CN112553170A

CN112553170A - Phage genome rescue method based on cell-free expression system and application thereof

Info

Publication number: CN112553170A
Application number: CN202011457913.8A
Authority: CN
Inventors: 马迎飞; 袁盛建
Original assignee: Shenzhen Institute of Advanced Technology of CAS
Current assignee: Shenzhen Institute of Advanced Technology of CAS
Priority date: 2020-12-10
Filing date: 2020-12-10
Publication date: 2021-03-26

Abstract

The application belongs to the technical field of biology and particularly discloses a phage genome rescue method based on a cell-free expression system and application thereof, wherein the method comprises the following steps: establishing a cell-free expression system, wherein the cell-free expression system at least comprises: buffer solution of a cell-free system, cell extract and Chi6 reagent; the phage genome is added to a cell-free expression system to accomplish DNA replication, RNA transcription and protein translation, and self-assemble into active phage particles. Through above-mentioned mode, this application has expanded the rescue means of phage genome, makes the rescue of phage genome become simple feasible.

Description

Phage genome rescue method based on cell-free expression system and application thereof

Technical Field

The application relates to the technical field of biology, in particular to a phage genome rescue method based on a cell-free expression system and application thereof.

Background

Bacteriophage is a generic term for viruses that infect microorganisms such as bacteria. Bacteriophages were found to be successful in the treatment of bacterial infectious diseases as soon as they were discovered. The application of the bacteriophage in preventing and treating bacterial infection has the advantages of specificity, high efficiency, no obvious side effect and the like. However, the phage products currently popularized and applied in large scale are still few, and a series of technical problems still need to be solved, such as easy generation of resistance of bacteria to phage, insufficient phage coverage temperature, possibility of virulence protein genes and the like. The artificial phage is designed and synthesized rationally by adopting a synthetic biology method and thinking, and the problems in phage treatment are expected to be solved. Meanwhile, how to efficiently and quickly rescue the phage genome becomes a problem to be solved urgently.

The inventor of this application in long-term development process, finds that the conventional rescue technique of phage genome mainly has electric transformation and chemical transformation, and when the phage genome was bigger (>40kb), the transformation efficiency of these two rescue techniques was low, can not effectively be used for the rescue of phage genome. Furthermore, the rescue of gram-positive bacteriophages by L-type cells covers a limited range of temperatures, and gram-negative bacteriophages cannot be rescued by L-type cells due to the large difference between the transcription and translation mechanisms of gram-negative and gram-positive bacteria.

Disclosure of Invention

In order to solve the technical problems, the application provides a phage genome rescue method based on a cell-free expression system and application thereof, the phage genome can be expressed and self-assembled in the cell-free expression system, the rescue means of the phage genome is expanded, and the rescue of the phage genome becomes simple and feasible.

In order to solve the technical problem, the application adopts a technical scheme that: a phage genome rescue method based on a cell-free expression system is provided, and the method comprises the following steps: establishing a cell-free expression system, wherein the cell-free expression system at least comprises: buffer solution of a cell-free system, cell extract and Chi6 reagent; the phage genome is added to a cell-free expression system to accomplish DNA replication, RNA transcription and protein translation, and self-assemble into active phage particles.

Wherein, before establishing the cell-free expression system, the method further comprises the following steps: preparing a buffer solution of a cell-free system; preparing a cell-free system buffer comprising: preparing a first liquid; preparing a second liquid according to the first liquid, wherein the second liquid at least comprises: HEPES buffer, tRNA, coenzyme a (coa), Nicotinamide Adenine Dinucleotide (NAD), Cyclic Adenosine monophosphate (cAMP), Folinic Acid (Folinic Acid), Spermidine (Spermidine), 3-phosphoglyceride (3-phosphoglyceride, 3-PGA), Adenosine Triphosphate (ATP), Guanosine Triphosphate (GTP), Cytidine Triphosphate (CTP), Uridine Triphosphate (UTP); preparing a third liquid from the second liquid, the third liquid comprising at least: HEPES buffer, tRNA, coenzyme a (coa), NAD, cyclic Adenosine monophosphate (cAMP), Folinic Acid (Folinic Acid), Spermidine (Spermidine), 3-phosphoglyceride (3-phosphoglyceride, 3-PGA), Adenosine triphosphate (Adenosine triphosphate, ATP), Guanosine Triphosphate (GTP), Cytidine Triphosphate (CTP), Uridine Triphosphate (UTP), polyethylene glycol, magnesium glutamate (Mg-glutamate), potassium glutamate (K-glutamate), Tris, KOH, Dithiothreitol (Dithiothreitol, DTT); and mixing the positive and negative chains of the exonuclease inhibitor Chi6 and the third liquid, and carrying out PCR annealing to obtain the cell-free system buffer solution.

Wherein, before establishing the cell-free expression system, the method further comprises the following steps: preparing a cell extract; preparing a cell extract comprising: incubating and collecting thalli; cell extracts were prepared from the cells.

Wherein, incubating and collecting thalli comprises: coating BL21 Rosetta2 strain on Cm resistant plates, streaking the plates, and incubating for a period of time; selecting a plurality of monoclonals on the Cm resistant plate to be cultured in a Cm +2YT + P culture medium at 37 ℃ and 220rpm, and incubating for a period of time to obtain a bacterial liquid; transferring the bacterial liquid into a Cm +2YT + P culture medium according to a preset proportion, incubating for a period of time at 37 ℃ and 220 rpm; placing the S30B buffer solution on ice for precooling, adding DTT, and treating for a period of time on ice; adding Cm +2YT + P culture medium into several conical flasks, transferring the bacterial liquid into Cm +2YT + P culture medium, incubating at 37 deg.C and 220rpm until OD600 is 1.5-2.0, subpackaging, centrifuging, and collecting thallus; adding a DTT-containing S30B buffer solution into the thalli, and centrifugally collecting the thalli after the thalli are completely resuspended; the pellet weight of the cells was weighed and stored in liquid nitrogen to terminate the intracellular reaction.

Wherein, preparing cell extract according to thallus comprises: unfreezing the thallus and adding an S30A buffer solution; crushing under high pressure to obtain homogenate; centrifuging the homogenate to remove genomic DNA, and separating to obtain a first supernatant; incubating the first supernatant to cause ribosomes to end up dispersing from the RNA, degrading the mRNA; adding DTT into an S30B buffer solution, uniformly mixing, adding into the incubated first supernatant, centrifuging, and separating to obtain a second supernatant; dialyzing the second supernatant, centrifuging, treating with liquid nitrogen, and storing.

Wherein, the sequence of the Chi6 reagent is as follows:

Chi6.fwd:TCACTTCACTGCTGGTGGCCACTGCTGGTGGCCACTGCTGGTGGCCACTGCTGGTGGCCACTGCTGGTGGCCACTGCTGGTGGCCA；

Chi6.rev:TGGCCACCAGCAGTGGCCACCAGCAGTGGCCACCAGCAGTGGCCACCAGCAGTGGCCACCAGCAGTGGCCACCAGCAGTGAAGTGA。

wherein, establishing a cell-free expression system comprises: and uniformly mixing the cell-free system buffer solution with the concentration of 4 times, the cell extract with the concentration of 3 times and the Chi6 reagent, and placing the mixture in an incubator at 37 ℃ for 5 minutes to ensure that Chi6 is fully combined and inhibit the exonuclease in the cell extract.

Wherein the phage genome comprises at least: the E.coli T7 phage genome and the E.coli T4 phage genome.

Wherein, before the phage genome is added into the cell-free expression system, the method further comprises: obtaining a phage genome; obtaining a phage genome comprising: providing host bacteria, a culture medium and Escherichia coli T7/T4 phage liquid; inoculating host bacteria into a culture medium after taking part of the culture medium for incubation, and incubating; adding T7/T4 phage liquid into the culture medium, adding the rest culture medium, and incubating until the liquid is clear; subpackaging, centrifuging and separating to obtain a third supernatant; mixing the third supernatant, NaCl and PEG8000, and incubating for a period of time; taking an LB fresh culture medium, mixing the incubated third supernatant with the LB fresh culture medium, and carrying out heavy suspension, precipitation and cleaning to obtain a heavy suspension liquid; adding chloroform into the heavy suspension liquid, and performing centrifugal separation to obtain a fourth supernatant; adding RNase and DNase into the fourth supernatant, fully and uniformly mixing, and incubating; cooling on ice, adding a precooled phage precipitation solution, incubating, centrifuging, removing supernatant, and resuspending the precipitate; adding protease K and SDS solution, incubating, adding phenol-chloroform mixed solution, and mixing gently; centrifuging and separating to obtain an upper aqueous phase; adding 2 times volume of anhydrous ethanol pre-cooled at-20 ℃ into the upper water phase, and gently mixing uniformly; standing on ice, centrifuging at 0 deg.C, and removing supernatant; adding 70% ethanol pre-cooled at-20 deg.C, centrifuging at 0 deg.C, and removing supernatant; the DNA precipitate was dissolved in water and stored at-20 ℃ after the concentration was determined.

In order to solve the above technical problem, another technical solution adopted by the present application is: provides an application of a phage genome rescue method based on a cell-free expression system in the rescue of genomes of Escherichia coli T7 phage and T4 phage.

The beneficial effect of this application is: in contrast to the state of the art, the present application establishes a cell-free expression system, wherein the cell-free expression system comprises at least: the cell-free system comprises a cell-free system buffer solution, a cell extract and a Chi6 reagent, wherein the cell-free system buffer solution contains exogenous supplementary components, and after a phage genome is added into a cell-free expression system, corresponding functional proteins can be expressed and are self-assembled into phage particles. The method of the application does not need the process that the phage genome breaks through the cell wall and the cell membrane enters the cell, overcomes the main obstacle of the rescue of the phage genome, expands the means of the rescue of the phage genome and enables the rescue of the phage genome to become simple and feasible.

Drawings

In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings needed to be used in the description of the embodiments are briefly introduced below, and it is obvious that the drawings in the following description are only some embodiments of the present application, and it is obvious for those skilled in the art to obtain other drawings based on these drawings without creative efforts. Wherein:

FIG. 1 is a schematic flow diagram of a method for phage genome rescue based on a cell-free expression system as provided in the first embodiment of the present application;

FIG. 2 is a schematic flow diagram of a phage genome rescue method based on a cell-free expression system provided in a second embodiment of the present application;

FIG. 3 is a schematic flow diagram of a phage genome rescue method based on a cell-free expression system provided in a third embodiment of the present application;

FIG. 4 is a schematic flow diagram of a phage genome rescue method based on a cell-free expression system provided in a fourth embodiment of the present application;

FIG. 5 is a schematic flow chart of a phage genome rescue method based on a cell-free expression system provided in a fifth embodiment of the present application;

FIG. 6 shows the results of the cell-free expression system of the present application for expressing Red Fluorescent Protein (RFP) and Green Fluorescent Protein (GFP);

FIG. 7 shows the results of the cell-free expression system of the present application for expressing linear DNA;

FIG. 8 is the result of the rescue of the cell-free expression system of the present application for the T7 phage genome;

FIG. 9 is the result of the rescue of the cell-free expression system of the present application for the T4 phage genome.

Detailed Description

The technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the drawings in the embodiments of the present application, and it is obvious that the described embodiments are only a part of the embodiments of the present application, and not all the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present application.

During long-term development, the inventors of the present application found that the major obstacles to the rescue of phage genome were: the blockage of bacterial cell wall and cell membrane, conventional rescue means (such as electric transformation, chemical transformation or L-type cell rescue technology) have let bacteriophage genome break through cell wall and cell membrane at present, enter inside the cell, and then accomplish gene expression, DNA replication and capsid protein assembly of bacteriophage genome etc. to breed active bacteriophage granule. The size of the tailed phage genome currently found is typically between 16kb to 735kb, and most are larger than 40 kb. Conventional rescue means (e.g., electro-transformation and chemical transformation) have low efficiency for transforming phage genomes larger than 40kb and cannot be effectively used for the rescue of the phage genomes. Furthermore, the rescue of gram-positive bacteriophages by L-type cells covers a limited range of temperatures, and gram-negative bacteriophages cannot be rescued by L-type cells due to the large difference between the transcription and translation mechanisms of gram-negative and gram-positive bacteria.

In view of this, the present application provides a phage genome rescue method based on a cell-free expression system. As shown in fig. 1, the method comprises the steps of:

s10: establishing a cell-free expression system, wherein the cell-free expression system at least comprises: buffer solution of cell-free system, cell extract and Chi6 reagent.

S20: the phage genome is added to a cell-free expression system to accomplish DNA replication, RNA transcription and protein translation, and self-assemble into active phage particles.

Specifically, the cell-free expression system is an efficient and rapid in vitro protein synthesis means, in this embodiment, on the basis of the cell extract, a cell-free system buffer solution containing exogenous supplementary components and a Chi6 reagent are added, wherein the exogenous supplementary components include but are not limited to RNA polymerase, amino acids, tRNA and the like, the Chi6 reagent can enable the cell-free expression system to express the phage genome more efficiently, thereby achieving phage genome DNA replication, RNA transcription and protein translation in vitro, and the protein can self-assemble (self-assembly) into phage particles. Therefore, the process that the phage genome breaks through the cell wall and the cell membrane to enter the cell is not needed, and the main obstacle of phage genome rescue is overcome.

In contrast to the state of the art, the present application establishes a cell-free expression system, wherein the cell-free expression system comprises at least: the cell-free system comprises a cell-free system buffer solution, a cell extract and a Chi6 reagent, wherein the cell-free system buffer solution contains exogenous supplementary components, and after a phage genome is added into a cell-free expression system, corresponding functional proteins can be expressed and are self-assembled into phage particles. The method of the application does not need the process that the phage genome breaks through the cell wall and the cell membrane enters the cell, overcomes the main obstacle of the rescue of the phage genome, expands the means of the rescue of the phage genome and enables the rescue of the phage genome to become simple and feasible.

In one embodiment, as shown in fig. 2, before step S10, the method further includes the steps of:

s30: cell-free system buffer was prepared.

Specifically, the preparation of the buffer solution of the cell-free system comprises the following steps:

step 1: a plurality of reagent stock solutions were prepared separately according to table 1 below.

TABLE 1 concentration and weighing of the respective reagent mother liquors

In table 1, each reagent was used as an exogenous supplement component.

Step 2: according to table 2, a portion of the reagent mother liquor in table 1 was prepared as a 14-fold concentration energy generation mother liquor.

TABLE 2

And step 3: the remaining reagent stock solution in Table 1 was added to the 14-fold concentration of the energy generation stock solution according to Table 3 to prepare a 4-fold concentration of cell-free system buffer, and stored at-80 ℃.

TABLE 3

Name of mother liquid of reagent	Volume (μ L)
		Energy generation mother liquor with 14 times concentration	142.85
10 times concentrated amino acid solution	200
		Mg-glutamate(1M，4mM)	8
K-glutamate(1M，60mM)	40
		PEG8000(40％，2％)	100
DTT(1M，2mM)	4
		Water (W)	Adding to 500 μ L

And 4, step 4: after synthesizing an exonuclease inhibitor Chi6 positive-negative chain (hereinafter referred to as Chi6 reagent) of a cell-free expression system, a Chi6 reagent and a cell-free system buffer solution are mixed according to a final concentration of 10nM, PCR annealing is performed, and the mixture is stored at-20 ℃.

In one embodiment, as shown in fig. 3, before step S10, the method further includes the steps of:

s40: cell extracts were prepared.

In an embodiment, as shown in fig. 4, step S40 specifically includes the following steps:

s41: incubating and collecting the thallus.

S42: cell extracts were prepared from the cells.

Specifically, the incubation and the collection of the thalli specifically comprise the following steps:

step 1: BL21 Rosetta2 strain stored at-80 ℃ was removed, BL21 Rosetta2 strain was spread on Cm resistant plates, streaked, and incubated overnight.

Step 2: 3-4 monoclonals on Cm-resistant plates were picked, inoculated into 3mL of Cm +2YT + P medium (37 ℃, pre-warmed for 30 min), incubated at 220rpm, 37 ℃ for 7.5 hours.

And step 3: after 7.5 hours, 100. mu.L of Cm +2YT + P medium inoculated with BL21 Rosetta2 strain was mixed with 50mL of fresh Cm +2YT + P medium (37 ℃ C., pre-heated for 30 minutes), incubated at 220rpm and 37 ℃ for 8 hours.

And 4, step 4: after 6 hours, placing the S30B buffer solution on ice for precooling, and dissolving on DTT ice; after 7.5 hours, 300mL of medium (37 ℃ C., pre-heating for 30 minutes) was added to 13 1L Erlenmeyer flasks; after 8 hours, 2mL of the suspension of step 3 was inoculated into a 1L Erlenmeyer flask at 220rpm at 37 ℃ and incubated until OD600 (10-fold dilution of the measured OD) was between 1.5 and 2.0, and the resulting suspension was dispensed into 200mL centrifuge cups, centrifuged at 5000 Xg for 12 minutes, and centrifuged at 4 ℃ to collect the suspension.

And 5: 2mL of 1M DTT was added to 1L of S30B buffer. After the centrifugation was completed, the supernatant was removed. 100mL of S30A buffer was added to each centrifuge cup to completely resuspend the cells. After centrifugation at 5000 Xg for 12 minutes at 4 ℃ and removal of the supernatant, washing was repeated once.

Step 6: adding 50mL of S30A buffer solution, suspending, transferring to a pre-cooled 50mL centrifuge tube, centrifuging at 4 ℃ for 12 minutes at 5000 Xg, completely sucking the supernatant with a gun head, centrifuging again, completely removing the supernatant, weighing the precipitate weight of the thallus, soaking the precipitate thallus in liquid nitrogen for 2 minutes, and storing at-80 ℃ for 1 day to stop the intracellular reaction.

The ingredients and weights of the S30A buffer and the S30B buffer are shown in Table 5.

TABLE 5

Name of reagent	Concentration (mM)	Molecular weight	Weighing (g)
				Tris solution	50	121	6
Mg-glutamate	14	214	3
				K-glutamate	60	185	11

Wherein the S30A buffer solution is prepared by weighing the components in Table 5, adjusting pH to 7.7 with acetic acid, autoclaving, and storing at 4 deg.C. Before use, adding 1M DTT, wherein the addition amount of DTT is 2 mL/L;

S30B buffer solution was prepared by weighing the components and the prepared solution according to Table 5, adjusting pH to 8.2 with acetic acid, autoclaving, and storing at 4 ℃. Before use, DTT was added at a concentration of 1M, and the amount of DTT added was 1 mL/L.

Specifically, the preparation of the cell extract according to the thalli specifically comprises the following steps:

step 1: after thawing the precipitated cells, 1mL of S30A buffer was added to 1g of the cells, and the mixture was thoroughly mixed with S30A buffer.

Step 2: the above cells were crushed under high pressure at 900bar for 5 minutes to obtain a homogenate.

And step 3: taking out the homogenate, placing the homogenate in a 50mL centrifuge tube, and centrifuging the homogenate at 30000 Xg for 30 minutes at 4 ℃ to remove the genomic DNA; the supernatant was taken out and placed in a 50mL centrifuge tube and centrifuged at 30000 Xg for 30 minutes at 4 ℃ to separate the supernatant and place it in a special centrifuge tube (RNase and DNase free).

And 4, step 4: after incubation at 37 ℃ for 80 minutes (dark environment, shaking at 220 rpm) to stop the ribosomes from dispersing from the RNA, the mRNA was degraded and the solution became cloudy after incubation. A dialysis material was prepared by adding 1mL of 1M DTT to 1L of S30B buffer solution, mixing, adding to a beaker, and adding to a rotor.

And 5: centrifugation was carried out at 12000 Xg at 4 ℃ for 10 minutes, and the supernatant was put into a dialysis bag and dialyzed at 4 ℃ for 80 minutes.

Step 6: the supernatant was taken into a 1.5mL centrifuge tube and centrifuged at 12000 Xg for 10 minutes at 4 ℃.

And 7: and (4) treating the supernatant obtained in the step 6 with liquid nitrogen for 2 minutes, and storing at-80 ℃.

Wherein, the protein concentration of the supernatant obtained in the step 7 is measured by using Brad for dassay, which must be more than 27 mg/mL.

In one embodiment, the sequence of the Chi6 reagent is as follows:

in one embodiment, the phage genome comprises at least: the E.coli T7 phage genome and the E.coli T4 phage genome.

In one embodiment, as shown in fig. 5, before step S10, the method further includes the steps of:

s50: and (5) obtaining a phage genome.

Specifically, obtaining the phage genome specifically comprises the following steps:

step 1: 15mL of host cells, 1.6L of medium, and 15mL of Escherichia coli T4/T7 phage liquid were prepared.

Step 2: 1.2L of the medium was incubated at 37 ℃ in 4 flasks, inoculated with 1% inoculum, 300mL of medium plus 3mL of host bacteria per flask, and incubated at 37 ℃ for 3 hours.

And step 3: and (3) taking the rest 0.4L of culture medium to incubate to 37 ℃, inoculating 1% of the culture solution cultured in the step 2, adding 3mL of escherichia coli T4/T7 phage liquid and preheated 100mL of fresh culture medium into each bottle, shaking uniformly, dividing into 5 bottles again, and incubating at 37 ℃ for 2-3 hours until the culture solution is clear.

And 4, step 4: the bacterial suspension was dispensed into 50mL centrifuge tubes in sequence, and centrifuged at 9000 Xg for 5 minutes at 12 ℃ to obtain two supernatants (800 mL each).

And 5: 2 clean bottles were prepared, and 23.36g of NaCl and 80g of PEG8000 were weighed in each bottle.

Step 6: mixing the centrifuged two 800mL supernatants with NaCl and PEG8000, placing the mixture into a shaking table, gently shaking the mixture until the mixture is completely dissolved, subpackaging the mixture into 50mL centrifuge tubes, and incubating at 4 ℃ overnight or 6 to 8 hours.

And 7: 40mL of LB fresh medium was added to each of the 50mL centrifuge tubes, centrifuged at 12000g × g at 4 ℃ for 10 minutes, the supernatant and the pellet were separated, and the pellet in the centrifuge tube was resuspended in 10mL of LB fresh medium, and the pellet was washed once with 10mL of LB fresh medium, separated and resuspended in liquid.

And 8: 10mL of chloroform was added to each of two resuspension liquids (about 40mL), and the mixture was mixed well to give a milky white color, left to stand for 10 minutes to separate layers, centrifuged at 10000 Xg for 10 minutes, and the supernatant was transferred to a new 50mL centrifuge tube, with the proviso that the chloroform layer and the precipitate were not removed.

And step 9: mu.L RNase and 160. mu.L DNase were added to each tube, mixed well and incubated at 37 ℃ for 30 minutes.

Step 10: and (3) placing the centrifuge tubes in the step (9) on ice for cooling for 10 minutes, then respectively adding 8mL of precooled phage precipitation solution into each centrifuge tube, slightly reversing and uniformly mixing, and then placing on ice for cooling for more than 1 hour.

Step 11: after centrifugation at 12000g × g for 15 minutes at 4 ℃ and removal of the supernatant, the pellet was resuspended in 400 μ Ltris (pH 7.8).

Step 12: adding 250 mu g/mL proteinase K and 50 mu L10% SDS solution, incubating at 37 ℃ for 30 minutes, adding an equal volume of phenol-chloroform mixed solution (phenol: chloroform ═ 1: 1), gently mixing, and taking the mixture in the form of emulsion;

step 13: centrifuging at 12000r for 10 min, transferring the upper aqueous phase into a new centrifuge tube, adding chloroform with the same volume, gently mixing, centrifuging at 12000r for 10 min, and transferring the upper aqueous phase into the new centrifuge tube.

Step 14: adding 2 times of precooled absolute ethyl alcohol with the temperature of-20 ℃, softly and uniformly mixing, and placing on ice for cooling for 30 minutes.

Step 15: centrifuging at 14000r at 0 ℃ for 10 minutes, and removing supernatant;

step 16: adding 400 μ L, pre-cooling at-20 deg.C in 70% ethanol, centrifuging at 0 deg.C 14000r for 10 min, and removing supernatant.

And step 17: after being opened and kept stand for 5 minutes at room temperature, the DNA precipitate is dissolved by 50 mu L of water, and the DNA precipitate is stored at the temperature of minus 20 ℃ after the concentration is detected.

In an embodiment, step S10 specifically includes:

a10. mu.L cell-free expression system was established according to Table 6 and placed in an incubator at 37 ℃ for 5 minutes to allow Chi6 to bind well and inhibit exonuclease in cell extracts.

The phage genome obtained in step S50 was then added according to the ratios in table 6 to complete DNA replication, RNA transcription and protein translation, and self-assembled into active phage particles.

TABLE 6

After step S20, a Red Fluorescent Protein (RFP) plasmid and a Green Fluorescent Protein (GFP) plasmid were added to the cell-free expression system to test the protein expression function of the cell-free expression system. After 8 hours at 30 ℃ the results were directly observed by means of a fluorescence transilluminator. Wherein, RNA polymerase of antibiotic rifampicin inhibition system was added to the cell-free expression system as a negative control. As shown in FIG. 6, significant expressed fluorescence was still observed after the reaction system was diluted 5-fold with PBS, respectively.

As shown in FIG. 7, because the linearization proportion of the phage genome is high, the efficiency of the newly prepared cell-free expression system directly used for phage rescue is very low, and Chi6 reagent is added into the cell-free expression system to resist the system exonuclease activity, so that the cell-free expression system can be directly used for PCR products or linear DNA expression, but the expression linearization fragment is less effective than the plasmid.

As shown in FIG. 8, the cell-free expression system was used to rescue the T7 phage genome at an expression concentration of 10⁷Above mL, the control group, to which the RNA inhibitor rifampicin was added, did not rescue the phage genome.

As shown in FIG. 9, the T4 phage genome was rescued by a cell-free expression system, and the whole wild-type T4 phage genome (169kb) was added to the cell-free expression system, and after 8 hours of reaction at 30 ℃, the results were observed on a dot-plate: different phage genome qualities are tested (0.25 to 2 mug), the lowest 0.25 mug can be successfully rescued, and when the DNA quality is 1 to 1.5 mug, the expression quantity is the highest and is 10¹⁰Each active particle per ml, suggesting that the rescue of the T4 phage genome can be completed within 8 hours, which is short. The control group added with the RNA inhibitor rifampicin is not expressed, which shows that the T4 phage genome DNA and a cell-free reaction system are not polluted by phage, and the cell-free expression system developed by the application can efficiently perform in-vitro expression and packaging of the phage.

The application also provides application of the phage genome rescue method based on the cell-free expression system in the rescue of genomes of Escherichia coli T7 phage and T4 phage.

It can be understood that the phage genome rescue method based on the cell-free expression system can also be applied to rescue of other phage genomes to prepare corresponding other bacteria into corresponding cell-free expression systems.

The above description is only for the purpose of illustrating embodiments of the present application and is not intended to limit the scope of the present application, and all modifications of equivalent structures and equivalent processes, which are made by the contents of the specification and the drawings of the present application or are directly or indirectly applied to other related technical fields, are also included in the scope of the present application.

Claims

1. A phage genome rescue method based on a cell-free expression system, which is characterized by comprising the following steps:

establishing a cell-free expression system, wherein the cell-free expression system at least comprises: buffer solution of a cell-free system, cell extract and Chi6 reagent;

the phage genome is added to the cell-free expression system to accomplish DNA replication, RNA transcription and protein translation, and self-assemble into active phage particles.

2. The method of claim 1, wherein prior to establishing the cell-free expression system, the method further comprises: preparing the cell-free system buffer solution;

the preparation of the cell-free system buffer solution comprises the following steps:

preparing a first liquid;

preparing a second liquid according to the first liquid, wherein the second liquid at least comprises: HEPES buffer, tRNA, coenzyme A (CoA), NAD, cyclic adenosine monophosphate (cAMP), Folinic Acid (Folic Acid), Spermidine (Spermidine), 3-PGA, ATP, GTP, CTP, UTP;

preparing a third liquid from the second liquid, the third liquid comprising at least: HEPES buffer, tRNA, coenzyme A (CoA), Nicotinamide Adenine Dinucleotide (NAD), cyclic adenosine monophosphate (cAMP), Folinic Acid (Folic Acid), Spermidine (Spermidine), 3-PGA, ATP, GTP, CTP, UTP, polyethylene glycol, magnesium glutamate (Mg-glutamate), potassium glutamate (K-glutamate), Tris, KOH, DTT;

and mixing the positive and negative strands Chi6 serving as an exonuclease inhibitor and the third liquid, and carrying out PCR (polymerase chain reaction) annealing to obtain the cell-free system buffer solution.

3. The method of claim 1, wherein prior to establishing the cell-free expression system, the method further comprises: preparing a cell extract;

the preparation of the cell extract comprises the following steps:

incubating and collecting thalli;

preparing the cell extract according to the thallus.

4. The method of claim 3, wherein the incubating and collecting the biomass comprises:

coating BL21 Rosetta2 strain on Cm resistant plates, streaking the plates, and incubating for a period of time;

selecting a plurality of monoclonals on the Cm resistant plate to be cultured in a Cm +2YT + P culture medium at 37 ℃ and 220rpm, and incubating for a period of time to obtain a bacterial liquid;

transferring the bacterial liquid into a Cm +2YT + P culture medium according to a preset proportion, incubating for a period of time at 37 ℃ and 220 rpm;

placing the S30B buffer solution on ice for precooling, adding DTT, and treating for a period of time on ice;

adding Cm +2YT + P culture medium into several conical flasks, transferring the bacterial liquid into Cm +2YT + P culture medium, incubating at 37 deg.C and 220rpm until OD600 is 1.5-2.0, subpackaging, centrifuging, and collecting thallus;

adding the S30B buffer solution containing DTT into the thalli, and centrifugally collecting the thalli after the thalli are completely resuspended;

the pellet weight of the cells was weighed and stored in liquid nitrogen to terminate the intracellular reaction.

5. The method of claim 4, wherein the preparing the cell extract from the thallus comprises:

thawing the thallus and adding S30A buffer solution;

crushing under high pressure to obtain homogenate;

centrifuging the homogenate to remove genomic DNA, and separating to obtain a first supernatant;

incubating the first supernatant to cause ribosomes to end up dispersing from the RNA, degrading the mRNA;

adding DTT into an S30B buffer solution, uniformly mixing, adding into the incubated first supernatant, centrifuging, and separating to obtain a second supernatant;

dialyzing the second supernatant, centrifuging, treating with liquid nitrogen, and storing.

6. The method of claim 1, wherein the sequence of the Chi6 reagent is as follows:

7. the method of claim 1, wherein the establishing a cell-free expression system comprises:

and uniformly mixing the cell-free system buffer solution with the concentration of 4 times, the cell extract with the concentration of 3 times and the Chi6 reagent, and placing the mixture in an incubator at 37 ℃ for 5 minutes to ensure that Chi6 is fully combined and inhibit the exonuclease in the cell extract.

8. The method of claim 1, wherein the phage genome comprises at least: the E.coli T7 phage genome and the E.coli T4 phage genome.

9. The method of claim 8, wherein prior to adding the phage genome to the cell-free expression system, the method further comprises: obtaining the phage genome;

the obtaining the phage genome, comprising:

providing host bacteria, a culture medium and Escherichia coli T7/T4 phage liquid;

inoculating the host bacteria into the culture medium after taking part of the culture medium for incubation, and incubating;

adding the T7/T4 phage liquid to the medium and adding the rest of the medium, and incubating until the liquid is clear;

subpackaging, centrifuging and separating to obtain a third supernatant;

mixing the third supernatant, NaCl, and PEG8000, and incubating for a period of time;

taking an LB fresh culture medium, mixing the incubated third supernatant with the LB fresh culture medium, carrying out heavy suspension, precipitation and cleaning to obtain a heavy suspension liquid;

adding chloroform into the heavy suspension liquid, and performing centrifugal separation to obtain a fourth supernatant;

adding RNase and DNase into the fourth supernatant, fully and uniformly mixing, and incubating;

cooling on ice, adding a precooled phage precipitation solution, incubating, centrifuging, removing supernatant, and resuspending the precipitate;

adding protease K and SDS solution, incubating, adding phenol-chloroform mixed solution, and mixing gently;

centrifuging and separating to obtain an upper aqueous phase;

adding 2 times of anhydrous ethanol precooled at the temperature of-20 ℃ into the upper-layer water phase, and gently and uniformly mixing;

standing on ice, centrifuging at 0 deg.C, and removing supernatant;

adding 70% ethanol pre-cooled at-20 deg.C, centrifuging at 0 deg.C, and removing supernatant;

the DNA precipitate was dissolved in water and stored at-20 ℃ after the concentration was determined.

10. Use of the method of any one of claims 1-9 for rescuing the genomes of e.coli T7 bacteriophage and T4 bacteriophage.