the purity of the separated cells.

Stimulation of activated CD8+ T cells by IL-10 fusion proteins: three days after activation of CD8+ T were collected and the cells were resuspended at a density of 2X10 by resuspending the cells in X-VIVO containing 10% FBS ⁶ one/mL, cultured in 96-well plates at a volume of 250. Mu.L/well, with a dose ofIL-10 fusion proteins R0354, R0355, R0356 and isotype control protein R0359, carbon dioxide incubator 37 degrees C continued to culture for three days. Three days after activation, anti-CD3 murine mAb was added again to a concentration of 1. Mu.g/mL and incubation continued for 4h.

Detecting INF gamma: and collecting cell culture supernatant after the culture end point is reached, and detecting the INF gamma content of the cell culture supernatant by using an INF gamma detection kit according to the steps of the INF gamma detection kit specification.

The experimental results are as follows: the self-produced IL-10 fusion proteins R0354, R0355 and R0356 can promote the activated CD8+ T cells to secrete INF gamma, certain differences exist among different donors (see figure 5), and the left graph shows that the purity of the CD8+ T cells of the doror separated in the experiment is 99.75%. The right panel shows the expression of the DONOR CD8+ T cells in this experiment after 3 days of activation with anti-CD3 antibody (10. Mu.g/mL, pre-coated in 96-well plates) and anti-CD28 (1. Mu.g/mL, free), followed by IL-10 fusion protein: secretion of INF γ by cells after 3 days of further culture for R0354, R0355, and R0356 (isotype control for R0359). The experimental result shows that three concentration gradients (10/1/0.1 mu g/mL) of the IL-10 fusion protein can stimulate activated CD8+ T cells to secrete INF gamma, and the activity is R0355> R0354> R0356.

Example 6: establishment of tumor model

1) The purpose is as follows: establishing a tumor model in Balb/c mice by using CT26WT mouse colon cancer cells with different cell densities, and observing the relationship between tumor growth and tumor appearance to determine the cell density required for establishing a stable CT26WT mouse colon cancer model.

Experimental materials: female, balb/c mice; RPMI 1640 medium (Gibco, 11875085), FBS (Gibco, 10091-148), 0.25% trypsin-EDTA (Gibco, 25200056), penicillin-streptomycin (Gibco, 15140122), DMSO (Sigma, D2650), DPBS (Hyclone, SH 30028.02), CT26WT cells (Shanghai cell bank, TCM 37)

The instrument equipment comprises: electronic balance (Shanghai Shunhui scientific instruments Co., ltd., JA 12002), slide caliper (Shanghai Meinaite practice Co., ltd., MNT-150T), microscope (Chongqing Ote optical instruments Co., ltd., BDS 200), medical centrifuge (Hunan Xiang instruments laboratory development Co., ltd., L530R), digital display thermostatic water bath (Puruis mechanical Co., ltd., HH-S), carbon dioxide incubator (Nippon Song health medical instruments Co., ltd., MCO-18 AC), double vertical super clean bench (Sn-free easy cleaning device Co., SW-CJ-VS 2)

The experimental method comprises the following steps: establishment of tumor model in vivo of CT26WT mouse colon cancer: use of complete medium: mouse colon cancer cells CT26WT were cultured in RPMI 1640 medium +10% fetal bovine serum (Gibco, cat: 10091-148) +1% double antibiotic (penicillin-streptomycin 1:1), and the number of viable cells was determined by trypan blue staining. After cell collection, the cells were washed twice with serum-free RPMI 1640 medium to remove complete medium. The axillary skin of the forelimb of a female Balb/c mouse is disinfected by 75% alcohol, and the colon cancer cells of the CT26WT mouse with adjusted density are inoculated under the axillary skin of the forelimb, and the volume of each mouse is inoculated to be 0.2mL. Setting the cell density: balb/c mice were divided into 3 groups of 5 per group, based on the number of different inoculations of cells, i.e.: density 1 (1X 10) ⁵ Individual cells/0.2 mL/cell), density 2 (5X 10) ⁵ Individual cells/0.2 mL/cell), density 3 (1X 10) ⁶ One cell/0.2 mL/one).

Example 7: in vivo anti-tumor evaluation of IL-10 fusion proteins in tumor models

Example 7.1: in vivo anti-tumor evaluation of CT26 mouse colon cancer by R0330, R0354, R0355 and R0356

1) The purpose is as follows: the antitumor activity of R0330, R0354, R0355 and R0356 on colon cancer of CT26 mice was observed, and an isotype control R0359 group and a vehicle control PBS group were set.

Experimental materials: female, balb/c mice; CT26WT cells; RPMI 1640 medium (Gibco, 11875085), FBS (Gibco, 10091-148), 0.25% trypsin-EDTA (Gibco, 25200056), penicillin-streptomycin (Gibco, 15140122), DMSO (Sigma, D2650), DPBS (Hyclone, SH 30028.02)

Experimental methods

Cell culture: mouse colon cancer cells (CT 26WT,) were cultured in RPMI 1640 medium (Gibco) containing 10% fetal bovine serum (Gibco), 1% glutamine and 1% penicillin-streptomycin (1:1).

Inoculation: collecting CT26WT cells in logarithmic growth phase, and regulating cell concentration to 1X10 ⁵ and/mL. 70 female BALB/C mice were inoculated with CT26WT cells subcutaneously in a volume of 0.1 mL/mouse, i.e., 1X10 ⁵ Mice.

Administration: the day of vaccination was recorded as day 0 (D0), day 9, mice were randomized into 6 groups by tumor volume, 10 mice per group, and dosing was started (see table 2 below for dosing regimen).

TABLE 2 CT26WT tumor model dosing dose, regimen and frequency

Recording:

d9 tumor volume was measured and recorded initially, and thereafter tumor major and minor diameters were measured 2 times per week with a vernier caliper. According to the formula: (1/2) X major axis X (minor axis) ² Tumor volumes were calculated (see Table 3; FIG. 6 a). When each mouse reached the end of the experiment (tumor volume over 2000 mm) ³ At the crinis Citrifis endpoint), mice were sacrificed by cervical dislocation and survival curves were recorded (see fig. 6 b).

TABLE 3 evaluation of antitumor Activity in R0330, R0354, R0355, R0356 and R0359 CT26WT models

The experimental results are as follows: r0354 and R0356 were administered intraperitoneally 1 time with significant tumor suppression in the CT26WT model tumor growth compared to vehicle control PBS and isotype control R0359 groups (TGI =70.35% in the R0330 group, TGI =66.0% in the R0354 group, and TGI = 82.71%) as shown in table 3; fig. 6 a. The survival curve is shown in FIG. 6b, the lifetime of R356 is longest, and the rest are R0354, R355 and R0330 in sequence.

Example 7.2: in vivo anti-tumor evaluation of R0356 for B16-F1 mouse melanoma

1) The purpose is as follows: the antitumor activity of R0356 against melanoma in B16-F1 mice was observed, while an isotype control R0359 group was set.

Experimental materials: female, C57BL/6 mice; B16-F1 cells (national laboratory cell resource sharing platform); DMEM (Gibco, 11965084), FBS (Gibco, 10091-148), 0.25% trypsin-EDTA (Gibco, 25200056), penicillin-streptomycin (Gibco, 15140122), DMSO (Sigma, D2650), DPBS (Hyclone, SH 30028.02)

Experimental methods

Cell culture: mouse melanoma cells (B16-F1) were cultured in DMEM medium (Gibco) containing 10% FBS (Gibco), 1% glutamine and 1% penicillin-streptomycin.

Inoculation: collecting B16-F1 cells in logarithmic growth phase, and regulating cell concentration to 2X10 ⁶ and/mL. (1) 20 female C57BL/6 mice were inoculated subcutaneously with B16-F1 cells in a volume of 0.1 mL/mouse, i.e., 2X10 ⁵ Mice.

Administration: the day of vaccination was recorded as day 0 (D0), mice were randomized into 2 groups of 10 mice per group by body weight, and dosing was started (dosing regimen is shown below in table 4).

TABLE 4 dosage, mode and frequency of administration for B16-F1 tumor model

Recording:

d10 tumor volume was measured and recorded initially, and tumor major and minor diameters were measured 2 times per week with a vernier caliper. According to the formula: (1/2) X major axis X (minor axis) ² Tumor volumes were calculated (see table 5).

TABLE 5 evaluation of antitumor Activity of R0356 and R0359B 16-F1 models

The experimental results are as follows: intraperitoneal administration of R0356 2 times showed significant tumor suppression in the B16-F1 model tumor growth compared to the isotype control R0359 group (TGI = 76.94%) (see table 5; fig. 7 c).

Example 7.3: evaluation of antitumor Activity of R0354, R0355 and R0356 on colon cancer of MC38 mice

1) The purpose is as follows: the antitumor activity of R0354, R0355 and R0356 on the colon cancer of MC38 mice was observed, while an isotype control R0359 group was set.

Experimental materials: female, C57BL/6 mice; MC38 cells (national experimental cell resource sharing platform); RPMI Medium 1640 (Gibco, 11875085), FBS (Gibco, 10091-148), 0.25% trypsin-EDTA (Gibco, 25200056), penicilin Streptomyces (Gibco, 15140122), DMSO (Sigma, D2650), DPBS (Hyclone, SH 30028.02)

Experimental methods

Cell culture: mouse colon cancer cells (MC 38) were cultured in RPMI 1640 medium (Gibco) containing 10% fetal bovine serum (Gibco), 1% glutamine and 1% penicillin-streptomycin.

Inoculation: collecting MC38 cells in logarithmic growth phase, and regulating cell concentration to 1X10 ⁷ and/mL. (1) 30 female BALB/C mice were inoculated with MC38 cells subcutaneously in a volume of 0.1 mL/mouse, i.e., 1X10 ⁶ Mice.

Administration: on day 5, mice with more uniform tumor size were selected into groups, randomized into 4 groups of 5 mice by tumor volume, and dosing was started (the dosing schedule is shown in table 6 below).

TABLE 6 dose, regimen and frequency of administration of MC38 tumor models

Recording:

d5 tumor volume was measured and recorded initially, after which tumor major and minor diameters were measured 2 times per week with a vernier caliper. According to the formula: (1/2) X major axis X (minor axis) ² Tumor volumes were calculated (see table 7).

TABLE 7 evaluation of the antitumor Activity of R0354, R0355, R0356 and R0359 MC38 models

The experimental results are as follows: in comparison to the isotype control R0359 group, the low dose of 1mg/kg of R0354, R0355 and R0356 administered only intraperitoneally 1 time had a significant tumor suppression effect on MC38 model tumor growth (TGI =65.32% in the R0354 group, TGI =54.28 in the R0355 group, TGI =74.77% in the R0356 group) (see table 7; fig. 7 d).

The above-mentioned embodiments are intended to illustrate the objects, technical solutions and advantages of the present invention in further detail, and it should be understood that the above-mentioned embodiments are only exemplary embodiments of the present invention and are not intended to limit the present invention, and any modifications, equivalents, improvements and the like made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. An Fc variant which is a three amino acid substitution as compared to a wild-type Fc; the wild-type Fc is IgG1 Fc, wherein

The three amino acid substitutions are selected from E233P, P238A, D265A, according to EU numbering; N297A, L235A, N434A; and a327Q, G237A, L235A.

2. A fusion protein formed by fusing an Fc variant, which is a three amino acid substitution compared to a wild-type Fc, to a polypeptide; the wild-type Fc is IgG1 Fc, wherein

3. The fusion protein of claim 2, wherein the fusion protein has a structure according to formula (I):

a-peptide linker-B or B-peptide linker-A (I),

wherein A is IL-10, IL-6 or IL-12, and the peptide linker is (GS) _n 、(G4S) _n Or absent, wherein n is an integer from 1 to 10 and B is an Fc variant.

4. The fusion protein of claim 3, wherein the A is IL-10.

5. The fusion protein of claim 3, wherein the a is human IL-10.

6. The fusion protein of claim 3, wherein the amino acid sequence of IL-10 is set forth in SEQ ID NO: shown at 17.

7. A nucleic acid encoding the Fc variant of claim 1 or the fusion protein of any one of claims 2-6.

8. The nucleic acid of claim 7, wherein the nucleotide sequence of the nucleic acid is SEQ ID NO 1, SEQ ID NO 3, SEQ ID NO 5, SEQ ID NO 20, SEQ ID NO 21, or SEQ ID NO 22.

9. A pharmaceutical composition comprising the Fc variant of claim 1 or the fusion protein of any one of claims 2-6 and a pharmaceutically acceptable carrier.

10. Use of the Fc variant of claim 1, the fusion protein of any one of claims 2-6, or the pharmaceutical composition of claim 9 in the manufacture of a medicament for treating cancer in an individual in need thereof.

11. The use of claim 10, wherein the cancer is a solid tumor.

12. The use according to claim 11, wherein the solid tumor is colon cancer, melanoma, rectal cancer, breast cancer.

13. The use of claim 10, wherein the subject is a human.