CN112553309A - Primer, probe and method for screening papillary thyroid carcinoma-associated fusion gene - Google Patents
Primer, probe and method for screening papillary thyroid carcinoma-associated fusion gene Download PDFInfo
- Publication number
- CN112553309A CN112553309A CN202110006343.9A CN202110006343A CN112553309A CN 112553309 A CN112553309 A CN 112553309A CN 202110006343 A CN202110006343 A CN 202110006343A CN 112553309 A CN112553309 A CN 112553309A
- Authority
- CN
- China
- Prior art keywords
- ret
- ptc
- probe
- abl
- ptc3
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 239000000523 sample Substances 0.000 title claims abstract description 64
- 108090000623 proteins and genes Proteins 0.000 title claims abstract description 37
- 238000000034 method Methods 0.000 title claims abstract description 29
- 238000012216 screening Methods 0.000 title claims abstract description 8
- 206010033701 Papillary thyroid cancer Diseases 0.000 title abstract description 17
- 208000030045 thyroid gland papillary carcinoma Diseases 0.000 title abstract description 17
- 230000004927 fusion Effects 0.000 title abstract description 6
- 230000003321 amplification Effects 0.000 claims abstract description 12
- 238000003199 nucleic acid amplification method Methods 0.000 claims abstract description 12
- 239000002299 complementary DNA Substances 0.000 claims abstract description 11
- 238000003753 real-time PCR Methods 0.000 claims abstract description 8
- 238000001514 detection method Methods 0.000 claims description 35
- 230000008707 rearrangement Effects 0.000 claims description 31
- 238000011529 RT qPCR Methods 0.000 claims description 13
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims description 5
- 238000004458 analytical method Methods 0.000 claims description 3
- 238000012257 pre-denaturation Methods 0.000 claims description 3
- 239000008223 sterile water Substances 0.000 claims description 2
- 238000010839 reverse transcription Methods 0.000 claims 1
- 238000011282 treatment Methods 0.000 abstract description 7
- 238000004393 prognosis Methods 0.000 abstract description 4
- 230000035945 sensitivity Effects 0.000 abstract description 3
- 201000010099 disease Diseases 0.000 abstract 1
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 abstract 1
- 108020004414 DNA Proteins 0.000 description 8
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 7
- 101000579425 Homo sapiens Proto-oncogene tyrosine-protein kinase receptor Ret Proteins 0.000 description 7
- 102100028286 Proto-oncogene tyrosine-protein kinase receptor Ret Human genes 0.000 description 6
- 238000005516 engineering process Methods 0.000 description 6
- 239000000203 mixture Substances 0.000 description 6
- 239000013642 negative control Substances 0.000 description 6
- 239000013641 positive control Substances 0.000 description 6
- 239000000243 solution Substances 0.000 description 6
- KFZMGEQAYNKOFK-UHFFFAOYSA-N Isopropanol Chemical compound CC(C)O KFZMGEQAYNKOFK-UHFFFAOYSA-N 0.000 description 5
- 239000003153 chemical reaction reagent Substances 0.000 description 5
- HEDRZPFGACZZDS-UHFFFAOYSA-N Chloroform Chemical compound ClC(Cl)Cl HEDRZPFGACZZDS-UHFFFAOYSA-N 0.000 description 4
- 101150077555 Ret gene Proteins 0.000 description 4
- 210000004027 cell Anatomy 0.000 description 4
- 239000000126 substance Substances 0.000 description 4
- 239000006228 supernatant Substances 0.000 description 4
- 210000001685 thyroid gland Anatomy 0.000 description 4
- 208000024770 Thyroid neoplasm Diseases 0.000 description 3
- 210000004369 blood Anatomy 0.000 description 3
- 239000008280 blood Substances 0.000 description 3
- 201000011510 cancer Diseases 0.000 description 3
- 238000003745 diagnosis Methods 0.000 description 3
- 230000000694 effects Effects 0.000 description 3
- 210000003743 erythrocyte Anatomy 0.000 description 3
- 238000009396 hybridization Methods 0.000 description 3
- 239000006166 lysate Substances 0.000 description 3
- 238000003757 reverse transcription PCR Methods 0.000 description 3
- 201000002510 thyroid cancer Diseases 0.000 description 3
- 108090000873 Receptor Protein-Tyrosine Kinases Proteins 0.000 description 2
- 102000004278 Receptor Protein-Tyrosine Kinases Human genes 0.000 description 2
- 238000003556 assay Methods 0.000 description 2
- 230000009286 beneficial effect Effects 0.000 description 2
- 235000019441 ethanol Nutrition 0.000 description 2
- 238000000605 extraction Methods 0.000 description 2
- 230000003902 lesion Effects 0.000 description 2
- 239000003550 marker Substances 0.000 description 2
- 108020004707 nucleic acids Proteins 0.000 description 2
- 102000039446 nucleic acids Human genes 0.000 description 2
- 150000007523 nucleic acids Chemical class 0.000 description 2
- 239000002244 precipitate Substances 0.000 description 2
- 239000000047 product Substances 0.000 description 2
- 238000012360 testing method Methods 0.000 description 2
- 101100522123 Caenorhabditis elegans ptc-1 gene Proteins 0.000 description 1
- 101100410162 Caenorhabditis elegans ptc-3 gene Proteins 0.000 description 1
- 102100031048 Coiled-coil domain-containing protein 6 Human genes 0.000 description 1
- 208000030836 Hashimoto thyroiditis Diseases 0.000 description 1
- 241000282412 Homo Species 0.000 description 1
- 101000777370 Homo sapiens Coiled-coil domain-containing protein 6 Proteins 0.000 description 1
- 101000974343 Homo sapiens Nuclear receptor coactivator 4 Proteins 0.000 description 1
- 101001026573 Homo sapiens cAMP-dependent protein kinase type I-alpha regulatory subunit Proteins 0.000 description 1
- 102000043136 MAP kinase family Human genes 0.000 description 1
- 108091054455 MAP kinase family Proteins 0.000 description 1
- 206010028980 Neoplasm Diseases 0.000 description 1
- 102100022927 Nuclear receptor coactivator 4 Human genes 0.000 description 1
- 108700020796 Oncogene Proteins 0.000 description 1
- 102000043276 Oncogene Human genes 0.000 description 1
- 208000009453 Thyroid Nodule Diseases 0.000 description 1
- 230000004913 activation Effects 0.000 description 1
- 230000010100 anticoagulation Effects 0.000 description 1
- 238000010009 beating Methods 0.000 description 1
- 238000007664 blowing Methods 0.000 description 1
- 102100037490 cAMP-dependent protein kinase type I-alpha regulatory subunit Human genes 0.000 description 1
- 239000012295 chemical reaction liquid Substances 0.000 description 1
- 230000002759 chromosomal effect Effects 0.000 description 1
- 210000000349 chromosome Anatomy 0.000 description 1
- 238000003759 clinical diagnosis Methods 0.000 description 1
- 238000004090 dissolution Methods 0.000 description 1
- 238000001035 drying Methods 0.000 description 1
- 101150100366 end gene Proteins 0.000 description 1
- 230000002124 endocrine Effects 0.000 description 1
- 238000011156 evaluation Methods 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 238000009472 formulation Methods 0.000 description 1
- 238000012151 immunohistochemical method Methods 0.000 description 1
- 238000007901 in situ hybridization Methods 0.000 description 1
- 238000011337 individualized treatment Methods 0.000 description 1
- 238000002156 mixing Methods 0.000 description 1
- 201000010198 papillary carcinoma Diseases 0.000 description 1
- 230000007170 pathology Effects 0.000 description 1
- 239000002504 physiological saline solution Substances 0.000 description 1
- 238000002360 preparation method Methods 0.000 description 1
- 230000002265 prevention Effects 0.000 description 1
- 102000004169 proteins and genes Human genes 0.000 description 1
- 238000007859 qualitative PCR Methods 0.000 description 1
- 238000011002 quantification Methods 0.000 description 1
- 108020003175 receptors Proteins 0.000 description 1
- 102000005962 receptors Human genes 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 238000004904 shortening Methods 0.000 description 1
- 239000000439 tumor marker Substances 0.000 description 1
- 108010063331 type 2 taste receptors Proteins 0.000 description 1
- 238000011144 upstream manufacturing Methods 0.000 description 1
- 230000000007 visual effect Effects 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a primer, a probe and a method for screening papillary thyroid cancer related fusion genes RET-PTC1, RET-PTC2 and RET-PTC3 in a tubular manner, wherein the method comprises the following steps: and performing in-line Real-time PCR amplification by using the cDNA as a template according to the specific amplification primer and the probe. The primer and the probe have the advantages of good specificity, high sensitivity and simple and convenient operation. The kit can rapidly detect the existence of RET-PTC1, RET-PTC2 and RET-PTC3 in the sample, and can assist in making a personalized treatment scheme and disease prognosis judgment for papillary thyroid cancer.
Description
Technical Field
The invention relates to a gene detection method for clinical examination, which adopts a probe real-time fluorescence PCR technology to carry out one-tube screening on RET gene rearrangement RET-PTC1, RET-PTC2 and RET-PTC3 in human PTC.
Technical Field
Thyroid cancer is derived from malignant tumor or lump grown in thyroid gland, is the most common endocrine malignant tumor, accounts for about 4% of all human malignant tumors, has increasing incidence rate in the world, can be developed in all ages, and is advanced age at age of 20-55 years. This increase in incidence is primarily due to Papillary Thyroid Carcinoma (PTC).
The RET gene is one of the earliest oncogenes found in humans and was the first gene to be proposed as a tumor marker. The RET protooncogene is located on chromosome 10q11.2 and encodes a transmembrane tyrosine kinase receptor protein, which is highly expressed in thyroid parafollicular cells. RET-PTC rearrangement is a rearrangement resulting from the combination of the 3 ' end of RET gene and the 5 ' end of other gene due to chromosomal ectopy or intra-arm inversion, which leads to the activation of the receptor as chimera, and is classified into various types, including 13 types such as RET-PTC1, RET-PTC2, RET-PTC3, etc., depending on the 5 ' end gene. Among them, RET-PTC1, RET-PTC2 and RET-PTC3 have the highest incidence rate in rearrangement type, and are formed by the intraarm inverted fusion of RET genes with CCDC6(H4), PRKAR1A and NCO4(ELE1) genes respectively, and all the fusions contain complete tyrosine kinase receptors, so that RET-PTC protein can activate MAPK signal path.
The rate of rearrangement of RET-PTC in PTC depends on the histological subtype of the tumor, regional factors, detection methods, and radiation exposure history. Early RET-PTC was considered a marker specific for PTC, but studies found that RET-PTC rearrangement also occurs in benign lesions of the thyroid gland and is associated with high growth rates of thyroid nodules. Thus, RET-PTC cannot be a marker specific for PTC. One study involving 64 patients with PTC found that the RET rearrangement positive rate was only 3.1%, with no obvious correlation with clinical pathology. The disadvantage of this study is that the number of subjects is small and thus the rate of expression of RET rearrangements in RET cannot be fully assessed. It has also been found that RET rearrangement rates are as high as 65% in people with a history of radiation exposure, and that RET gene rearrangement frequency is significantly lower in patients >45 years of age than in patients <45 years of age. The detection rate of RET rearrangement in PTC is greatly different at present, and may be related to the detection method, race and number of cases.
RET-PTC rearrangement assay is helpful for the diagnosis of thyroid cancer, and clonal RET-PTC assay is a strong index for predicting papillary carcinoma. The current research shows that RET-PTC rearrangement is not only commonly seen in thyroid cancer, but also can be seen in benign lesions of thyroid gland, such as Hashimoto's thyroiditis and the like.
The common techniques for detecting gene rearrangement at present include Fluorescence In Situ Hybridization (FISH), RT-PCR and the like. The FISH detection result is visual, but the test process is complicated, the related reagents are various, time and labor are wasted, the result needs to be interpreted by professionals with rich experience, and the result interpretation has larger subjectivity. RT-PCR adopts Taqman probe fluorescence quantitative technology, integrate biology, enzymology and fluorescence chemistry in an organic whole, carry on under PCR reaction tube closed state from amplification to result analysis, has solved the problem that PCR product pollutes and leads to the false positive, have improved the sensitiveness at the same time, its result is expressed by copy number, have realized the accurate quantification to PCR product, easy to unify the standard, compare with qualitative PCR technology, it is good to have the specificity, the sensitivity is high, the linear relation is good, easy to operate, the degree of automation is high, prevent pollution, have advantages such as the great linear range. Can meet the detection of RET-PTC gene rearrangement, is considered to be the first detection method at present and is used for evaluating the treatment effect and predicting prognosis. Common methods in real-time fluorescent quantitative PCR include SYBR GreenI dye method, double-probe hybridization method, Taqman technology and the like. Wherein, SYBR GreenI is unsaturated dye, so the specificity is not as good as that of a double-probe hybridization method and a Taqman method, and the specificity is judged by observing a dissolution curve; the two-probe hybridization method is expensive. Therefore, the invention adopts the real-time fluorescence PCR technology and the Taqman probe method to be applied to the RET-PTC gene rearrangement detection.
Disclosure of Invention
The invention designs a method for screening 3 common rearrangement types RET-PTC1, RET-PTC2 and RET-PTC3 of RET-PTC genes in a tubular manner, which comprises the following steps:
1) specific primers and probes for detecting RET-PTC1, RET-PTC2 and RET-PTC3 genes:
PTC1-F GAGGAGAACCGCGACCTG
PTC2-F GGCATCGACCGAGACAGCT
PTC3-F CCTTACATACCCAGCACCGA
PTC-R：CCGTTGCCTTGACCACTTTT
PTC-probe：FAM-TTCCAAGAACCAAGTTCTTCCGAGGG–TAMRA
2) specific primers and probes for detecting reference gene Abl:
Abl-F:GATACGAAGGGAGGGTGTACCA
Abl-R:CTCGGCCAGGGTGTTGAA
Abl-Probe:FAM-TGCTTCTGATGGCAAGCTCTACGTCTCCT-TAMRA
3) adding primers and probes of RET-PTC1, RET-PTC2 and RET-PTC3 genes into the same PCR tube according to a reasonable concentration ratio, detecting a sample through optimized Real-time PCR reaction conditions, and simultaneously amplifying an internal reference gene Abl as a reference.
Further, the detection method further comprises the following steps:
1) extracting sample RNA and reverse transcribing to cDNA
2) Performing in-line Real-time PCR amplification by using cDNA as a template according to the specific amplification primer (PTC1-F, PTC2-F, PTC3-F, PTC-R) and the detection probe (PTC-probe), and simultaneously amplifying an internal reference gene Abl as a reference;
3) and analyzing whether the sample has RET-PTC gene rearrangement according to the Real-time PCR result.
The extraction method is that blood RNA is extracted by a conventional TRIZOL method, and then is reversely transcribed into cDNA by a Rever Tra Ace qPCR RT Kit of TOYOBO company.
The Real-time PCR amplification method in the step 2) is as follows:
further, the qPCR system for one sample was 25 ul: 2 x qPCR MIX 12.5ul, primers PTC1-F, PTC2-F, PTC3-F, PTC-R each 0.4ul, probe PTC-probe 0.4ul, sterilized water 8ul, cDNA template 2 ul.
The qPCR system for the internal controls was 25 ul: 2 x qPCR MIX 12.5ul, primers Abl-F, Abl-R each 0.4ul, Probe Abl-Probe 0.4ul, sterile water 8.8ul, cDNA template 2 ul.
Real-time PCR reaction program: pre-denaturation at 95 ℃ for 1 min; the temperature is 95 ℃ for 15s, and the temperature is 58 ℃ for 35s, and the circulation is carried out for 40 times.
The result analysis specifically comprises: RT-PCR of the internal reference (ABL) and the gene of interest RET-PTC were performed simultaneously on one plate:
a. when the internal reference is positive, the detection result is considered to be effective;
b. positive judgment standard: ct <36, positive, RET-PTC gene rearrangement in the sample; ct is more than or equal to 36 and less than or equal to 38, is suspected positive and needs to be verified again; ct > 38, negative, no RET-PTC gene rearrangement in the sample.
The invention has the beneficial effects that: firstly, the invention combines the real-time fluorescence PCR technology with the Tapman probe to respectively amplify the reference genes ABL and the RET-PTC target genes and detect whether RET-PTC gene rearrangement exists in the body of a detected person. Compared with the traditional FISH and immunohistochemical method, the method has the advantages of simple and rapid operation, high result precision, convenience in interpretation and the like.
According to the characteristics of three main rearrangement types of PTC, the invention designs common downstream primers, probes and 3 upstream primers to be mixed in the same system according to a reasonable proportion, and the existence of RET-PTC rearrangement in a sample can be detected by one-time reaction, thereby reducing operation steps, shortening sample adding time and reducing pollution probability.
And thirdly, the primers and the probes required by the reaction system are reasonably proportioned and optimized, so that the experimental conditions are optimal, a complicated condition groping link is omitted, and the experimental efficiency is greatly improved. The method has good specificity, high sensitivity and simple operation. The kit is beneficial to the detection of RET-PTC gene rearrangement in a PTC patient clinically, and has important significance for PTC typing diagnosis, treatment scheme adjustment, treatment effect evaluation, prognosis prediction and clinical relapse prevention.
Drawings
FIG. 1 is a graph of amplification curves for the detection of RET-PTC1 positive samples using the present method.
FIG. 2 is a graph of amplification curves for the detection of RET-PTC2 positive samples using the present method.
FIG. 3 is a graph of amplification curves for the detection of RET-PTC3 positive samples using the present method.
Detailed Description
Example 1
The invention is used for assisting the clinical diagnosis of the PTC and the method for making the individualized treatment scheme. Mainly comprises the following reagents: a lysate of red blood cells; TRIzol; chloroform; isopropyl alcohol; absolute ethyl alcohol;
detection system PCR reaction solution: ReverTra Ace qPCR RT Kit (TOYOBO Co.); primer and Probe concentrations of THUNDERBIRD Probe qPCR Mix (2X), ABL reference gene and RET-PTC target gene are all 10 μ M;
wherein, the primers and probes for detecting the reference gene ABL and the target gene RET-PTC are respectively as follows:
positive control: a solution containing RET-PTC gene;
negative control: a solution not containing RET-PTC gene.
Example 2
The method comprises the following operation flows:
(1) extraction of total RNA in blood: 1ml of erythrocyte lysate is added into a clean centrifugal tube with 1.5ml, and 0.5ml of anticoagulation blood is taken and mixed evenly. Standing at room temperature for 10 min; centrifuging at 1500rpm for 5min, discarding the supernatant, and collecting the cells at the bottom; adding 0.5ml of erythrocyte lysate again, centrifuging at 1500rpm for 5min, discarding the supernatant, and collecting the cells at the bottom; adding 1ml of TRIzol into the cells, repeatedly blowing and beating until the precipitate is completely dissolved, and standing at room temperature for 5 min; adding 0.2ml of chloroform, and shaking uniformly; centrifuging at 14000rpm and 4 ℃ for 10min, sucking the supernatant and transferring to another new centrifuge tube; adding isopropanol with the same volume, mixing thoroughly, standing at room temperature for 10 min; centrifuging at 14000rpm and 4 ℃ for 10min, removing the supernatant, adding 1ml of 75% ethanol, and slightly reversing the upper part and the lower part to wash the tube wall; centrifuging at 14000rpm and 4 ℃ for 5min, and removing ethanol; drying at room temperature for 10-15min, adding 20ul RNase-free water to dissolve precipitate.
(2) RNA was inverted to cDNA by referring to the Rever Tra Ace qPCR RT Kit instructions from TOYOBO.
(3) Reagent preparation: preparing X mu L of PCR reaction liquid of a detection system according to the number of detected persons, and subpackaging 23 mu L of each person:
x ═ 23 μ L reaction solution X (8 parts of internal reference (standard curve) +8 parts of target gene (standard curve) + n parts of specimen +1 part of positive control +1 part of negative control +1 part of blank control);
(4) sample adding: adding 2 mu L of cDNA into the PCR reaction solution of the detection system; directly adding 2 mu L of positive control substance and negative control substance into the positive control substance and the negative control substance; blank control was supplemented with 2. mu.L of physiological saline or nothing.
(5) And (3) detection: the detection was performed on a real-time fluorescent PCR instrument, and available instruments include ABI7300, 7500 (Applied Biosystems, USA), and the like. Reaction conditions are as follows: pre-denaturation at 95 ℃ for 1 min; 95 ℃ for 15s, 58 ℃ for 35sec for 40 cycles, and fluorescence signals were collected at 58 ℃ for 35 sec.
(6) And (5) judging a result: the threshold line is adjusted to be above the background signal and the negative amplification line, and the system automatically calculates the copy number according to the standard curve and the CT value.
1) When the internal reference is positive, the detection result is considered to be effective;
2) positive judgment standard: ct <36, positive; ct is more than or equal to 36 and less than or equal to 38, is suspected positive and needs to be verified again; ct > 38, negative.
Example 3
Detection of positive specimen by the nucleic acid detection method of the invention
1 example of each of the positive samples RET-PTC1, RET-PTC2 and RET-PTC3 was taken, and the genome was extracted, the reagent was prepared and tested as described in example 2. The positive sample is used for simultaneously testing the mixed system PTC-mix and the conventional systems PTC-1, PTC-2 and PTC-3, and the Abl is used as an internal reference. Each sample was replicated 3 times, one positive control and one negative control, each with 2 μ L of the corresponding positive sample. The detection time is 60 minutes. All detection systems and ABL are on line, and CT values detected by the mixed system for all RET-PTC rearrangement types are consistent with detection values of a conventional system, so that the detection result of the mixed system PTC-mix is reliable, and the result is shown in figures 1-3.
Example 4
Detection of clinical specimens Using the nucleic acid detection method of the invention
22 clinical samples to be detected are taken, and the genome is extracted, the reagent is prepared and detected according to the method described in the embodiment 2.
Each sample was added to 2. mu.L of the detection system PCR reaction solution. And simultaneously, making positive, negative and blank controls, and respectively copying standard curves of reference genes/target genes. A96-well fluorescent PCR instrument can simultaneously detect 22 samples, each sample is repeated for 2 times, one positive control and one negative control, and the detection time is only 60 minutes. All samples in 22 screened samples had line-outs in ABL, but no specimen in RET-PTC. The results of the experiment are shown in table 2 below:
TABLE 222 clinical specimens RET-PTC expression levels
The invention mixes 3 common rearrangement primers and probes into the same PCR tube, reduces operation steps, shortens sample adding time, and reduces pollution probability. The detection result can be used as one of the bases for PTC typing diagnosis and selection and formulation of individual treatment schemes, and has important significance for adjusting the treatment scheme, evaluating the treatment effect, evaluating the prognosis and preventing clinical relapse. Meanwhile, the detection time can be effectively saved, and the detection precision is improved.
Sequence listing
<110> Hangzhou Aidikang medical inspection center Co., Ltd
<120> primers, probes and methods for screening papillary thyroid carcinoma-associated fusion genes
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
<210> 2
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
<210> 5
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
ttccaagaac caagttcttc cgaggg 26
<210> 6
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
gatacgaagg gagggtgtac ca 22
<210> 7
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
<210> 8
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
tgcttctgat ggcaagctct acgtctcct 29
Claims (6)
1. A tubular screening RET-PTC gene 3 rearrangement type RET-PTC1, RET-PTC2, RET-PTC3 primer and probe, characterized in that: the sequences of the corresponding primers and probes are as follows
PTC1-F：GAGGAGAACCGCGACCTG
PTC2-F：GGCATCGACCGAGACAGCT
PTC3-F：CCTTACATACCCAGCACCGA
PTC-R：CCGTTGCCTTGACCACTTTT
PTC-probe：FAM-TTCCAAGAACCAAGTTCTTCCGAGGG–TAMRA。
2. The primers and probes according to claim 1, further comprising specific primers and probes for detecting reference gene Abl as follows
Abl-F:GATACGAAGGGAGGGTGTACCA
Abl-R:CTCGGCCAGGGTGTTGAA
Abl-Probe:FAM-TGCTTCTGATGGCAAGCTCTACGTCTCCT-TAMR。
3. A method for screening 3 rearrangement types RET-PTC1, RET-PTC2 and RET-PTC3 of RET-PTC gene in a tubular mode is characterized by comprising the following steps:
(1) providing specific primers and probes for detecting RET-PTC1, RET-PTC2 and RET-PTC3 genes:
PTC1-F：GAGGAGAACCGCGACCTG
PTC2-F：GGCATCGACCGAGACAGCT
PTC3-F：CCTTACATACCCAGCACCGA
PTC-R：CCGTTGCCTTGACCACTTTT
PTC-probe：FAM-TTCCAAGAACCAAGTTCTTCCGAGGG–TAMRA；
(2) providing specific primers and probes for detecting an internal reference gene Abl:
Abl-F:GATACGAAGGGAGGGTGTACCA
Abl-R:CTCGGCCAGGGTGTTGAA
Abl-Probe:FAM-TGCTTCTGATGGCAAGCTCTACGTCTCCT-TAMRA；
(3) adding primers and probes of RET-PTC1, RET-PTC2 and RET-PTC3 genes into the same PCR tube;
(4) the amplified reference gene Abl was used as a reference.
4. The method of claim 3, further comprising the steps of:
(1) extracting sample RNA and performing reverse transcription to form cDNA as a template, performing in-tube Real-time PCR amplification in a proper qPCR system according to the specific amplification primer PTC1-F, PTC2-F, PTC3-F, PTC-R and the probe PTC-probe, and simultaneously amplifying an internal reference gene Abl as reference;
(2) and analyzing whether the sample has RET-PTC gene rearrangement according to the Real-time PCR result.
5. The method of claim 4, wherein the qPCR system is 25 ul: 2 × qPCR MIX 12.5ul, primers PTC1-F, PTC2-F, PTC3-F, PTC-R each 0.4ul, probe PTC-probe 0.4ul, sterilized water 8ul, cDNA template 2 ul; the qPCR system for the internal controls was 25 ul: 2 x qPCR MIX 12.5ul, primers Abl-F, Abl-R each 0.4ul, Probe Abl-Probe 0.4ul, sterile water 8.8ul, cDNA template 2 ul. Real-time PCR reaction program: pre-denaturation at 95 ℃ for 1 min; the temperature is 95 ℃ for 15s, and the temperature is 58 ℃ for 35s, and the circulation is carried out for 40 times.
6. The method according to claim 4, wherein the result analysis of step (2) is specifically:
(1) when the internal reference is positive, the detection result is considered to be effective;
(2) positive judgment standard: ct <36, positive, RET-PTC gene rearrangement in the sample; ct is more than or equal to 36 and less than or equal to 38, is suspected positive and needs to be verified again; ct > 38, negative, no RET-PTC gene rearrangement in the sample.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110006343.9A CN112553309A (en) | 2021-01-05 | 2021-01-05 | Primer, probe and method for screening papillary thyroid carcinoma-associated fusion gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110006343.9A CN112553309A (en) | 2021-01-05 | 2021-01-05 | Primer, probe and method for screening papillary thyroid carcinoma-associated fusion gene |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112553309A true CN112553309A (en) | 2021-03-26 |
Family
ID=75035174
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110006343.9A Pending CN112553309A (en) | 2021-01-05 | 2021-01-05 | Primer, probe and method for screening papillary thyroid carcinoma-associated fusion gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112553309A (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112143812A (en) * | 2020-10-19 | 2020-12-29 | 杭州艾迪康医学检验中心有限公司 | Primers, probes, compositions and methods for screening and identifying Ph-like ALL-related fusion genes using fluorescent PCR technology |
-
2021
- 2021-01-05 CN CN202110006343.9A patent/CN112553309A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112143812A (en) * | 2020-10-19 | 2020-12-29 | 杭州艾迪康医学检验中心有限公司 | Primers, probes, compositions and methods for screening and identifying Ph-like ALL-related fusion genes using fluorescent PCR technology |
Non-Patent Citations (4)
| Title |
|---|
| ANNA CYNIAK-MAGIERSKA ET AL.: "Assessment of RET/PTC1 and RET/PTC3 rearrangements in fine-needle aspiration biopsy specimens collected from patients with Hashimoto’s thyroiditis", 《THYROID RESEARCH》, vol. 4, pages 1 - 5 * |
| LIU ET AL.: "Low Prevalence of RET Rearrangements (RET/PTC1, RET/PTC2, RET/PTC3, and ELKS-RET) in Sporadic Papillary Thyroid Carcinomas in Taiwan Chinese", 《THYROID》, vol. 15, no. 4, pages 1 * |
| SU ET AL.: "RET/PTC Rearrangements Are Associated with Elevated Postoperative TSH Levels and Multifocal Lesions in Papillary Thyroid Cancer without Concomitant Thyroid Benign Disease", 《PLOS ONE》, no. 1, pages 3 * |
| 朱晓丽等: "甲状腺乳头状癌中BRAF Ｖ599Ｅ点突变与 RET/PTＣ融合基因的检测", 《中华病理学杂志》, vol. 34, no. 5, pages 270 - 274 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108949990B (en) | Kit and method for detecting EGFR gene mutation | |
| CN106591438B (en) | Nucleic acid combination, kit and application for detecting Her2 gene | |
| CN109825586B (en) | DNA methylation qPCR kit for lung cancer detection and use method | |
| JP2011515109A (en) | Method for detecting IGF1R / Chr15 in circulating tumor cells using FISH method | |
| CN110387421A (en) | DNA methylation qPCR kit and application method for lung cancer detection | |
| CN109504780B (en) | DNA methylation qPCR kit for lung cancer detection and use method thereof | |
| CN109112216A (en) | The kit and method of triple qPCR detection DNA methylations | |
| CN111560435A (en) | DNA methylation kit for colorectal cancer detection, and use method and application thereof | |
| CN112646888B (en) | Kit for detecting mammary tumor specific methylation | |
| CN110964823A (en) | DNA methylation kit for colorectal cancer detection and detection method | |
| CN102676663A (en) | Nucleic acid detection kit for detecting BRCA1mRNA | |
| CN111500731A (en) | Kit for early diagnosis, detection or screening of thyroid cancer, and use method and application thereof | |
| JP2022130509A (en) | Analytical method and kit | |
| CN111826446A (en) | Primer, probe and kit for early screening and auxiliary diagnosis of bladder cancer | |
| CN108531598B (en) | ROS1 gene fusion detection primer, method and kit | |
| CN107815494B (en) | Method, kit and oligonucleotide for detecting relative expression amount of PCM1-JAK2 | |
| CN109593861A (en) | The detection method and detection kit of different loci leukaemia MEF2D-BCL9 fusion oligonucleotides | |
| CN112553337A (en) | Method for detecting ERBB2 gene amplification based on digital PCR technology and detection kit thereof | |
| CN108728538B (en) | ALK gene fusion detection primer, method and kit | |
| US7217515B2 (en) | HURP gene as a molecular marker for bladder cancer | |
| CN102796818A (en) | Assay kit for testing relative expression of core-binding factor (CBF) beta/myosin 11 fusion genes | |
| CN110551821B (en) | Primers, probe and kit for detecting MEF2D gene rearrangement by using fluorescent quantitative PCR | |
| CN106755330B (en) | Cancer-related gene expression difference detection kit and application thereof | |
| CN112553309A (en) | Primer, probe and method for screening papillary thyroid carcinoma-associated fusion gene | |
| CN107326092A (en) | Applications and colorectal cancer detection kit of the related miRNA of colorectal cancer as biomarker |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20210326 |