CN112557475B - Exosome separation detection system based on micro-fluidic and ELISA analysis - Google Patents
Exosome separation detection system based on micro-fluidic and ELISA analysis Download PDFInfo
- Publication number
- CN112557475B CN112557475B CN202010103287.6A CN202010103287A CN112557475B CN 112557475 B CN112557475 B CN 112557475B CN 202010103287 A CN202010103287 A CN 202010103287A CN 112557475 B CN112557475 B CN 112557475B
- Authority
- CN
- China
- Prior art keywords
- electrode
- magnetic bead
- sample
- sequence
- layer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
- G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
- G01N27/28—Electrolytic cell components
- G01N27/30—Electrodes, e.g. test electrodes; Half-cells
- G01N27/327—Biochemical electrodes, e.g. electrical or mechanical details for in vitro measurements
- G01N27/3271—Amperometric enzyme electrodes for analytes in body fluids, e.g. glucose in blood
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
- B01L3/00—Containers or dishes for laboratory use, e.g. laboratory glassware; Droppers
- B01L3/50—Containers for the purpose of retaining a material to be analysed, e.g. test tubes
- B01L3/502—Containers for the purpose of retaining a material to be analysed, e.g. test tubes with fluid transport, e.g. in multi-compartment structures
- B01L3/5027—Containers for the purpose of retaining a material to be analysed, e.g. test tubes with fluid transport, e.g. in multi-compartment structures by integrated microfluidic structures, i.e. dimensions of channels and chambers are such that surface tension forces are important, e.g. lab-on-a-chip
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
- G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
- G01N27/416—Systems
- G01N27/48—Systems using polarography, i.e. measuring changes in current under a slowly-varying voltage
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/5308—Immunoassay; Biospecific binding assay; Materials therefor for analytes not provided for elsewhere, e.g. nucleic acids, uric acid, worms, mites
Abstract
The invention provides an exosome separation detection system based on micro-fluidic and ELISA analysis, which comprises a micro-fluidic chip, wherein the micro-fluidic chip comprises a top polydimethylsiloxane layer and a bottom polydimethylsiloxane layer, and a closed microchannel is formed by bonding the bottom polydimethylsiloxane layer and the top polydimethylsiloxane layer; the bottom polydimethylsiloxane layer is provided with a microfluidic pattern, the microfluidic pattern comprises a sample loading area, a sample channel, a separated micro chamber and a sample outlet area, and three electrode sensors are arranged on the top polydimethylsiloxane layer: a working electrode, a counter electrode and a reference electrode. The exosome separation and detection system provided by the invention can be used for continuously separating and detecting exosomes containing specific antigens in a large concentration range, has good accuracy, does not need an exogenous reagent, can work at room temperature, effectively improves the combining capacity of exosomes in a micro-dosage sample, and is convenient to operate.
Description
Technical Field
The invention belongs to the technical field of exosome separation detection, and particularly relates to an exosome separation detection system based on microfluidic and ELISA analysis.
Background
Exosomes are microvesicles actively secreted by living cells into the extracellular environment, coated by phospholipid bilayers, with a size between 30 and 150nm, and belonging to extracellular vesicles. Exosomes can carry proteins, transport RNA, the contents of which include proteins, short-chain peptides, DNA fragments, lncRNA, phospholipids, and miRNA. Besides common markers (such as CD9, CD63, CD81 and the like), the surface of the exosome membrane also expresses various specific markers (such as GPC1, GPC3, PSMA, TMEM256, EpCAM and the like). After secretion, exosomes are transferred through the peripheral blood circulation, targeting parental cellular information and regulatory elements to the target region. This exosome is closely related to the occurrence, development and metastasis of cancer. In view of the important role played by exosomes in cancer occurrence, development and metastasis, the separation and detection of specific exosomes has important significance for disease diagnosis, treatment monitoring and prognosis judgment, and particularly has high diagnosis specificity and diagnosis sensitivity in the aspect of malignant tumor diagnosis.
The current classical separation method of exosomes is ultracentrifugation, ExoQuickTMKit detection, membrane filtration method, etc., which require separation by extremely high centrifugation rate (160,000g)And has the problems of large sample consumption, more impurities, low exosome purity and the like. There are also several exosome detection methods, such as the existing microfluidic technology, which present different technical hurdles. The microfluidic technology refers to science and technology related to a system for processing or operating micro fluid by using a microfluidic chip as a micro pipeline, wherein microchannels of the microfluidic chip are generally in a micron level, and can be freely designed and combined to realize different requirements. However, the research of the current microfluidic technology applied to exosomes has some technical defects, such as low detection sensitivity, very complicated process for manufacturing detection equipment, various and complex required materials, difficulty in realizing separation and detection integration and the like.
Therefore, there is a need to provide a new technical solution to overcome the technical problems in the prior art.
Disclosure of Invention
In order to solve the problems in the prior art, the invention provides an exosome separation detection system based on microfluidic and ELISA analysis, which can continuously separate and detect exosomes containing specific antigens in a large concentration range, has good accuracy, does not need exogenous reagents, can work at room temperature, effectively improves the binding capacity of exosomes in a micro-dose sample, and is convenient to operate.
The invention provides an exosome separation and detection system based on microfluidic and ELISA analysis, which comprises a microfluidic device, wherein the microfluidic device comprises a microfluidic chip, the microfluidic chip comprises a top polydimethylsiloxane layer and a bottom polydimethylsiloxane layer, and a closed microchannel is formed by bonding the top polydimethylsiloxane layer and the bottom polydimethylsiloxane layer; the bottom polydimethylsiloxane layer is provided with a microfluidic pattern, the microfluidic pattern comprises a sample loading area, a sample channel, a separated micro chamber and a sample outlet area, and three electrode sensors are arranged on the top polydimethylsiloxane layer: a working electrode, a counter electrode and a reference electrode. Through the technical scheme, the inventor finds that the required materials for manufacturing the whole exosome separation detection system can be conveniently obtained and manufactured, and meanwhile, the binding capacity of exosomes in a micro-dose sample is improved.
Preferably, in the exosome-separating detection system as described above, the bottom and top polydimethylsiloxane layers are matched in configuration to each other. Through the technical scheme, the inventor finds that the interference or influence of the external environment on the whole exosome separation detection system is reduced through the structure of the closed environment, and meanwhile, the detection accuracy of exosomes in a micro-dose sample is improved.
Preferably, in the exosome separation detection system as described above, the method for preparing the microfluidic pattern comprises: simultaneously photoetching patterns of the sample loading area, the sample channel, the separated micro chamber and the sample outlet area on a Su lambda silicon wafer with the thickness of 80-120 mu m to obtain a photoetched Su lambda silicon wafer; and directly pouring liquid polydimethylsiloxane onto the Su lambda silicon wafer after photoetching, curing for at least 1 hour at the temperature of 60-80 ℃, and stripping the cured polydimethylsiloxane from the Su lambda silicon wafer after photoetching. Through the technical scheme, the inventor finds that through the configuration of the microfluidic pattern, a powerful component performance basis is provided for accurately detecting and separating samples, exosomes and the like, the separation and detection of exosomes in a micro-dose sample are more convenient, and the accuracy of a final result is ensured.
Preferably, in the exosome separation detection system, the sample loading area is of a cylindrical structure, the cross section of the sample loading area is a circle with the diameter of 1-2 mm, and the height of the sample loading area is 0.4-1 mm; the sample channel is of a cylindrical structure, the cross section of the sample channel is circular with the diameter of 0.2-1 mm, and the length of the sample channel is 20-30 mm; the sample outlet area is of a cylindrical structure, the cross section of the sample outlet area is a circle with the diameter of 0.6-1.2 mm, and the height of the sample outlet area is 0.4-1 mm; the partitioned microchamber is of a cylindrical structure, the cross section of the partitioned microchamber is a circular microporous plate with the diameter of 1-1.6 cm, and the height of the microporous plate is 0.6-1 mm; micropores with the diameter of about 1-2 mm are uniformly distributed in the circular microporous plate. Through this technical scheme, the inventor finds that: the micro-dosage liquid sample can be continuously detected and separated, and the micro-dosage liquid sample is convenient to design and easy to manufacture and obtain.
Preferably, in the exosome separation detection system as described above, the three-electrode sensor is prepared by: adhering a silicon dioxide insulating layer with the thickness of not less than 400 mu m to the top polydimethylsiloxane layer, fixing a chromium seed crystal layer with the thickness of 15-25 nm on the silicon dioxide insulating layer, and sputtering two thin film gold layers with the sizes of 2.5 mm x 2.5 mm and the thickness of 400-600 nm on the chromium seed crystal layer, wherein the two thin film gold layers are respectively used as a working electrode and a counter electrode; and (3) forming a silver ink layer with the size of 1.2mm x 10 mm and the thickness of 400-600 nm on a single chromium seed crystal layer with the thickness of 15-25 nm by using silver ink spraying, and using the silver ink layer as a reference electrode. Through the technical scheme, the inventor finds that a uniform electrochemical sensing interface is obtained, the binding capacity of the nano magnetic bead-aptamer compound and a specific exosome in a detected sample is improved, and the detection performance and the separation accuracy are optimized.
Preferably, in the exosome separation detection system as described above, the three-electrode sensor mounting method includes: cutting a silicon wafer with a sensing electrode on the top into cuboid or cube small blocks (the side length is not more than 5 mm), and placing the cuboid or cube small blocks above the partitioned micro-chamber to correspond to the corresponding positions of the working electrode, the counting electrode and the reference electrode; the placing positions are as follows: the working electrode is opposite to the counting electrode, and the distance between the working electrode and the counting electrode is 2-3 cm; the reference electrode is arranged beside the working electrode, and the distance between the reference electrode and the working electrode is 1.6-2 cm; and pouring the liquid polydimethylsiloxane around the three electrode sensors to form a uniform sensor layer with the thickness of 400-600 nm. By adopting the technical scheme, the electrode and the external potentiostat are conveniently connected, a uniform electrochemical sensing interface is conveniently obtained, the binding capacity of the nano magnetic bead-aptamer compound and a specific exosome in a detected sample is improved, the detection performance is optimized, and the separation accuracy is improved.
Preferably, in the exosome separation detection system as described above, a nanobead-aptamer complex is loaded in the partitioned microchamber, and the nanobead-aptamer complex comprises an aptamer sequence; the aptamer sequence has a hairpin structure, and is as follows: 5 'lambda-Fc-artificially synthesized nucleotide sequence-biotin-3'; wherein, the Fc is ferrocene, and the biotin is biotin. By adopting the technical scheme, the specific binding capacity, the separation and the detection accuracy of exosomes in each detected sample can be improved.
Preferably, in the exosome separation and detection system as described above, the artificially synthesized nucleotide sequence includes sequence 1 shown in the sequence table, and sequence 1 shown in the sequence table includes sequence 2 shown in the sequence table. By adopting the technical scheme, the specific binding capacity of exosomes in each detected sample is improved.
Preferably, in the exosome separation and detection system, the preparation method of the nanobead-aptamer complex comprises the following steps: adding aptamer sequence solution (30. mu.l, 5. mu.M) into different volumes (40. mu.L, 50. mu.L, 60. mu.L, 80. mu.L, 100. mu.L, 120. mu.L) of magnetic bead resuspension (100 ng/mL) to obtain a preparation mixture; incubating and reacting the prepared mixed solution for at least 2 hours at the temperature of 20-40 ℃; then, it was placed on a magnetic rack for at least 1min, the supernatant was removed, followed by washing twice with buffer B; obtaining a nanobead-aptamer complex after repeating the washing step twice; the preparation method of the magnetic bead resuspension comprises the following steps: streptavidin-coated nanobeads (bead amount 3X 10) were washed with 500. mu.L of buffer A11/mL) to obtain a nano magnetic bead treatment solution 1; then 50 mul of nano magnetic bead processing liquid 1 is taken, and 50 mul of buffer solution A is added into the nano magnetic bead processing liquid 1 to obtain nano magnetic bead processing liquid 2; incubating the nano magnetic bead treatment solution 2 for 15 minutes, placing the incubated nano magnetic bead treatment solution on a magnetic frame, and standing for at least 1 min; removing the supernatant, washing the nano magnetic bead precipitate twice by using 500 mu L of buffer solution B, and then adding 500 mu L of buffer solution B for resuspension to obtain a magnetic bead resuspension solution; the formulation of buffer A was 100mM Tris-HCl, 1mM EDTA and 2M NaCl (pH 7.5); the formulation of buffer B was 5mM Tris-HCl, 0.5mM EDTA and 100mM NaCl (pH 7.5); the preparation method of the aptamer sequence solution comprises the following steps: dissolving the aptamer sequence in 1 XPBS buffer (pH 7.4) to obtain an aptamer sequence solution; wherein the aptamer sequence is 5'lambda-Fc-artificially synthesized nucleotide sequence-biotin-3', wherein the artificially synthesized nucleotide sequence comprises a sequence 1 shown in a sequence table, the sequence 1 shown in the sequence table comprises a sequence 2 shown in the sequence table, and the sequence 2 shown in the sequence table is a sequence specifically combined with an antigen on an exosome. By adopting the technical scheme, the proportion of the nano magnetic beads to the aptamer sequence solution is optimized, and the specific binding capacity of the nano aptamer compound in combination with exosomes in a micro-dose detected sample and the separation detection accuracy are improved.
Preferably, in the exosome separation and detection system, a buffer C is used to resuspend the nanobead-aptamer complex, and then the nanobead-aptamer complex is loaded into the partitioned microchamber, a magnetic field generating device is disposed below the partitioned microchamber, and the formula of the buffer C is as follows: 100mM Tris-HCl, 100mM NaCl, 1mM MgCl2And 5mM KCl (pH = 7.4). By the technical scheme, the sufficient salt ion concentration is improved during separation detection, a uniform electrochemical sensing interface is obtained, and the specific binding capacity of exosomes in a micro-dose detected sample and the separation detection accuracy are improved.
The beneficial effects created by the invention are as follows:
(1) the invention provides a customizable disposable micro-fluidic chip modified by a nano magnetic bead-aptamer compound, which is used for continuously separating and detecting components such as CD63+ exosomes and the like in a large concentration range and has good accuracy.
(2) The present invention operates at room temperature through a microfluidic electrochemical detector with continuous monitoring in vitro, without the need for exogenous reagents, and can be reconfigured by modular exchange probes to measure different target molecules.
(3) The aptamer sequence modified by a biotin group and ferrocene (Fc) redox label is fixed on a magnetic bead through the strongest non-covalent interaction between streptavidin and biotin, wherein the aptamer sequence comprises a sequence specifically combined with components such as an exosome surface antigen CD63 and the like. Once components such as CD63+ exosomes are bound to the aptamer sequence, the hairpin structure of the aptamer sequence unfolds, allowing Fc oxygenThe redox molecules are far away from the electrodes, reducing the electron transfer efficiency. The change in redox current was measured by square wave voltammetry and was found to be highly sensitive to the concentration of components including CD63+ exosomes. The optimized biosensor greatly improved the micro-dose sample (as low as 10000 times diluted sample of 1 μ L (2.4 x 10)3Mu L, even lower concentration)) has the advantages of high efficiency, low detection limit, high specificity, convenient operation and the like.
Drawings
In order to more clearly illustrate the technical solution of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to these drawings without inventive effort.
FIG. 1 is a schematic diagram of the structure of a microfluidic chip according to the present invention;
FIG. 2 is a graph showing the relationship between the current obtained by square wave voltammetry monitoring and the volume of a 100ng/mL nanobead solution when 30. mu.L of a 5. mu.M aptamer solution and the 100ng/mL nanobead solution react;
FIG. 3 is a graph showing the relationship between the flow rate and the current response of a microfluidic chip based on a nano magnetic bead-aptamer complex to CD63+ exosomes (100/. mu.L);
FIG. 4 is a graph showing the separation and detection results of exosomes in experimental samples using the microfluidic chip of the present invention;
FIG. 5 comparison of microfluidic chip method, ultra-ionization method, and ExoQuick based on nanoparticle tracking analysisTMA comparative diagram of exosome results obtained by separation by a kit method;
FIG. 6 compares the microfluidic chip method, the ultra-separation method, and the ExoQuick based on Western-BlotTMA comparative diagram of exosome results obtained by separation by a kit method;
FIG. 7 Electron microscope based microfluidic chip method, ultra-ionization method, and ExoQuickTMA comparative diagram of the exosome results obtained by the kit method.
Detailed Description
The experimental methods of the following examples, which are not specified under specific conditions, are generally determined according to national standards. If there is no corresponding national standard, it is carried out according to the usual international standards, to the conventional conditions or to the conditions recommended by the manufacturer.
The features mentioned with reference to the invention or the features mentioned with reference to the embodiments can be combined. All the features disclosed in this specification may be combined in any combination, and each feature disclosed in this specification may be replaced by alternative features serving the same, equivalent or similar purpose. Thus, unless expressly stated otherwise, the features disclosed are merely generic examples of equivalent or similar features.
In the present invention, all embodiments and preferred embodiments mentioned herein may be combined with each other to form a new technical solution, if not specifically stated.
In the present invention, the "ultracentrifugation method" and the "ultracentrifugation method" as referred to herein mean the same concept unless otherwise specified.
In the present invention, the waste liquid collecting region mentioned herein may use the following products, if not specifically mentioned: such as a laboratory waste tank.
In order to make the technical means, the original characteristics, the achieved purposes and the effects of the invention easy to understand, the invention is further described with the specific embodiments, but the invention includes but is not limited to the embodiments.
Potentiostats (model No. CHI660E, available from shanghai chen instruments ltd);
zetaview instruments (Particle Metrix, Germany, available from Shanghai Xiaopeng Biotech, Inc.);
syringe pumps (doctor 2000, harvard instruments, usa);
fetal bovine serum (Hyclone, SH30406.05, available from wuhan punuosai life science ltd);
nanobead (purchased from Ocean NanoTech, cat # SS 0200);
magnetic frame (purchased from Shenzhen Huanyankang Gene science and technology Limited, the catalog number is IDN 06-C-P1);
a magnet (1.5 mm. times.1.5 mm, available from Huizzimagnet, Inc., of Dongguan);
streptavidin (available from sigma under the cat designation 189730);
laboratory waste liquid tank (purchased from Wuhan south-north medical equipment Co., Ltd.)
The relevant reagents are all common reagents which are commercially available.
Example 1 exosome separation detection method based on microfluidic and ELISA analysis
The embodiment provides a technical method for detecting an exosome surface antigen CD63 based on microfluidic and ELISA analysis methods to separate exosomes and realize continuous detection of exosome concentration.
Firstly, a Ferrocene (Fc, Ferrocene, molecular formula is Fe (C) through the interaction of streptavidin and biotin5H5)2) A labeled aptamer sequence, having a hairpin structure containing a sequence complementary to the exosome surface antigen CD63, was immobilized on nanobeads (200 nm in size). The aptamer-modified nano magnetic beads are loaded on a microfluidic chip obtained by a dimethyl siloxane compression mold, and an electrochemical sensing interface is formed under the action of a magnetic field (generated by a magnet with the model of 1.5mm multiplied by 1.5 mm) after current is switched on. Binding of the CD63+ exosomes may trigger the development of a hairpin of aptamer sequence, pushing the Fc redox molecule away from the sensing interface, followed by turning off the electrochemical signal (as shown in figure 1). The microfluidic device or the microfluidic system is simple and easy to implement, and provides a universal fixed-point biosensing platform for in-vitro continuous detection and separation of exosomes in a body fluid sample.
The microfluidic system is mainly realized by a microfluidic chip, an injection pump and a waste liquid collecting region, wherein the microfluidic chip consists of a top polydimethylsiloxane layer, a bottom polydimethylsiloxane layer and a cover glass. The bottom polydimethylsiloxane layer is provided with a microfluidic pattern, and the microfluidic pattern comprises a sample loading area, a sample channel, a separated microchamber of a sensing area and a sample outlet area; the top polydimethylsiloxane layer comprises three electrode sensors of the sensing area: a working electrode, a counter electrode and a reference electrode. The two layers of polydimethylsiloxane are bonded to form a closed micro-channel, the two polydimethylsiloxane layers are ensured to be matched with each other, and then the polydimethylsiloxane at the bottom is fixed on the cover glass.
The microfluidic pattern comprises a sampling area, a sample channel, a partitioned microchamber of a sensing area and a sample outlet area in sequence. The model of the microfluidic pattern is realized by simultaneously photoetching patterns of a sample loading area, a sample channel, a partitioned microchamber of a sensing area and a sample outlet area on a Su lambda silicon wafer with the thickness of 100 mu m; after photolithography, liquid polydimethylsiloxane was poured directly onto the microfluidic pattern model and then cured in an oven at 65 ℃ for 2 hours. And finally, stripping the cured polydimethylsiloxane from the microfluidic pattern model to obtain the microfluidic pattern. The polydimethylsiloxane layer where the microfluidic pattern is located is the bottom polydimethylsiloxane layer.
In the microfluidic pattern, the loading area is a cylindrical structure whose cross section is a circle with a diameter of 1.2mm and whose height is 0.5 mm. The sample channel is a cylindrical structure, the cross section of the sample channel is a circle with the diameter of 0.3mm, and the length of the sample channel is 25 mm. The sample outlet area is of a cylindrical structure, the cross section of the sample outlet area is a circle with the diameter of 0.8mm, and the height of the sample outlet area is 0.5 mm. The sensing area comprises a working electrode, a counting electrode, a reference electrode and a separated micro chamber; wherein, the separated micro-chamber is a cylinder structure, the cross section of the separated micro-chamber is a circular micro-porous plate with the diameter of 1.2 cm, and the height of the separated micro-chamber is 0.8 mm; micropores with the diameter of about 1mm are uniformly distributed in the circular microporous plate, and the distance between the micropores is 0.3 mm.
For three electrode sensors mounted on the top polydimethylsiloxane layer, three electrode sensors are mainly fabricated on a 525 μm thick silicon dioxide insulating layer. The specific preparation method of the three-electrode sensor is as follows: a 525 μm thick silicon dioxide insulating layer was glued on top of the polydimethylsiloxane layer, then a 20nm thick chromium seed layer was fixed on top of the silicon dioxide insulating layer, followed by sputtering two thin film gold layers of 2.5 mm x 2.5 mm thickness and 500nm thickness on the chromium seed layer, which would be used as the working electrode and the counter electrode, respectively. A silver ink layer of 1.2mm x 10 mm in size and 500nm in thickness was spray coated with silver ink on a separate 20nm thick chromium seed layer as a reference electrode.
The specific mounting method of the three electrode sensors is as follows: cutting a silicon wafer with a sensing electrode on the top into cuboid or cube small blocks (the side length is 4 mm), placing the cuboid or cube small blocks above a separated micro chamber of a polydimethylsiloxane layer at the bottom, and corresponding to thin film gold and silver ink layers of the polydimethylsiloxane layer at the top, namely corresponding to the positions of a working electrode, a counting electrode and a reference electrode respectively; the placing positions are as follows: the working electrode is opposite to the counting electrode, and the distance between the working electrode and the counting electrode is 2.5 cm; the reference electrode was next to the working electrode, and the distance between the reference electrode and the working electrode was 1.8 cm. Liquid polydimethylsiloxane was poured around the three electrode sensors to form a uniform sensor layer with a thickness of 500 nm. The three electrode sensors are connected with the three separated static lines through conductive adhesive, and the conductive adhesive is connected with an external constant potential rectifier. And finally, combining the bottom polydimethylsiloxane layer containing the microfluidic chip with the top polydimethylsiloxane layer to form a closed microchannel so as to ensure that the two polydimethylsiloxane layers are matched with each other. A square magnet (1.5 mmx 1.5mm in size) was mounted below the partitioned microchamber. When the liquid sample to be detected flows through the sensing area, exosomes in the sample to be detected can be specifically combined and precipitated with the nano magnetic bead-aptamer complex in the sensing area, so that the purpose of detecting the concentration of exosomes is achieved in the process of separating exosomes.
Example 2 preparation method of nano magnetic bead-aptamer complex
This embodiment mainly describes a method for preparing a nanobead-aptamer complex, which includes the following steps:
step one, configuring a buffer solution
The buffer solution mainly comprises the following three types, and the specific formula of the buffer solution is as follows:
(1) and (3) buffer solution A: 100mM Tris-HCl, 1mM EDTA, 2M NaCl (pH 7.5);
(2) and (3) buffer solution B: 5mM Tris-HCl, 0.5mM EDTA and 100mM NaCl (pH 7.5);
(3) and (3) buffer C: 100mM Tris-HCl, 100mM NaCl, 1mM MgCl2And 5mM KCl (pH = 7.4);
step two, preparation of aptamer sequence solution
The aptamer sequence capable of being specifically bound with the nanometer magnetic beads and the exosome surface antigen CD63 at the same time is as follows: 5' lambda-Fc-CACCCCACCTCGCTCCCGTGACACTAATGCTACCAACCCC-biotin-3'; wherein the content of the first and second substances,CACCCCACCTCGCTCCC GTGACACTAATGCTACCAACCCC is shown as a sequence 1 in a sequence table, and underlined sequence is a sequence which is specifically combined with an exosome antigen CD63 ((namely, a sequence 2 shown in the sequence table)). The aptamer sequence is dissolved in 1 XPBS buffer (pH 7.4) to obtain an aptamer sequence solution;
step three: production process of nano magnetic bead-aptamer compound
(1) Streptavidin-coated nanobeads (the amount of beads was 3X 10) were washed with 500. mu.L of buffer A in a 1.5mL tube11The washing mode is that a pipette gun is used for taking a buffer solution to blow and beat the nano magnetic beads for at least 2 times to obtain a nano magnetic bead suspension; then 50 mu L of nano magnetic bead suspension is taken, and 50 mu L of buffer solution A is added into the nano magnetic bead suspension; wherein, the preparation method of the streptavidin-coated nano magnetic bead is referred toCheahEtc. (Studies ofCheah, Joleen S., Yamada, Soichiro. A simple elution strategy for biotinylated proteins bound to streptavidin conjugated beads using excess biotin and heat.Biochemical and Biophysical Research Communications, 03 Oct 2017, 493(4):1522-1527) The method as described in (1);
(2) incubating the solution obtained in the step three (1) for 15 minutes, and then placing the test tube on a magnetic frame for 1-5 min to enable the nano magnetic beads to be precipitated at the bottom of the test tube;
(3) removing the supernatant, washing the nano magnetic bead precipitate twice by using 500 mu L of buffer solution B, and then adding 500 mu L of buffer solution B for resuspension to obtain a magnetic bead resuspension solution;
(4) preparing a nano magnetic bead-aptamer complex: adding the aptamer sequence solution (30 μ L, 5 μ M) prepared in the second step into different volumes (40 μ L, 50 μ L, 60 μ L, 80 μ L, 100 μ L, 120 μ L) of the treated magnetic bead resuspension (100 ng/mL) in the third step, and incubating for 2 hours at the temperature of 20-40 ℃. Then, the tube was placed on a magnetic rack for 1-5 min (to allow the nanobeads to settle), the supernatant was removed, and then washed twice with buffer B. After repeating the washing step twice, obtaining the nanobead-aptamer complex, adding buffer C for resuspension, and loading into the partitioned microchamber described in example 1 (example 6 or 7);
(5) reaction and detection of the microfluidic chip: adding the experimental sample of the fresh culture solution of the human MCF7 cells into the sampling area one by one, adding the experimental sample into the sensing area through the sample channel, and then optimizing the preparation parameters of the nano magnetic bead-aptamer compound. The results showed that the reaction of 30. mu.L of aptamer solution (5 μm) with 60. mu.L of nanobelt resuspension (100 ng/ml) showed the highest current, indicating that the largest amount of aptamer was loaded on the surface of nanobead to form nanobead-aptamer complex, as shown in FIG. 2.
This example mainly describes a method for optimizing the flow rate of a microfluidic chip device according to example 1 (example 6 or 7), including the following steps:
step one, adding aptamer sequence solution (5 μ M) prepared in example 2 into the nano magnetic bead suspension (100 ng/mL) prepared in step three (1) of example 2 according to the volume ratio of 1:2, and incubating at room temperature for 2 hours. The tube was then placed on a magnetic rack to allow the nanobeads to settle, the supernatant removed, and then washed twice with buffer B. After repeating the washing step twice, obtaining the nanobead-aptamer complex, adding buffer C for resuspension, and then loading the complex into the partitioned microchamber described in example 1 (example 6 or 7);
step two, preparation of a CD63+ exosome test solution: using ExoQuickTMKit method for separating and extracting exosome in fresh culture solution of human MCF7 cellsThe method comprises the following steps:
(1) repeatedly freezing and thawing fetal calf serum for 2-3 times, and removing a membrane structure; or selecting serum without exosome to culture human MCF7 cells; after resuscitation at 37 ℃, passage is carried out for 1-2 times, and 50 mL of supernatant is collected in a centrifuge tube;
(2) centrifuging at 1000rpm for 10min, and sucking supernatant;
(3) transferring the cell supernatant to a 50 mL ultrafiltration concentration tube (100 kDa), centrifuging at 3000g rotation speed and 4 ℃ for 30min, and concentrating to 1.2 mL volume;
(4) adding 1/3 volume of cell supernatant exosome extraction reagent (0.4 ml), gently blowing and uniformly mixing by using a pipette tip of a pipette, and standing overnight (16 h) at 4 ℃;
(5) 13000 Xg, centrifuging for 10min at 4 ℃, discarding the supernatant, and obtaining the precipitate as an exosome;
(6) adding 20-50 mu L of 1 XPBS solution for suspension according to the precipitation amount, wherein the volume ratio of the precipitation amount to the 1 XPBS solution is 1: 40-1: 60 is between;
(7) when a western blot experiment is carried out, a CD63 band is clear, and the CD63+ exosome is determined;
(8) packaging the suspension exosome solution into 10 μ L, 20 μ L, 30 μ L, 50 μ L, 70 μ L, 90 μ L and 120 μ L as uniformly as possible;
(9) carrying out exosome counting on the subpackaged exosome samples by a nanoparticle tracking analysis method, wherein the detection method is to adopt a Zetaview instrument for detection;
step three, applying different flow rates (10 μ L, 20 μ L, 30 μ L, 50 μ L, 70 μ L, 90 μ L and 120 μ L of exosome solution added in the step two (8) per minute) to the microfluidic system described in the embodiment 1 (the embodiment 6 or 7) to monitor the current response of the device to 100/μ L of CD63+ exosome test solution;
and step four, controlling all the flow rates flowing to the equipment by using the injection pump.
The experimental result shows that the inventor observes that the maximum current is obtained when the detection is carried out at the flow rate of the exosome solution of 19.6 mu L/min, and the nano magnetic bead-aptamer complex and the exosome of the substance to be detected CD63+ have enough interaction (as shown in figure 3). Therefore, the sample solution was continuously sucked into the microfluidic chip device by starting the syringe pump described in example 1 (example 6 or 7) at a speed of 19.6 μ L/min.
Example 4 Ex vivo isolation and detection of samples Using microfluidic chips in this study
In this embodiment, the microfluidic chip described in embodiment 1 (embodiment 6 or 7) is used for the separation and detection of exosomes from a sample, and includes the following steps:
step one, the operation of the step is carried out according to the step one completed in the embodiment 3;
step two, measuring the oxidation signal of ferrocene in the buffer solution C by using Square Wave Voltammetry (SWV) (specific method reference)Helfrick J C, Bottomley L A. Cyclic square wave voltammetry of single and consecutive reversible electron transfer reactions[J]. Analytical Chemistry, 2009, 81(21): 9041-9047) And scanning from 0.2 to 0.6V;
step three, performing real-time measurement of timing current in a series of experimental samples containing CD63+ with different concentrations (50/muL, 100/muL, 150/muL, 200/muL, 250/muL, 300/muL, 350/muL, 400/muL, 450/muL, 500/muL, 1000/muL) by fixing at a potential of 0.2V for 5000 seconds under the conditions of room temperature and pH 7.5 based on square wave voltammetry, wherein the real-time measurement comprises detection on a serum sample without exosomes;
and step four, selecting a sample of the culture solution of the human MCF7 cell supernatant to carry out microfluidic detection.
The experimental results are shown in FIG. 4, and the number of CD63+ exosomes in the sample of the culture solution of the human MCF7 cell supernatant is concentrated at 350-400/. mu.L. In a control experiment, no change in current was detected when a culture solution without CD63+ exosomes was added to the microfluidic chip.
In some embodiments of the invention, the sample includes, but is not limited to: cell supernatant culture fluid, pleural effusion, serum and plasma.
In some embodiments of the present invention, the microfluidic chip described in this example is used to separate and detect exosomes in microdose samples (10000 times diluted samples (350-. Experimental results show that the microfluidic chip provided by the embodiment improves the capacity of separating and detecting exosomes in a microdose sample (10000 times of diluted sample (350-.
Example 5 microfluidic chip isolation of exosomes and ultra-ionization method, ExoQuickTMComparison of exosome separation results by classical method of kit
This example describes the microfluidic chip described in example 1 for exosome isolation, superisolation, ExoQuickTMThe separation results of exosomes by the classical method of the kit are compared.
Exosomes isolated from the microfluidic chip described in example 1 and the same batch of samples were subjected to ultracentrifugation, ExoQuickTMExosomes obtained by the kit method are detected and compared by a nanoparticle tracking analysis method, a western blot and an electron microscope, and the identification and comparison results are shown in fig. 5-7.
The results show that: as can be seen from fig. 5, the particle size results compared by nanoparticle tracking analysis show that the particle size of exosome is around 100nm in all three methods, but the peak value of the particle size of exosome obtained by the microfluidic separation method described in example 4 is closer to 100nm than that obtained by the other two methods; as can be seen from fig. 6, Western Blot detects CD63, HSC70 and CD9 surface antigens, and the results show that the specificity of the three surface antigens isolated by the microfluidic method described in example 4 is better than that of the other two methods. As can be seen in FIG. 7, the electron microscopy results show that the microfluidic method described in example 4 is used in comparison with ExoQuickTMThe background of the kit separation method is obviously less and much impurities are contained, and compared with the super-separation method, the yield of the exosome is relatively high.
Example 6 exosome separation detection method based on microfluidic and ELISA analysis
The embodiment provides a technical method for detecting an exosome surface antigen CD63 based on microfluidic and ELISA analysis methods to separate exosomes and realize continuous detection of exosome concentration, which is different from the embodiment 1 in that: a method for preparing a microfluidic pattern, a method for preparing a three-electrode sensor and a method for mounting the three-electrode sensor.
The preparation method of the microfluidic pattern comprises the following steps: simultaneously photoetching the patterns of the sample loading area, the sample channel, the separated micro chamber and the sample outlet area on a Su lambda silicon wafer with the thickness of 80 mu m to obtain a photoetched Su lambda silicon wafer; and directly pouring liquid polydimethylsiloxane onto the Su lambda silicon wafer after photoetching, curing for 1 hour at the temperature of 80 ℃, and stripping the cured polydimethylsiloxane from the Su lambda silicon wafer after photoetching.
The sample loading area is of a cylindrical structure, the cross section of the sample loading area is a circle with the diameter of 1mm, and the height of the sample loading area is 0.4 mm; the sample channel is of a cylindrical structure, the cross section of the sample channel is circular with the diameter of 0.2mm, and the length of the sample channel is 20 mm; the sample outlet area is of a cylindrical structure, the cross section of the sample outlet area is a circle with the diameter of 0.6mm, and the height of the sample outlet area is 0.4 mm; the separated micro-chamber is of a cylindrical structure, the cross section of the separated micro-chamber is a circular microporous plate with the diameter of 1cm, and the height of the separated micro-chamber is 0.6 mm; micropores with the diameter of about 2mm are uniformly distributed in the circular microporous plate, and the distance between the micropores is 0.2 mm. .
The preparation method of the three-electrode sensor comprises the following steps: adhering a silicon dioxide insulating layer with the thickness of 400 mu m to the top polydimethylsiloxane layer, fixing a chromium seed crystal layer with the thickness of 15nm on the silicon dioxide insulating layer, and sputtering two film gold with the sizes of 2.5 mm x 2.5 mm and the thickness of 400nm on the chromium seed crystal layer, wherein the two film gold are respectively used as a working electrode and a counting electrode; a 400nm thick layer of silver ink of dimensions 1.2mm x 10 mm was spray coated with silver ink on a single 15nm thick chromium seed layer as a reference electrode.
The mounting method of the three-electrode sensor comprises the following steps: cutting a silicon wafer with a sensing electrode on the top into cuboid or cube small blocks (the side length is 4 mm), and placing the cuboid or cube small blocks above the separated micro-chamber to correspond to the corresponding positions of the working electrode, the counting electrode and the reference electrode; the placing positions are as follows: the working electrode is opposite to the counting electrode, and the working electrode and the counting electrode are separated by 2 cm; the reference electrode is arranged beside the working electrode, and the reference electrode and the working electrode are separated by 1.6 cm; liquid polydimethylsiloxane was poured around the three electrode sensors to form a uniform sensor layer with a thickness of 400 nm.
Example 7 exosome separation detection method based on microfluidic and ELISA analysis
The embodiment provides a technical method for detecting an exosome surface antigen CD63 based on microfluidic and ELISA analysis methods to separate exosomes and realize continuous detection of exosome concentration, which is different from the embodiment 1 in that: a method for preparing a microfluidic pattern, a method for preparing a three-electrode sensor and a method for mounting the three-electrode sensor.
The preparation method of the microfluidic pattern comprises the following steps: simultaneously photoetching the patterns of the sample loading area, the sample channel, the separated micro chamber and the sample outlet area on a Su lambda silicon wafer with the thickness of 120 mu m to obtain a photoetched Su lambda silicon wafer; and directly pouring liquid polydimethylsiloxane onto the Su lambda silicon wafer after photoetching, curing for 2 hours at the temperature of 60 ℃, and stripping the cured polydimethylsiloxane from the Su lambda silicon wafer after photoetching.
The sample loading area is of a cylindrical structure, the cross section of the sample loading area is a circle with the diameter of 2mm, and the height of the sample loading area is 1 mm; the sample channel is of a cylindrical structure, the cross section of the sample channel is circular with the diameter of 1mm, and the length of the sample channel is 30 mm; the sample outlet area is of a cylindrical structure, the cross section of the sample outlet area is a circle with the diameter of 1.2mm, and the height of the sample outlet area is 1 mm; the separated micro-chamber is of a cylindrical structure, the cross section of the separated micro-chamber is a circular microporous plate with the diameter of 1.6cm, and the height of the separated micro-chamber is 1 mm; micropores with the diameter of about 1.5mm are uniformly distributed in the circular microporous plate, and the distance between the micropores is 0.5 mm.
The preparation method of the three-electrode sensor comprises the following steps: adhering a silicon dioxide insulating layer with the thickness of 600 mu m to the top polydimethylsiloxane layer, fixing a chromium seed crystal layer with the thickness of 25nm on the silicon dioxide insulating layer, and sputtering two thin film gold layers with the sizes of 2.5 mm x 2.5 mm and the thickness of 600nm on the chromium seed crystal layer, wherein the two thin film gold layers are respectively used as a working electrode and a counting electrode; a silver ink layer of 1.2mm x 10 mm in size, 600nm thick was spray coated with silver ink on a single 25nm thick chromium seed layer as a reference electrode.
The mounting method of the three-electrode sensor comprises the following steps: cutting a silicon wafer with a sensing electrode on the top into cuboid or cube small blocks (the side length is 5 mm), and placing the cuboid or cube small blocks above the partitioned micro-chamber to correspond to the corresponding positions of the working electrode, the counting electrode and the reference electrode; the placing positions are as follows: the working electrode is opposite to the counting electrode, and the working electrode and the counting electrode are separated by 3 cm; the reference electrode is arranged beside the working electrode, and the reference electrode and the working electrode are separated by 2 cm; liquid polydimethylsiloxane was poured around the three electrode sensors to form a uniform sensor layer with a thickness of 600 nm.
Example 8 microfluidic chip separation of exosomes and ultra-ionization method, ExoQuickTMComparison of exosome separation results by classical method of kit
This example separated exosomes, ultra-separation, ExoQuick for the microfluidic chips described in examples 6 and 7TMThe separation results of exosomes by the classical method of the kit are compared.
Exosomes isolated from the microfluidic chips described in examples 6 and 7, and the same batch of samples were obtained by ultracentrifugation, ExoQuickTMThe exosome obtained by the kit method is detected, compared, identified and compared by a nanoparticle tracking analysis method, a western blot and an electron microscope.
The results show that: particle size results compared by a nanoparticle tracking analysis method show that the particle size of exosomes is about 100nm by the three methods, but the particle size peak value of exosomes obtained by the microfluidic separation method in the embodiment 4 is closer to 100nm than that of exosomes obtained by the other two methods; the Western Blot for detecting the surface antigens CD63, HSC70 and CD9 shows that the specificity of the three surface antigens of the exosome obtained by the microfluidic separation method in the embodiment 4 is better than that of the other two methods. The electron microscope results show that the method adopts the implementationExample 4 microfluidic methods compare ExoQuickTMThe background of the kit separation method is obviously less and much impurities are contained, and compared with the super-separation method, the yield of the exosome is relatively high. The inventor finds that the overall performance of the microfluidic chip in example 7 is improved by 5-10% compared with that of the microfluidic chip in example 1 or 6.
The foregoing shows and describes the general principles and broad features of the present invention and advantages thereof. It will be understood by those skilled in the art that the present invention is not limited to the embodiments described above, which are described in the specification and illustrated only to illustrate the principle of the present invention, but that various changes and modifications may be made therein without departing from the spirit and scope of the present invention, which fall within the scope of the invention as claimed. The scope of the invention is defined by the appended claims and equivalents thereof.
Sequence listing
<110> Nanjing Ke medical technology Co., Ltd
<120> exosome separation detection system based on micro-fluidic and ELISA analysis
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 40
<212> DNA
<213> Artificial sequence ("Artificial sequence")
<400> 1
caccccacct cgctcccgtg acactaatgc taccaacccc 40
<210> 2
<211> 32
<212> DNA
<213> Artificial sequence ("Artificial sequence")
<400> 2
caccccacct cgctcccgtg acactaatgc ta 32
Claims (6)
1. The exosome separation and detection system based on microfluidic and ELISA analysis is characterized by comprising a microfluidic device, wherein the microfluidic device comprises a microfluidic chip, the microfluidic chip comprises a top polydimethylsiloxane layer and a bottom polydimethylsiloxane layer, and a closed microchannel is formed by bonding the top polydimethylsiloxane layer and the bottom polydimethylsiloxane layer; the bottom polydimethylsiloxane layer is provided with a microfluidic pattern, the microfluidic pattern comprises a sample loading area, a sample channel, a separated micro chamber and a sample outlet area, and three electrode sensors are arranged on the top polydimethylsiloxane layer: a working electrode, a counter electrode and a reference electrode;
loading a nano magnetic bead-aptamer complex into the separated micro chamber, wherein the nano magnetic bead-aptamer complex comprises an aptamer sequence; the aptamer sequence has a hairpin structure, and is as follows: 5 'lambda-Fc-artificially synthesized nucleotide sequence-biotin-3'; wherein, the Fc is ferrocene, the biotin is biotin, the 5 'lambda-Fc-artificially synthesized nucleotide sequence-biotin-3' is 5 'lambda-Fc-CACCCCACCTCGCTCCGTGACACTAATGCTACCAACCCC-biotin-3', wherein CACCCCACCTCGCTCCCGTGACACTAATGCTACCAACCCC is sequence 1, sequence 2 is included in sequence 1, sequence 2 is a sequence specifically combined with antigen on exosome, and sequence 2 is CACCCCACCTCGCTCCGTGACACTAATGCTA;
the preparation method of the nano magnetic bead-aptamer compound comprises the following steps: adding aptamer sequence solution 30 μ L and 5 μ M into magnetic bead resuspension with concentration of 100ng/mL, 40 μ L, 50 μ L, 60 μ L, 80 μ L, 100 μ L and 120 μ L to obtain preparation mixed solution; incubating and reacting the prepared mixed solution for at least 2 hours at the temperature of 20-40 ℃; then placing on a magnetic frame for at least 1min, removing supernatant, and then washing twice with buffer solution B; obtaining a nanobead-aptamer complex after repeating the washing step twice; adopting a buffer solution C to carry out resuspension on the nano magnetic bead-aptamer compound, and then loading the compound into the separated micro chamber, wherein a magnetic field generating device is arranged below the separated micro chamber, and the formula of the buffer solution C is as follows: 100mM Tris-HCl, 100mM NaCl, 1mM MgCl2, and 5mM KCl, buffer C pH = 7.4;
the preparation method of the magnetic bead resuspension comprises the following steps: the amount of streptavidin-coated magnetic beads washed with 500. mu.L of buffer A was 3X 1011a/mL nano magnetic bead to obtain a nano magnetic bead treatment solution 1; then 50 mul of nano magnetic bead processing liquid 1 is taken, and 50 mul of buffer solution A is added into the nano magnetic bead processing liquid 1 to obtain nano magnetic bead processing liquid 2; incubating the nano magnetic bead treatment solution 2 for 15 minutes, placing the incubated nano magnetic bead treatment solution on a magnetic frame, and standing for at least 1 min; removing the supernatant, washing the nano magnetic bead precipitate twice by using 500 mu L of buffer solution B, and then adding 500 mu L of buffer solution B for resuspension to obtain a magnetic bead resuspension solution; the formula of the buffer solution A is 100mM Tris-HCl, 1mM EDTA and 2M NaCl, and the pH value of the buffer solution A is 7.5; the formula of the buffer solution B is 5mM Tris-HCl, 0.5mM EDTA and 100mM NaCl, and the pH value of the buffer solution B is 7.5;
the preparation method of the aptamer sequence solution comprises the following steps: the aptamer sequence was dissolved in a 1 × PBS buffer at pH 7.4 to obtain a solution of aptamer sequence.
2. The exosome separation detection system according to claim 1, characterized in that the bottom and top polydimethylsiloxane layers are matched in construction.
3. The exosome separation detection system according to claim 1, characterized in that the microfluidic pattern is prepared by a method comprising: simultaneously photoetching patterns of the sample loading area, the sample channel, the separated micro chamber and the sample outlet area on a Su lambda silicon wafer with the thickness of 80-120 mu m to obtain a photoetched Su lambda silicon wafer; and directly pouring liquid polydimethylsiloxane onto the Su lambda silicon wafer after photoetching, curing for at least 1 hour at the temperature of 60-80 ℃, and stripping the cured polydimethylsiloxane from the Su lambda silicon wafer after photoetching.
4. The exosome separation detection system according to claim 1, characterized in that the loading area is a cylindrical structure, the cross section is a circle with a diameter of 1-2 mm, and the height of the loading area is 0.4-1 mm; the sample channel is of a cylindrical structure, the cross section of the sample channel is circular with the diameter of 0.2-1 mm, and the length of the sample channel is 20-30 mm; the sample outlet area is of a cylindrical structure, the cross section of the sample outlet area is a circle with the diameter of 0.6-1.2 mm, and the height of the sample outlet area is 0.4-1 mm; the partitioned microchamber is of a cylindrical structure, the cross section of the partitioned microchamber is a circular microporous plate with the diameter of 1-1.6 cm, and the height of the microporous plate is 0.6-1 mm; micropores with the diameter of 1-2 mm are uniformly distributed in the circular microporous plate.
5. The exosome separation detection system according to claim 1, characterized in that the three-electrode sensor is prepared by: adhering a silicon dioxide insulating layer with the thickness of not less than 400 mu m to the top polydimethylsiloxane layer, fixing a chromium seed crystal layer with the thickness of 15-25 nm on the silicon dioxide insulating layer, and sputtering two thin film gold layers with the sizes of 2.5 mm x 2.5 mm and the thickness of 400-600 nm on the chromium seed crystal layer, wherein the two thin film gold layers are respectively used as a working electrode and a counter electrode; and (3) forming a silver ink layer with the size of 1.2mm x 10 mm and the thickness of 400-600 nm on a single chromium seed crystal layer with the thickness of 15-25 nm by using silver ink spraying, and using the silver ink layer as a reference electrode.
6. An exosome-separation detecting system according to claim 1, characterized in that the three-electrode sensor mounting method comprises: cutting a silicon wafer with a sensing electrode on the top into cuboid or cube small blocks, and placing the cuboid or cube small blocks above the partitioned micro-chamber to correspond to the corresponding positions of the working electrode, the counting electrode and the reference electrode; the placing positions are as follows: the working electrode is opposite to the counting electrode, and the distance between the working electrode and the counting electrode is 2-3 cm; the reference electrode is arranged beside the working electrode, and the distance between the reference electrode and the working electrode is 1.6-2 cm; and pouring the liquid polydimethylsiloxane around the three electrode sensors to form a uniform sensor layer with the thickness of 400-600 nm.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010103287.6A CN112557475B (en) | 2020-02-19 | 2020-02-19 | Exosome separation detection system based on micro-fluidic and ELISA analysis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010103287.6A CN112557475B (en) | 2020-02-19 | 2020-02-19 | Exosome separation detection system based on micro-fluidic and ELISA analysis |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112557475A CN112557475A (en) | 2021-03-26 |
| CN112557475B true CN112557475B (en) | 2021-07-06 |
Family
ID=75040776
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010103287.6A Active CN112557475B (en) | 2020-02-19 | 2020-02-19 | Exosome separation detection system based on micro-fluidic and ELISA analysis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112557475B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114214177A (en) * | 2021-12-07 | 2022-03-22 | 广州国家实验室 | Microfluidic chip, detection kit and exosome detection method |
| CN117085751B (en) * | 2023-07-26 | 2024-04-02 | 湖南瑞生科生物科技有限公司 | Microfluidic chip and exosome separation and detection method based on microfluidic chip |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109342710A (en) * | 2013-03-28 | 2019-02-15 | 英属哥伦比亚大学 | Micro fluidic device and its application method in many cells secretion detection |
| CN110320355B (en) * | 2018-03-30 | 2022-03-01 | 上海市肿瘤研究所 | Micro-fluidic chip and circulating exosome detection method |
| CN208156013U (en) * | 2018-04-08 | 2018-11-27 | 国家纳米科学中心 | Cancer detection system based on excretion body |
| CN209148583U (en) * | 2018-11-08 | 2019-07-23 | 王浩然 | The micro flow control chip device of Electrochemical Detection is immunized for excretion body magnetic bead |
| CN110257482A (en) * | 2019-07-16 | 2019-09-20 | 上海纳米技术及应用国家工程研究中心有限公司 | A kind of blood coagulation enzyme assay method based on aptamer and telomere enzymatic amplification |
-
2020
- 2020-02-19 CN CN202010103287.6A patent/CN112557475B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN112557475A (en) | 2021-03-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Yu et al. | A comparison of traditional and novel methods for the separation of exosomes from human samples | |
| Wang et al. | Towards microfluidic-based exosome isolation and detection for tumor therapy | |
| Zhang et al. | Rapid capture and nondestructive release of extracellular vesicles using aptamer-based magnetic isolation | |
| Mittal et al. | Biosensors for breast cancer diagnosis: A review of bioreceptors, biotransducers and signal amplification strategies | |
| Su et al. | Microfluidic strategies for label-free exosomes isolation and analysis | |
| CN112557475B (en) | Exosome separation detection system based on micro-fluidic and ELISA analysis | |
| CN107185612B (en) | Microfluid chip applied to exosome capture and preparation method thereof | |
| Sibbitts et al. | Cellular analysis using microfluidics | |
| WO2021128678A1 (en) | Method for simultaneously detecting protein, rna and exosome membrane protein in exosome | |
| CN111733056B (en) | Micro-fluidic chip integrating circulating tumor cell separation and single-cell immunoblotting | |
| Gao et al. | Recent developments in isolating methods for exosomes | |
| Bargahi et al. | Recent advances for cancer detection and treatment by microfluidic technology, review and update | |
| Cui et al. | ZnO nanowire-integrated bio-microchips for specific capture and non-destructive release of circulating tumor cells | |
| CN111440696A (en) | Fetal cell capture module, microfluidic chip for fetal cell capture, and methods of using same | |
| Hashkavayi et al. | Dual rolling circle amplification-enabled ultrasensitive multiplex detection of exosome biomarkers using electrochemical aptasensors | |
| CN112345754B (en) | Colorimetric biosensor for detecting exosomes based on Au@Ag | |
| Chang et al. | Biomimetic immunomagnetic gold hybrid nanoparticles coupled with inductively coupled plasma mass spectrometry for the detection of circulating tumor cells | |
| Chen et al. | Microfluidic methods for cell separation and subsequent analysis | |
| US20120064513A1 (en) | Cell Sensor, And Monitoring Method Using Same For The Real-Time Monitoring Of Cell Capacitance | |
| CN112630282A (en) | Preparation of array electrode chip combined with micro-fluidic clamp and construction method of electrochemical immunosensor | |
| Chang et al. | Aptamers as recognition elements for electrochemical detection of exosomes | |
| KR101218987B1 (en) | Biochip and manufacturing method thereof and method for detecting analyzed material using the biochip | |
| Lee et al. | 3D interior hotspots embedded with viral lysates for rapid and label-free identification of infectious diseases | |
| Li et al. | Recent progress in CRISPR-based microfluidic assays and applications | |
| CN114106978A (en) | Kit and method for simultaneously detecting internal microRNA and surface protein of exosome |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |