CN112553345A - Application of sheep PRNP gene insertion/deletion in breeding character early selection - Google Patents
Application of sheep PRNP gene insertion/deletion in breeding character early selection Download PDFInfo
- Publication number
- CN112553345A CN112553345A CN202011389207.4A CN202011389207A CN112553345A CN 112553345 A CN112553345 A CN 112553345A CN 202011389207 A CN202011389207 A CN 202011389207A CN 112553345 A CN112553345 A CN 112553345A
- Authority
- CN
- China
- Prior art keywords
- sheep
- deletion
- prnp gene
- genotype
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to application of a sheep PRNP gene insertion/deletion site in early selection of Australian white sheep reproductive traits. The invention finds that the insertion/deletion site of the sheep PRNP gene can be used as a molecular marker for auxiliary selection in sheep molecular breeding, thereby accelerating the speed of fine breed breeding. The sheep PRNP gene insertion/deletion (indel) polymorphic site established by the invention is used as an application method for early selection of reproductive traits, is beneficial to quickly establishing sheep populations with excellent reproductive traits and accelerating the speed of fine breed breeding.
Description
Technical Field
The invention belongs to the technical field of biotechnology and livestock breeding, and relates to application of a sheep PRNP gene NC-040264.1: 20-bp insertion/deletion (indel) at positions from 8776 to 8777 and NC-040264.1: g.13330-13344-15-bp insertion/deletion (indel) in molecular marker-assisted selective breeding, in particular to application of the sheep PRNP gene insertion/deletion in the aspect of early selection of reproductive traits.
Background
China is the country with the most sheep feeding amount, slaughtering amount and mutton output, and the breeding characters of sheep directly influence the production benefits of breeding enterprises. Therefore, the breeding of individuals with excellent reproductive performance has been an important problem in the sheep industry. The key technology of breeding is seed selection, and the key of seed selection is to improve the accuracy of selection. The animal breeding technology goes through 3 stages of phenotypic and phenotypic value seed selection technology breeding, DNA recombination technology breeding and molecular technology breeding. With the development of biological science and technology and the deepening of genetic research, the traditional selection method gradually exposes the defects of long period, high difficulty and the like. Rapidly, researchers developed various molecular markers for locating Quantitative Trait Loci (QTL) of important traits of animals, wherein the candidate genetic method has the advantages of convenience in polymorphic site detection, high statistical efficiency, simplicity and convenience in result application and the like. Therefore, the determination of candidate genes related to reproductive traits is important for breeding improvement of sheep populations.
The prion protein (PRNP) gene has been the focus of sheep research as an important control gene for lethal prion diseases or Transmissible Spongiform Encephalopathies (TSEs). By widely and deeply researching the PRNP (porcine reproductive and respiratory syndrome) regulation and control of the itch disease caused by both human and animals, the itch disease which is outbreak in China and the adjacent countries (such as Mongolia) is controlled. Besides the regulation of scrapie infection, PRNP has a great influence on the economic traits of healthy livestock, such as cashmere yield, wool thickness and milk yield of goats, and body size traits of cattle. In 2018, a study published by Li et al in the journal of Prion shows that the second intron of the PRNP gene of sheep has a 20bp indel (NC-040264.1: g.8776-8777) variation and a 15bp indel (NC-040264.1: g.13330-13344) variation, and is significantly related to the growth traits of two different varieties of sheep, namely small tailed Han sheep and Tan sheep. Furthermore, the PRNP gene also has an effect on the reproductive characteristics of sheep, such as the birth age, number of lambs, conception rate, etc. of sheep. Therefore, the PRNP gene is expected to become a candidate target gene applied to sheep breeding.
A key factor affecting phenotypic characteristics of animals at the genomic level is genomic variation. Currently, common genomic variations include insertions/deletions (InDels), Single Nucleotide Polymorphisms (SNPs), and Structural Variations (SVs). Indel refers to the difference in the entire genome of two parents, one of which has a certain number of nucleotide insertions or deletions in its genome relative to the other. indels are roughly classified into the following 5 major categories: (1) insertions/deletions of a single base pair; (2) single base insertions/deletions; (3) the repetitive unit is a multi-base pair insertion/deletion of 2-15 bases; (4) transposon insertion/deletion; (5) insertion/deletion polymorphism of an arbitrary DNA sequence. With the intensive research of comparative genomics, indels provide a great deal of biological information for theoretical research and genetic breeding application research, and the indels serve as a new generation of genetic identification markers and have the advantages of SNP. And indels are more easily identified directly by PCR amplification and agarose gel electrophoresis techniques than other variations. Furthermore, natural selection is believed by some researchers to be largely mediated by indel selection. Currently, much research on indels focuses on genome research of human beings and various crops (such as rice, corn and the like), and on livestock and poultry, research on growth traits of chickens is focused, and research and application on ruminants are few. Therefore, indel marker research on functional genes of ruminant livestock is urgently needed to be developed and advanced.
Through searching, no patent publication related to the present patent application has been found.
Disclosure of Invention
The invention aims to overcome the defects in the prior art and provides application of sheep PRNP gene insertion/deletion in the aspect of reproductive trait early selection so as to quickly establish a Australian white sheep genetic resource population with excellent reproductive traits.
The technical scheme adopted by the invention for solving the technical problems is as follows:
an application of sheep PRNP gene insertion/deletion site in Australian white sheep reproduction trait early selection.
Furthermore, the insertion/deletion site is a sheep PRNP gene NC-040264.1: g.8776-8777 bit 20-bp insertion/deletion polymorphic site and/or a sheep PRNP gene NC-040264.1: g.8776-8777 bit 15-bp insertion/deletion polymorphic site;
the insertion/deletion sequence of NC-040264.1: g.8776-8777 is SEQ ID NO.5, and the insertion/deletion sequence of NC-040264.1: g.13330-13344 is SEQ ID NO. 6.
Moreover, the DD (deletion/deletion genotype) of the 20-bp insertion/deletion polymorphic site and the II (insertion/insertion genotype) of the 15-bp insertion/deletion polymorphic site can be used as DNA molecular markers for improving the survival rate and the survival rate of the 92-day-old sheep.
Furthermore, the 20-bp insertion/deletion polymorphic site and the 15-bp insertion/deletion polymorphic site have I1I1I2I2、I1I1I2D2、I1I1D2D2、I1D1I2I2、I1D1I2D2、D1D1I2I2、D1D1I2D2、D1D1D2D2The 8 combined genotypes are all used for the early marker-assisted selection of the sheep reproductive traits.
A method for verifying an application as described above, comprising the steps of:
the method comprises the steps of detecting the genotype of an intron region insertion/deletion polymorphic site of a sheep PRNP gene in an Australian white sheep population by sequence amplification and electrophoretic identification by taking a primer pair designed by referring to a sheep whole genome as a primer and sheep genome DNA as a template;
and (3) carrying out genotype and gene frequency analysis on the insertion/deletion polymorphic sites of the PRNP gene of the Australian white sheep, and carrying out correlation analysis on 5 reproduction traits of the insertion/deletion polymorphic sites, such as total lamb number, number of live lambs, number of malformations, number of live 92-day-old and survival rate of 92-day-old of the initial birth times of the Australian white sheep.
The polymorphic sites of the insertion/deletion of the intron region of the sheep PRNP gene are NC-040264.1: g.8776-8777 and NC-040264.1: g.13330-13344, and the primer pair is P1 and P2;
the primer pair P1 is SEQ ID NO.1 and SEQ ID NO.2, and the primer pair P2 is SEQ ID NO.3 and SEQ ID NO. 4.
The invention has the advantages and positive effects that:
1. the invention finds that the insertion/deletion site of the sheep PRNP gene can be used as a molecular marker for auxiliary selection in sheep molecular breeding, thereby accelerating the speed of fine breed breeding. The sheep PRNP gene insertion/deletion (indel) polymorphic site established by the invention is used as an application method for early selection of reproductive traits, is beneficial to quickly establishing sheep populations with excellent reproductive traits and accelerating the speed of fine breed breeding.
2. The invention can detect the genotype of the insertion/deletion polymorphic sites (NC-040264.1: g.8776-8777 and NC-040264.1: g.13330-13344) of the intron region of the sheep PRNP gene in the Australian white sheep population efficiently, accurately and at low cost by taking a primer pair P1 and P2 designed by referring to the whole genome of sheep as a primer and sheep genome DNA as a template through sequence amplification and electrophoretic identification.
3. The invention carries out genotype and gene frequency analysis on the insertion/deletion polymorphic sites of the PRNP gene of the Australian white sheep, and carries out correlation analysis on 5 reproductive traits of the insertion/deletion polymorphic sites and the total number of lambs born, the number of deformities, the number of survivors at 92 days and the survival rate at 92 days of Australian sheep, and the result shows that the 20-bp insertion/deletion polymorphic sites and the 15-bp insertion/deletion polymorphic sites which are detected by the invention can be used as molecular markers of the number of survivors at 92 days (P <0.05) and the survival rate at 92 days of sheep (P <0.05), thereby being beneficial to quickly establishing sheep populations with excellent reproductive traits and accelerating the breeding speed of improved varieties.
4. The present invention uses the whole genome DNA of Australian white sheep containing PRNP gene as a template, and a reference sheepA primer pair P1 and P2 designed by a whole genome is used as a primer, the sheep PRNP gene is amplified by a PCR technology, and the polymorphism of the 20-bp indel and the 15-bp indel in the Australian white sheep population, which are known to exist in the gene, is identified by agarose gel electrophoresis and a DNA sequencing technology. The correlation analysis results reveal: the different genotypes of 20-bp indel at the P1 locus of the PRNP gene are obviously related to the survival number of Australian white sheep at the age of 92 days and the survival rate of the Australian white sheep at the age of 92 days; the different genotypes of the 15-bp indel at the P2 locus are obviously related to the survival number of Australian white sheep at 92 days and the survival rate of Australian white sheep at 92 days. In addition, the P1 and P2 loci coexist in 8 combined genotypes in the sheep population to be detected, and the correlation analysis result of the combined genotypes reveals that D1D1I2I2The method is a dominant combined genotype and can be used for early marker-assisted selection of sheep reproductive traits.
Drawings
FIG. 1 shows the result of agarose gel electrophoresis of the product of the sheep PRNP gene amplified by primer pair P1 according to the present invention; wherein M represents Marker;
FIG. 2 is a sequencing diagram of PCR amplification products of the sheep PRNP gene of the present invention; wherein the black boxes indicate the 20-bp insert: NC-040264.1 g.8776-8777 insAAGATATTTGCATCTCAGAG;
FIG. 3 shows the result of agarose gel electrophoresis of the product of the sheep PRNP gene amplified by primer pair P2 according to the present invention; m represents Marker;
FIG. 4 is a sequencing diagram of PCR amplification products of the sheep PRNP gene of the present invention; wherein the black boxes indicate the 15-bp deletion sequence: NC-040264.1 g.13330-13344del GTACACACAACGAG.
Detailed Description
The following detailed description of the embodiments of the present invention is provided for the purpose of illustration and not limitation, and should not be construed as limiting the scope of the invention.
The raw materials used in the invention are conventional commercial products unless otherwise specified; the methods used in the present invention are conventional in the art unless otherwise specified.
An application of sheep PRNP gene insertion/deletion (indel) locus in Australian white sheep breeding trait early selection.
Preferably, the insertion/deletion site is a sheep PRNP gene NC-040264.1: 20-bp insertion/deletion (indel) polymorphic site at positions g.8776-8777 and/or a sheep PRNP gene NC-040264.1: 15-bp insertion/deletion (indel) polymorphic site at positions g.8776-8777;
the insertion/deletion sequence of NC-040264.1: g.8776-8777 is SEQ ID NO.5, and the insertion/deletion sequence of NC-040264.1: g.13330-13344 is SEQ ID NO. 6.
Preferably, the DD (deletion/deletion genotype) of the 20-bp insertion/deletion polymorphic site and the II (insertion/insertion genotype) of the 15-bp insertion/deletion polymorphic site can be used as DNA molecular markers for improving the survival rate and the survival rate of 92-day-old sheep.
Preferably, the 20-bp insertion/deletion polymorphic site and the 15-bp insertion/deletion polymorphic site have I1I1I2I2、I1I1I2D2、I1I1D2D2、I1D1I2I2、I1D1I2D2、D1D1I2I2、D1D1I2D2、D1D1D2D2The 8 combined genotypes are all used for the early marker-assisted selection of the sheep reproductive traits.
A method for verifying an application as described above, comprising the steps of:
the method comprises the steps of detecting the genotype of an intron region insertion/deletion polymorphic site of a sheep PRNP gene in an Australian white sheep population by sequence amplification and electrophoretic identification by taking a primer pair designed by referring to a sheep whole genome as a primer and sheep genome DNA as a template;
and (3) carrying out genotype and gene frequency analysis on the insertion/deletion polymorphic sites of the PRNP gene of the Australian white sheep, and carrying out correlation analysis on 5 reproduction traits of the insertion/deletion polymorphic sites, such as total lamb number, number of live lambs, number of malformations, number of live 92-day-old and survival rate of 92-day-old of the initial birth times of the Australian white sheep.
Preferably, the polymorphic sites of the insertion/deletion of the intron region of the sheep PRNP gene are NC-040264.1: g.8776-8777 and NC-040264.1: g.13330-13344, and the primer pair is P1 and P2;
the primer pair P1 is SEQ ID NO.1 and SEQ ID NO.2, and the primer pair P2 is SEQ ID NO.3 and SEQ ID NO. 4;
primer pair P1 was:
an upstream primer: 5'-GGCCAACCCAACTTCTAAATTAC-3' (23bp) in the sequence,
a downstream primer: 5'-AAACAAAGGGGAAACAAAGTCAT-3' (23 bp).
Primer pair P2 was:
an upstream primer: 5'-TTGTACCAGTCTTTGTCCTTGCA-3' (23bp) in the sequence,
a downstream primer: 5'-TCCTCTGTCCATTAGATTTCCCA-3' (23 bp).
The invention can detect the genotype of the insertion/deletion polymorphic sites (NC-040264.1: g.8776-8777 and NC-040264.1: g.13330-13344) of the intron region of the sheep PRNP gene in the Australian white sheep population efficiently, accurately and at low cost by taking a primer pair P1 and P2 designed by referring to the whole genome of sheep as a primer and sheep genome DNA as a template through sequence amplification and electrophoretic identification.
The method can analyze the genotype and the gene frequency of the PRNP gene insertion/deletion polymorphic sites of the Australian white sheep, and perform correlation analysis on 5 reproductive traits of the insertion/deletion polymorphic sites and the total number of lambs born, the number of distortions, the number of survivors at 92 days and the survival rate at 92 days of Australian sheep, and the result shows that the 20-bp insertion/deletion polymorphic sites and the 15-bp insertion/deletion polymorphic sites detected by the method can be used as molecular markers of the number of survivors at 92 days of sheep (P <0.05) and the survival rate at 92 days of sheep (P <0.05), thereby being beneficial to quickly establishing a sheep population with excellent property reproduction and accelerating the breeding speed of improved varieties.
The invention can detect the insertion/deletion polymorphism which is possibly generated in Australia white sheep population by the mutation of 8776-8777 site and 13330-13344 site (reference sequence: NC-040264.1) of the sheep PRNP gene by using a PCR method, and carry out correlation analysis on the genotype, the combined genotype and the sheep reproduction character to verify whether the mutation can be used as a molecular marker for auxiliary selection in sheep molecular breeding.
1. Experimental drugs and reagents
1.1 Biochemical and biological reagents: (ii) Taq DNA polymerase (available from Fermantas, MBI); secondly, performing secondary filtration; proteinase K (available from Huamei bioengineering Co.) and Marker I (available from Tiangen Biotechnology (Beijing) Ltd.).
1.2 general reagents: the general reagent is purchased from Huamei bioengineering company and is an imported split charging product: citric acid, sodium citrate, glucose, Tris, EDTA, NaCl, NaOH, KCl and Na2HPO4、KH2PO4Tris-saturated phenol, chloroform, isoamyl alcohol, absolute ethyl alcohol, sodium acetate, Sodium Dodecyl Sulfate (SDS), Ethidium Bromide (EB), bromophenol blue, dimethyl benzonitrile FF, acetic acid, sucrose, boric acid, agarose, and the like.
1.3 solution and buffer: all solutions and buffers were prepared using deionized ultrapure water. The autoclaving condition was 15bf/in (1.034X 10)5Pa) and 25 min. The reagents were prepared according to the molecular cloning protocol described in Sambrook et al.
1) Solution for extracting tissue-like DNA:
in addition to the common solutions for genomic DNA extraction, the following reagents were prepared: (ii) 2mol/L NaCl: 11.688g of the extract was dissolved in water, and the volume was adjusted to 100mL, and the solution was autoclaved. Tissue DNA extract (100 mL): 1mL of 1mol/L Tris-HCl (pH 8.0), 20mL of 0.5mol/L EDTA (pH 8.0), 5mL of 2mol/L NaCl, and the volume is 100 mL.
2) Solutions for agarose gel electrophoresis analysis
(ii) 0.5 × TBE buffer: take 10 XTBE 50mL to 1000 mL. Sample loading buffer solution: contains 0.25% bromophenol blue and 0.25% xylene blue FF, and the solvent is 40.0% (w/v) sucrose aqueous solution.
2. Synthesis of sheep PRNP Gene indel primer
Based on the reference primer sequence, a primer P1 for amplifying a DNA fragment at the 20-bp indel (NC-040264.1: g.8776-8777) site of the sheep PRNP gene and a primer P2 for amplifying a DNA fragment at the 15-bp indel (NC-040264.1: g.13330-13344) site were synthesized. The sequences of the primer pairs are as follows:
primer pair P1 was:
an upstream primer: 5'-GGCCAACCCAACTTCTAAATTAC-3' (23bp) in the sequence,
a downstream primer: 5'-AAACAAAGGGGAAACAAAGTCAT-3' (23 bp).
Primer pair P2 was:
an upstream primer: 5'-TTGTACCAGTCTTTGTCCTTGCA-3' (23bp) in the sequence,
a downstream primer: 5'-TCCTCTGTCCATTAGATTTCCCA-3' (23 bp).
The sheep genome is amplified by the primer pair P1, and a 20-bp indel variant region containing the second intron of the sheep PRNP gene (NC-040264.1) can be amplified; the electrophoretic detection of the amplified fragment is shown in FIG. 1, and the 9 th lane is Marker I (600 bp,500bp,400bp,300bp,200bp,100bp from large to small). Lanes 1-8 are detection fragments, and II is insertion/insertion genotype, which shows a 160bp stripe; ID is insertion/deletion genotype and shows two bands of 140bp +160 bp; DD is deletion/deletion genotype, and shows a 140bp stripe. After sequencing and identifying the amplified fragment, 20-bp indel variation is found between the 8776-8777 th site of the NC-040264.1 sequence, and a sequencing peak diagram is shown in FIG. 2. The sheep genome is amplified by the primer pair P2, and a 15-bp indel variant region containing the first intron of the sheep PRNP gene (NC-040264.1) can be amplified; the electrophoretic detection of the amplified fragment is shown in FIG. 3, and the 9 th lane is Marker I (600 bp,500bp,400bp,300bp,200bp,100bp from large to small). Lanes 1-8 are detection fragments, and II is insertion/insertion genotype, which shows a 197bp band; ID is insertion/deletion genotype and shows two bands of stripes of 182bp +197 bp; DD is deletion/deletion genotype, and is represented by 182bp one-stripe. After sequencing and identifying the amplified fragment, 15-bp indel variation is found between 13330-position and 13344-position of the NC-040264.1 sequence, and a sequencing peak diagram is shown in FIG. 4.
PCR amplification of target fragment of Australian white sheep PRNP gene
3.1 Collection of sheep samples and Collection of Property data
The animals used in the experiment amounted to 320 samples. Randomly selecting adult sheep individuals with consistent feeding and management conditions, taking individual ear tissue samples, storing in 70% ethanol, bringing the individual ear tissue samples back to a laboratory at low temperature, and freezing and storing at-80 ℃. The sampling information is as follows: the total amount of the Australian white sheep ear tissue samples is 320, and the Australian white sheep ear tissue samples are collected in 8 months in 2019 in Tianjin Olympic group animal husbandry Co., Ltd by adopting a group random sampling mode;
australian white sheep breeding data include: the total lambing number, the number of live lambs, the number of malformations, the number of live 92-day-old and the survival rate of 92-day-old of the initial birth times of the sheep have 5 characters. The sheep reproduction character data is measured by workers in a breeding farm or a breeding farm, and 313 sheep individual reproduction data are recorded in total.
3.2 extraction and isolation of genomic DNA from tissue samples
Reference is made to the molecular cloning guidelines (2002) compiled by Sambrook et al and to the following: lanxian warrior, genetic variation of important functional genes of goats and the relationship between the genetic variation and economic traits [ D. ] in doctor academic thesis of university of agriculture and forestry in northwest, 2007, Shaanxi Yangling.
3.3 agarose gel electrophoresis detection of DNA
Reference is made to the molecular cloning guidelines (2002) compiled by Sambrook et al.
3.4 purification of DNA
Reference is made to the molecular cloning guidelines (2002) compiled by Sambrook et al.
3.5 spectrophotometric detection of DNA
The OD values of the DNA samples at 260nm and 280nm were measured by an ultraviolet photometer. Calculation of DNA content and OD260/OD280The ratio of (a) to (b). Such as OD260/OD280The ratio is less than 1.6, which indicates that the sample contains more protein or phenol, and purification is required; if the ratio is greater than 1.8, then RNA purification removal should be considered.
DNA concentration (ng/. mu.L) ═ 50 XOD260Value x dilution factor.
After the DNA detection, a certain amount of the DNA was taken out and diluted to 30 ng/. mu.L, and stored at-20 ℃ for later use, and the rest at-80 ℃.
3.6 PCR amplification
The PCR reaction system adopts a mixed sample adding method, namely the total amount of various reaction components is calculated according to the quantity of various components required by each reaction system and the quantity of PCR reactions required by 1 reaction, the reaction components are added into 1 1.5mL centrifuge tube, the centrifuge tubes are mixed fully and evenly and then are subjected to instantaneous centrifugation, the reaction components are subpackaged into 0.2mL Eppendorf PCR tubes, template DNA is added, and PCR amplification is carried out after the instantaneous centrifugation; the PCR reaction system comprises 2 xTaq PCR Supermix (comprising Taq DNA polymerase, dNTPs and optimized reaction buffer solution, the concentration is 2 x) 6.5 mu L; upstream primer 0.5 μ L; 0.5. mu.L of downstream primer (10 pmol/. mu.L of upstream primer and downstream primer); 0.6. mu.L of genomic DNA (concentration of 30 ng/. mu.L of sheep genomic DNA); 4.9 mu L of deionized water; PCR amplification system of total volume 13. mu.L.
3.7 procedure for PCR reaction
1) Pre-denaturation at 95.0 ℃ for 5min, and then entering step 2);
2) denaturation at 94.0 ℃ for 30s, renaturation at 68.0 ℃ for 30s (1 ℃ per cycle), extension at 72.0 ℃ for 20s for 18 cycles, and then step 3);
3) denaturation at 94.0 ℃ for 30s, renaturation at 50.0 ℃ for 30s, and extension at 72.0 ℃ for 20s for 25 cycles;
4) after step 3), extension was carried out at 72.0 ℃ for 10 min.
4. Agarose gel electrophoresis detection
Agarose gel electrophoresis detection is divided into 3 steps: 1) preparing 3.0% agarose gel, dyeing with nucleic acid dye, spotting 4.5 μ L, and performing 120V electrophoresis for 40-50 min; 2) when the DNA fragments with different molecular weights are clearly separated, imaging in a BIO-RAD Gel Doc 2000 Gel imaging system; 3) analyzing indel polymorphism according to the agarose gel electrophoresis result;
the polymorphism of indel was judged by photographic analysis using BIO-RAD Gel Doc 2000 Gel imaging system (see FIGS. 1 and 3):
for 20-bp insertion/deletion polymorphism existing at g.8776-8777 of sheep PRNP gene NC-040264.1, II is insertion/insertion genotype and shows one stripe of 160 bp; ID is insertion/deletion genotype and shows two bands of 140bp +160 bp; DD is deletion/deletion genotype, and shows a 140bp stripe. For 15-bp insertion/deletion polymorphism existing at g.13330-13344 of sheep PRNP gene NC-040264.1, II is insertion/insertion genotype and shows a 197bp strip; ID is insertion/deletion genotype and shows two bands of stripes of 182bp +197 bp; DD is deletion/deletion genotype, and is represented by 182bp one-stripe.
5. Frequency statistical analysis of sheep PRNP gene indel sites
1) Genotype and frequency of genes
Genotype frequency refers to the ratio of the number of individuals with a certain genotype for a trait to the total number of individuals in a population. PYY＝NYYN, wherein PYYRepresents the YY genotype frequency of a certain locus; n is a radical ofYYRepresenting the number of individuals in the population having a YY genotype; and N is the total number of detection groups.
Gene frequency refers to the relative ratio of a certain number of genes in a population to the total number of its alleles. The formula for the calculation can be written as: pY＝(2NYY+NYa1+NYa2+NYa3+NYa4+……+NYan)/2N
In the formula, PYIndicating allele Y frequency, NYYRepresenting the number of individuals in the population having the YY genotype, NYaiRepresenting the number of individuals having the Yai genotype in the population, a 1-an is n mutually different multiple alleles of allele Y.
The genotype frequencies and allele frequencies of the 20bp-indel and 15bp-indel mutation sites of the sheep PRNP gene are shown in Table 1.
TABLE 1 polymorphism parameters of sheep PRNP Gene indel site
6. Association analysis of sheep PRNP gene indel site gene effect
Genotype data: carrying out agarose gel electrophoresis on the genotype identified after PCR amplification;
propagation data: the total number of lambs, the number of live lambs, the number of malformations, the number of live 92-day-old survival and the survival rate of 92-day-old of the initial birth times of the Australian sheep have 5 characters.
And (3) correlation analysis model: the variety was analyzed using SPSS (24.0) software, with different factors being correlated with production traits. The resulting data is first analyzed descriptively by statistics to determine if outliers exist. The effect of the genotype is then further analyzed using analysis of variance, multivariate linear models, or t-analysis, based on the characteristics of the data. During the data processing, a fixed model is used for correlation analysis in consideration of the individual effects, the interaction between genes and the genotype effects. In addition, the complete model is as follows according to the practical conditions: y ═ μ + G + E, where Y: (ii) an individual phenotype record; u: an overall mean; g: a marker genotype effect; e: random error.
As can be seen from Table 2, in the production trait study of 320 sheep, PRNP gene 20-bp indel polymorphism has significant influence on number of survival at 92 days of gestational age of primary birth and survival at 92 days of age (P)<0.05), the individual character of the DD gene type is better than that of the ID gene type and the II gene type. PRNP gene 15-bp indel polymorphism has obvious influence on number of primiparous born survival at 92 days old and survival at 92 days old (P)<0.05), the II genotype individual character is superior to the ID and DD genotype individuals. In addition, the 20-bp indel site and the 15-bp indel site are I in the sheep population to be detected1I1I2I2(n＝12)、I1I1I2D2(n＝1)、I1I1D2D2(n＝16)、I1D1I2I2(n＝3)、I1D1I2D2(n＝95)、D1D1I2I2(n＝64)、D1D1I2D2(n＝2)、D1D1D2D2(n-5) Co-existing 8 combination genotypes for n>3, as shown in Table 3, D1D1I2I2The survival number of the combined genotype at 92 days and the survival rate of the combined genotype at 92 days are obviously superior to those of the combined genotype I1D1I2D2. Thus, the sheep PRNP gene NC-040264.1: g.8776-8777 position 20-bp insertion/deletion polymorphic site and NC _040264.1 the 15-bp insertion/deletion polymorphic sites at g.13330-13344 can be used as DNA molecular markers for the survival number of 92-day-old fetuses of sheep and the survival rate of 92-day-old sheep.
TABLE 2 Association analysis of sheep PRNP gene indel with Australian white sheep reproductive traits (Mean. + -. SE)
TABLE 3 Association analysis of the combination genotype of the 2 sites indel of the sheep PRNP gene with the reproductive traits of Australian white sheep (Mean. + -. SE)
In a word, the invention utilizes a PCR amplification method to detect 20-bp insertion/deletion polymorphic sites of sheep PRNP gene NC-040264.1: g.8776-8777 and 15-bp insertion/deletion polymorphic sites of NC-040264.1: g.13330-13344, and carries out correlation analysis on the polymorphic sites and the reproduction traits of Australia white sheep (total lambs, number of live lambs, number of malformation, number of survival at 92 days of age and survival at 92 days of age are 5 traits altogether), and finds that the polymorphic sites can be used as molecular markers for auxiliary selection in sheep breeding molecules, thereby accelerating the speed of fine breed breeding. The sheep PRNP gene insertion/deletion (indel) polymorphic site established by the invention is used as an application method for early selection of reproductive traits, is beneficial to quickly establishing sheep populations with excellent reproductive traits and accelerating the speed of fine breed breeding.
The related sequences of the invention are as follows:
application method of sheep PRNP gene insertion/deletion (indel) as breeding trait early selection
<160>3
<210>1
<211>23
<212>DNA
<213> Artificial Synthesis
<400>1
GGCCAACCCAACTTCTAAATTAC 23
<210>2
<211>23
<212>DNA
<213> Artificial Synthesis
<400>2
AAACAAAGGGGAAACAAAGTCAT 23
<210>3
<211>20
<212>DNA
<213> NC-040264.1 g.8776-8777 insertion/deletion sequence
<400>3
AAGATATTTGCATCTCAGAG 20
TTGTACCAGTCTTTGTCCTTGCA 23
<210>2
<211>23
<212>DNA
<213> Artificial Synthesis
<400>2
TCCTCTGTCCATTAGATTTCCCA 23
<210>3
<211>15
<212>DNA
<213> NC-040264.1 g.13330-13344 insertion/deletion sequences
<400>3
GTACACAACTGAG 15
Although the embodiments of the present invention have been disclosed for illustrative purposes, those skilled in the art will appreciate that: various substitutions, changes and modifications are possible without departing from the spirit and scope of the invention and the appended claims, and therefore the scope of the invention is not limited to the embodiments disclosed.
Sequence listing
<110> Tianjin Olympic group animal husbandry Co., Ltd
<120> application method of sheep PRNP gene insertion/deletion as reproductive trait early selection
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 23
<212> DNA
<213> primer pair P1 upstream primer (Unknown)
<400> 1
ggccaaccca acttctaaat tac 23
<210> 2
<211> 23
<212> DNA
<213> downstream primer of primer pair P1 (Unknown)
<400> 2
aaacaaaggg gaaacaaagt cat 23
<210> 3
<211> 23
<212> DNA
<213> primer pair P2 upstream primer (Unknown)
<400> 3
ttgtaccagt ctttgtcctt gca 23
<210> 4
<211> 23
<212> DNA
<213> downstream primer of primer pair P2 (Unknown)
<400> 4
tcctctgtcc attagatttc cca 23
<210> 5
<211> 43
<212> DNA
<213> NC-040264.1: g.8776-8777 insertion/deletion sequence (Unknown)
<400> 5
aagatatttg catctcagag ttgtaccagt ctttgtcctt gca 43
<210> 6
<211> 13
<212> DNA
<213> NC-040264.1: g.13330-13344 insertion/deletion sequences (Unknown)
<400> 6
gtacacaact gag 13
Claims (6)
1. An application of sheep PRNP gene insertion/deletion site in Australian white sheep reproduction trait early selection.
2. Use according to claim 1, characterized in that: the insertion/deletion site is a sheep PRNP gene NC-040264.1 20-bp insertion/deletion polymorphic site at the position g.8776-8777 and/or a sheep PRNP gene NC-040264.1 15-bp insertion/deletion polymorphic site at the position g.8776-8777;
the insertion/deletion sequence of NC-040264.1: g.8776-8777 is SEQ ID NO.5, and the insertion/deletion sequence of NC-040264.1: g.13330-13344 is SEQ ID NO. 6.
3. Use according to claim 2, characterized in that: the DD (deletion/deletion genotype) of the 20-bp insertion/deletion polymorphic site and the II (insertion/insertion genotype) of the 15-bp insertion/deletion polymorphic site can be used as DNA molecular markers for improving the survival number and survival rate of 92-day-old sheep.
4. Use according to claim 2 or 3, characterized in that: the 20-bp insertion/deletion polymorphic site and the 15-bp insertion/deletion polymorphic site have I1I1I2I2、I1I1I2D2、I1I1D2D2、I1D1I2I2、I1D1I2D2、D1D1I2I2、D1D1I2D2、D1D1D2D2The 8 combined genotypes are all used for the early marker-assisted selection of the sheep reproductive traits.
5. A method of validating an application as claimed in any one of claims 1 to 4, characterized by: the method comprises the following steps:
the method comprises the steps of detecting the genotype of an intron region insertion/deletion polymorphic site of a sheep PRNP gene in an Australian white sheep population by sequence amplification and electrophoretic identification by taking a primer pair designed by referring to a sheep whole genome as a primer and sheep genome DNA as a template;
and (3) carrying out genotype and gene frequency analysis on the insertion/deletion polymorphic sites of the PRNP gene of the Australian white sheep, and carrying out correlation analysis on 5 reproduction traits of the insertion/deletion polymorphic sites, such as total lamb number, number of live lambs, number of malformations, number of live 92-day-old and survival rate of 92-day-old of the initial birth times of the Australian white sheep.
6. The authentication method according to claim 5, wherein: the polymorphic sites of the insertion/deletion of the intron region of the sheep PRNP gene are NC-040264.1: g.8776-8777 and NC-040264.1: g.13330-13344, and the primer pair is P1 and P2;
the primer pair P1 is SEQ ID NO.1 and SEQ ID NO.2, and the primer pair P2 is SEQ ID NO.3 and SEQ ID NO. 4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011389207.4A CN112553345B (en) | 2020-12-02 | 2020-12-02 | Application of sheep PRNP gene insertion/deletion in breeding character early selection |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011389207.4A CN112553345B (en) | 2020-12-02 | 2020-12-02 | Application of sheep PRNP gene insertion/deletion in breeding character early selection |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112553345A true CN112553345A (en) | 2021-03-26 |
| CN112553345B CN112553345B (en) | 2022-11-22 |
Family
ID=75047480
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011389207.4A Active CN112553345B (en) | 2020-12-02 | 2020-12-02 | Application of sheep PRNP gene insertion/deletion in breeding character early selection |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112553345B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112980935A (en) * | 2021-03-31 | 2021-06-18 | 西北农林科技大学 | Application of goat PRNT gene single nucleotide polymorphism marker in early selection of characters |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109680070A (en) * | 2018-11-01 | 2019-04-26 | 天津奥群牧业有限公司 | It is a kind of to the extremely significant relevant SNP marker of the white sheep hoof color in Australia, molecular labeling and application |
| CN109825598A (en) * | 2018-11-01 | 2019-05-31 | 天津奥群牧业有限公司 | It is a kind of to the extremely significant relevant SNP marker of the white sheep hair thickness in Australia, molecular labeling and application |
| CN109880890A (en) * | 2019-04-10 | 2019-06-14 | 西北农林科技大学 | A kind of detection method and its application of goat HIAT1 gene insertion/deletion |
-
2020
- 2020-12-02 CN CN202011389207.4A patent/CN112553345B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109680070A (en) * | 2018-11-01 | 2019-04-26 | 天津奥群牧业有限公司 | It is a kind of to the extremely significant relevant SNP marker of the white sheep hoof color in Australia, molecular labeling and application |
| CN109825598A (en) * | 2018-11-01 | 2019-05-31 | 天津奥群牧业有限公司 | It is a kind of to the extremely significant relevant SNP marker of the white sheep hair thickness in Australia, molecular labeling and application |
| CN109880890A (en) * | 2019-04-10 | 2019-06-14 | 西北农林科技大学 | A kind of detection method and its application of goat HIAT1 gene insertion/deletion |
Non-Patent Citations (1)
| Title |
|---|
| 管峰等: "绵羊PRNP遗传多样性与抗病育种研究进展", 《遗传》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112980935A (en) * | 2021-03-31 | 2021-06-18 | 西北农林科技大学 | Application of goat PRNT gene single nucleotide polymorphism marker in early selection of characters |
| CN112980935B (en) * | 2021-03-31 | 2023-10-13 | 西北农林科技大学 | Application of goat PRNT gene single nucleotide polymorphism marker in early selection of characters |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112553345B (en) | 2022-11-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109880890B (en) | Detection method of goat HIAT1 gene insertion/deletion polymorphism and application thereof | |
| CN110468218B (en) | Detection method of goat IGF2BP1 gene insertion/deletion marker | |
| CN109957614B (en) | Method for detecting insertion/deletion polymorphism of CMTM2 gene of goat and application of method | |
| CN107164482B (en) | Detection method for insertion/deletion of goat CSN1S1 gene and application thereof | |
| CN110468185B (en) | Detection method for goat DNMT3B gene insertion/deletion polymorphism and application thereof | |
| CN108441566B (en) | Method for detecting insertion/deletion polymorphism of goat ATBF1 gene and application thereof | |
| CN108192985B (en) | Detection method for insertion/deletion of goat CTNNB1 gene and application thereof | |
| CN110607373B (en) | Method for detecting insertion/deletion polymorphism of goat DNAH1 gene and application thereof | |
| CN111154892B (en) | Primer pair, kit, method and application for detecting sheep BMPR1B gene insertion/deletion polymorphism | |
| CN117327806A (en) | Method for rapidly detecting single nucleotide polymorphism of sheep FecB gene by using KASP and application thereof | |
| CN112553345B (en) | Application of sheep PRNP gene insertion/deletion in breeding character early selection | |
| CN111088369B (en) | Detection method, primer pair and application of sheep RORA gene insertion/deletion polymorphism | |
| CN117568487A (en) | Application of sheep MAST4 gene insertion/deletion marker in early selection of reproductive traits | |
| CN113637768A (en) | SNP molecular marker on pig No. 13 chromosome related to number of malformed piglets born by sow and application thereof | |
| CN112795668B (en) | Application of goat CFAP43 gene insertion/deletion marker in early selection of characters | |
| CN112941202B (en) | Method for detecting cattle SEPT7 gene insertion/deletion mutation and application thereof | |
| CN111154891B (en) | Primer pair, kit, method and application for detecting sheep IGF2BP1 gene insertion/deletion polymorphism | |
| CN111455071B (en) | Detection method and application of SNP (single nucleotide polymorphism) marker on chromosome 8 of pig related to total litter size of all mount piglets of Erhualian pigs | |
| CN111118179B (en) | DNA detection method for detecting chest depth character of Luxi black ram and application thereof | |
| CN111088373B (en) | Sheep PRL gene insertion/deletion polymorphism detection primer pair, kit, method and application | |
| CN112609007B (en) | Application and method of sheep KDM3B gene insertion/deletion as breeding trait early selection | |
| CN112852974B (en) | Application method of sheep AHR gene insertion/deletion as breeding trait early selection | |
| CN106755370B (en) | Method for detecting sheep FTH-1 gene single nucleotide polymorphism by using PCR-RFLP and application thereof | |
| CN111154895B (en) | Sheep GHR gene insertion/deletion polymorphism detection primer pair, kit, method and application | |
| CN116463413B (en) | Molecular marker of WWOX gene related to pig venereal disease and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |