CN112522416A

CN112522416A - Primer for screening early lung cancer and kit containing primer

Info

Publication number: CN112522416A
Application number: CN202110089018.3A
Authority: CN
Inventors: 刘天津; 姜翠翠; 赵鑫; 高紫阳; 刘凯年
Original assignee: Weifang Jitao Medical Technology Co ltd
Current assignee: Weifang Jitao Medical Technology Co ltd
Priority date: 2021-01-22
Filing date: 2021-01-22
Publication date: 2021-03-19

Abstract

The invention belongs to the technical field of biology, and provides a primer for screening early lung cancer, which comprises a detection primer for DNA methylation of a human CDH1 gene, a detection primer for DNA methylation of a human SHOX2 gene and a detection primer for beta-actin; the invention also provides a kit containing the primer, which can be suitable for various samples such as tissues, blood and the like of lung cancer patients and has the advantages of higher sensitivity, specificity and the like.

Description

Primer for screening early lung cancer and kit containing primer

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a primer for screening early lung cancer and a kit containing the primer.

Background

The lung cancer is a lung malignant tumor originated from a bronchial mucosa, a gland or an alveolar epithelium, is one of the malignant tumors with the highest global incidence, and is shown by the latest statistical data of 2018 in the world health organization, the lung cancer is the most common malignant tumor in the world, the lung cancer is ranked first in the incidence ratio of various cancers (11.6%, which is parallel to female breast cancer), and the lung cancer is ranked first in the death ratio of the cancers (18.4%). At present, the early diagnosis of lung cancer comprises chest X-ray and low-dose spiral CT diagnosis, sputum cell examination, fiber bronchoscopy, percutaneous lung aspiration biopsy and other examination methods, and the clinical diagnosis methods have many limitations due to the high diagnosis cost, the limitation of technology and instruments, the trauma of patients and the like. And the early discovery, early diagnosis and early treatment have great significance for prolonging the life cycle of the lung cancer tumor patients.

DNA methylation is a novel molecular marker, and the importance of DNA methylation in tumor diagnosis is increasingly emphasized. Studies have shown that epigenetic changes are significantly associated with lung cancer, which occurs in the early stages with abnormal changes in the DNA methylation profile. The large amount of DNA methylation modification changes can be used as a potential biomarker to be applied to lung cancer clinical diagnosis and early screening, so that the detection rate and the survival rate of lung cancer patients are improved. On the other hand, abnormalities in DNA methylation have important effects on the occurrence, progression, prognosis, drug resistance, and the like of lung cancer. Therefore, the research on the abnormal DNA methylation in the early stage of the lung cancer has important clinical guiding significance for the molecular mechanism of the formation of the lung cancer, the search of diagnosis indexes and the prognosis judgment indexes.

Disclosure of Invention

Aiming at the defects in the prior art, the invention provides a primer for screening early lung cancer and a kit containing the primer, and establishes a lung cancer detection kit with good specificity and high sensitivity. Thus, the present invention has been completed.

In order to solve the technical problems, the invention adopts the following technical scheme:

a primer for screening early lung cancer comprises a detection primer for DNA methylation of a human CDH1 gene, a detection primer for DNA methylation of a human SHOX2 gene and a detection primer for beta-actin.

The following is a further improvement of the above technical solution:

the detection primers for DNA methylation of the human SHOX2 gene comprise an upstream primer aiming at the SHOX2 gene, a downstream primer aiming at the SHOX2 gene and a probe primer aiming at the SHOX2 gene; the detection primers for DNA methylation of the human CDH1 gene comprise an upstream primer aiming at CDH1 gene, a downstream primer aiming at CDH1 gene and a probe primer aiming at CDH1 gene.

Therefore, the first purpose of the invention is to provide that the upstream primer aiming at the SHOX2 gene is GTTTTTTGGATAGTTAGGTAAT as shown in SEQ ID NO.1 of the sequence table.

The downstream primer aiming at the SHOX2 gene is CCTCCTACCTTCTAACCC, and is shown as SEQ ID NO.2 in a sequence table.

The probe primer aiming at the SHOX2 gene is HEX-CCGGGGTTGTATGAGTATAGGCCCCGG-BHQ1, and is shown as SEQ ID NO.3 in the sequence table.

The upstream primer aiming at the CDH1 gene is TGGGATTATAGGCGTTTATTATTAC, and is shown as SEQ ID NO.4 in a sequence table.

The downstream primer aiming at the CDH1 gene is AACACTTTAAAAAACCGAAACGA, and is shown as SEQ ID NO.5 in a sequence table.

The probe primer aiming at the CDH1 gene is FAM-GGGTTGTATGAGTATAGGCC-BHQ1, and is shown as SEQ ID NO.6 in the sequence table.

The detection primers of the beta-actin are as follows:

beta-actin-F: GGAGGTTTAGTTTTTTGGATT, as shown in SEQ ID NO.7 of the sequence list,

beta-actin-R: CAATAAAACCTACTCCTCCCTTA, as shown in SEQ ID NO.8 of the sequence Listing

beta-actin-P: VIC-TTGTGTGTTGGGTGGTGGTT-BHQ1 as shown in SEQ ID NO.9 of the sequence list.

The kit comprises the primer for screening the early lung cancer.

Aiming at the promoter region of CDH1 gene and SHOX2 gene which are hypermethylated in lung cancer patients, the invention designs specific probes or primers and verifies the primers in more lung cancer tissues and blood samples.

The kit mainly adopts a method of Taqman-MGB probe detection, optimizes a reaction system and reaction conditions by the specific combination of the probe and a methylation sequence, accurately detects methylation sites of human CDH1 and SHOX2 genes, and has higher sensitivity and specificity. The specific probe, primer or other nucleotide sequence and the like of the invention are obtained by the conventional technology in the field, such as full sequence synthesis, fluorescence labeling and the like.

Compared with the prior art, the invention has the following beneficial effects:

1. the noninvasive liquid biopsy technology is adopted, so that the operation is simple and convenient;

2. the whole PCR process adopts a totally closed form from DNA extraction to amplification, so that cross contamination is avoided;

3. the Taqman-MGB probe has high sensitivity and strong specificity;

precise detection of methylation sites of CDH1 gene and SHOX2 gene.

Drawings

FIG. 1: detection of amplification curves of SHOX2 gene in different samples.

FIG. 2: detection of amplification curves of CDH1 gene in different samples.

Detailed Description

The following examples and experimental examples are intended to further illustrate the present invention and should not be construed as limiting the present invention. The experimental methods are conventional methods unless otherwise specified. The primer, the probe, the fluorescence labeling probe and other nucleotide sequences, strains, carriers, instruments, experimental consumables, kits, buffer solutions, reagents, nucleotide sequencing and the like are provided by Biotechnology engineering (Shanghai) GmbH or related suppliers if no special instructions exist, and all the experimental reagents and consumables can be obtained through normal commercial supply channels.

Example 1 the present invention provides a primer for screening early lung cancer, which includes a detection primer for DNA methylation of human CDH1 gene, a detection primer for DNA methylation of human SHOX2 gene, and a detection primer for β -actin.

The primers for detecting DNA methylation of human SHOX2 gene are as follows:

SHOX2-F (upstream primer for SHOX2 gene):

GTTTTTTGGATAGTTAGGTAAT（SEQ ID NO.1）。

SHOX2-R (downstream primer for SHOX2 gene):

CCTCCTACCTTCTAACCC（SEQ ID NO.2）

SHOX2-P (probe primer for SHOX2 gene): HEX-CCGGGGTTGTATGAGTATAGGCCCCGG-BHQ1 (SEQ ID NO. 3).

The primers for detecting DNA methylation of the human CDH1 gene are as follows:

CDH1-F (forward primer for CDH1 gene): TGGGATTATAGGCGTTTATTATTAC (SEQ ID NO. 4).

CDH1-R (downstream primer for CDH1 gene): AACACTTTAAAAAACCGAAACGA (SEQ ID NO. 5).

CDH1-P (probe primer for CDH1 gene): FAM-GGGTTGTATGAGTATAGGCC-BHQ1 (SEQ ID NO. 6).

Detection primers for beta-actin:

beta-actin-F (upstream primer for beta-actin gene): GGAGGTTTAGTTTTTTGGATT (SEQ ID NO. 7).

beta-actin-R (downstream primer for beta-actin gene): CAATAAAACCTACTCCTCCCTTA (SEQ ID NO. 8).

beta-actin-P (probe primer for beta-actin gene): VIC-TTGTGTGTTGGGTGGTGGTT-BHQ1 (SEQ ID NO. 9).

Beta-actin is an internal reference that ensures that the samples (templates) used to detect the expression level of the gene of interest are qualitatively identical.

Example 2 kit comprising the above primers

TABLE 1 major Components of the kit

In the PCR reaction solution, the mass concentration of each primer is 60 mu M;

the enzyme activity of the DNA polymerase is 0.125U.

Example 3 the specific detection method is as follows:

1. extracting DNA (extracting DNA by using magenta D3121 DNA extraction kit)

Sample treatment: nucleic acid extracted from cell-containing sample, such as tissue from lesion, pleural effusion, etc.; or a sample containing nucleic acids derived from cells, such as plasma, serum, etc. Different processing methods are adopted for samples from different sources

And (3) column chromatography purification: adding 250 mu l of absolute ethyl alcohol into the digestive juice, and uniformly mixing in a vortex for 15-20 s; HiPure gDNA Mini Column in 2ml collection tube, transfer the mixture to the Column, 12,000 x g centrifugation for 1 minutes; the filtrate was decanted, the column was returned to the collection tube, 500. mu.l of Buffer GW1 was added to the column, and centrifugation was carried out at 12,000 Xg for 1 minute; the filtrate was decanted, the column was returned to the collection tube, 650. mu.l Buffer GW2 was added to the column, and centrifugation was carried out at 12,000 Xg for 1 minute; the filtrate was decanted, the column was returned to the collection tube and centrifuged at 12,000 Xg for 2 minutes; the column is placed in a new 1.5ml centrifuge tube, 30-100 mul of Buffer AE preheated to 70 ℃ is added to the center of the membrane of the column, the column is placed for 3 minutes, and the column is centrifuged for 1 minute at 12,000 Xg; adding 30-100 mul of Buffer AE preheated to 70 ℃ to the center of the membrane of the column, standing for 3 minutes, and centrifuging for 1 minute at 12,000 Xg; discarding the DNA binding column, storing the DNA at 2-8 ℃ for a long time at-20 ℃.

2. Sulfite treatment of DNA (Using EZ-96 DNA methylation Kit)

(1) Add 110. mu.l CT Conversion Reagent to 2ml centrifuge tube containing 40. mu.l DNA solution, vortex and mix for 15 s;

(2) placing the centrifuge tube in a thermal cycler, and performing the following steps: 10min at 98 ℃, 2.5h at 64 ℃ and no more than 20h at 4 ℃;

(3) adding 600 mu l of M-Binding Buffer and 10 mu l of Magbinding Beads into each centrifuge tube, and uniformly mixing for 15s by vortex;

(4) standing the centrifuge tube for 5 minutes at room temperature, then transferring the centrifuge tube to a magnetic frame, standing for 5 minutes, removing liquid, and transferring 2ml of the centrifuge tube to the centrifuge tube frame;

(5) adding 400 mu l M-Wash Buffer, vortexing for 15s, uniformly mixing magnetic beads, transferring to a magnetic frame, standing for adsorption for 3 minutes, removing liquid, and transferring a 2ml centrifuge tube to a centrifuge tube frame;

(6) adding 200 mu l M-depletion Buffer into the magnetic beads, swirling for 30s, standing the centrifugal tube for 15-20min, transferring the centrifugal tube to a magnetic frame for adsorption for 3 min, and sucking out the supernatant;

(7) add 400 u l M-Wash Buffer, vortex and mix for 15s, in the magnetic frame adsorption for 3 minutes, suction supernatant.

(8) Repeating the step 7;

(9) placing the centrifugal tube at 55 ℃ and heating for 20-30 min to dry the magnetic beads so as to remove redundant washing liquid;

(10) and (3) elution: add 25. mu. l M-Elution Buffer and vortex for 15 s. The DNA was transferred to a 55 ℃ metal bath for 4min, then transferred to a magnetic stand and allowed to stand for 1min, and the supernatant was aspirated into a new 2ml centrifuge tube to store the DNA.

3. PCR detection

(1) Reaction system

Negative and positive controls must be carried simultaneously for each test.

(2) Reaction conditions

The PCR conditions were as follows:

4. analysis of results

(1) And (3) judging the validity of the experimental result: both FAM and HEX signals should be sent to the positive quality control reaction tube, and FAM and HEX amplification signals should not be sent to the negative quality control reaction tube.

(2) Confirming a correction fluorescence reference, setting and analyzing an FAM fluorescence signal, simultaneously selecting a positive quality control substance reaction tube and a sample reaction tube, determining an inflection point of an amplification curve according to the line condition of an actual amplification area, and adjusting the position of a base line to obtain the Ct value of the FAM fluorescence signal.

The amplification curve of the FAM fluorescence signal is in a smooth S shape, the Ct value is less than 35, and the positive methylation of the human CDH1 gene is prompted; b) the Ct value is more than or equal to 35, and the methylation negativity or the methylation degree of the CDH1 gene is indicated to be lower than the lowest detection limit;

(3) confirming a correction fluorescence reference, setting and analyzing an HEX fluorescence signal, simultaneously selecting a positive quality control substance reaction tube and a sample reaction tube, determining an inflection point of an amplification curve according to the actual amplification area line condition, and adjusting the base line position. Ct values of the HEX fluorescence signals are obtained.

a) The amplification curve of the HEX fluorescence signal is in a smooth S shape, the Ct value is less than 35, and the positive methylation of the human SHOX2 gene is prompted; b) the Ct value is more than or equal to 35, which indicates that the methylation of the human SHOX2 gene is negative or the methylation degree is lower than the lowest detection limit.

Example 4

The primer for screening early lung cancer described in example 1 is based on a real-time fluorescence quantitative PCR platform, and a method for screening early lung cancer of SHOX2 gene is established by using Taqman specific fluorescence detection technology, according to the method described in example 3, the results of DNA extraction, sulfite treatment purification and PCR detection from three different samples of plasma, sputum and pathological section of the same patient are shown in FIG. 1, and at the same time, each sample is provided with a duplicate hole.

The results in FIG. 1 show that the primer of the invention has different detection sensitivity for different samples of positive patients, pathological section > plasma > sputum, and positive signals can be amplified for different positive patients.

The primer for screening early lung cancer, which is described in example 1, is based on a real-time fluorescent quantitative PCR platform, and is established by using a Taqman-specific fluorescence detection technology, and a method for screening early lung cancer of a CDH1 gene is performed according to the method described in example 3, DNA extraction, sulfuration purification and PCR detection are performed on three different samples of plasma of different patients, and the result shown in FIG. 2 shows that a probe can amplify positive signals for three different positive patients.

It should be understood that various changes and modifications can be made by those skilled in the art after reading the above disclosure, and equivalents also fall within the scope of the invention as defined by the appended claims.

Sequence listing

<110> Weifang Jie Lao medical science and technology Co Ltd

<120> primer for screening early lung cancer and kit comprising primer

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gttttttgga tagttaggta at 22

<210> 2

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

cctcctacct tctaaccc 18

<210> 3

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ccggggttgt atgagtatag gccccgg 27

<210> 4

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tgggattata ggcgtttatt attac 25

<210> 5

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

aacactttaa aaaaccgaaa cga 23

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gggttgtatg agtataggcc 20

<210> 7

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ggaggtttag ttttttggat t 21

<210> 8

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

caataaaacc tactcctccc tta 23

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ttgtgtgttg ggtggtggtt 20

Claims

1. A primer for early lung cancer screening, comprising: the primers comprise a detection primer for DNA methylation of a human CDH1 gene, a detection primer for DNA methylation of a human SHOX2 gene and a detection primer for beta-actin.

2. The primer for screening early lung cancer according to claim 1, wherein: the detection primers for DNA methylation of the human SHOX2 gene comprise an upstream primer aiming at the SHOX2 gene, a downstream primer aiming at the SHOX2 gene and a probe primer aiming at the SHOX2 gene; the detection primers for DNA methylation of the human CDH1 gene comprise an upstream primer aiming at CDH1 gene, a downstream primer aiming at CDH1 gene and a probe primer aiming at CDH1 gene.

3. The primer for screening early lung cancer according to claim 2, wherein: the upstream primer aiming at the SHOX2 gene is GTTTTTTGGATAGTTAGGTAAT, and is shown as SEQ ID NO.1 in a sequence table.

4. The primer for screening early lung cancer according to claim 2, wherein: the downstream primer aiming at the SHOX2 gene is CCTCCTACCTTCTAACCC, and is shown as SEQ ID NO.2 in a sequence table.

5. The primer for screening early lung cancer according to claim 2, wherein: the probe primer aiming at the SHOX2 gene is HEX-CCGGGGTTGTATGAGTATAGGCCCCGG-BHQ1, and is shown as SEQ ID NO.3 in the sequence table.

6. The primer for screening early lung cancer according to claim 2, wherein: the upstream primer aiming at the CDH1 gene is TGGGATTATAGGCGTTTATTATTAC, and is shown as SEQ ID NO.4 in a sequence table.

7. The primer for screening early lung cancer according to claim 2, wherein: the downstream primer aiming at the CDH1 gene is AACACTTTAAAAAACCGAAACGA, and is shown as SEQ ID NO.5 in a sequence table.

8. The primer for screening early lung cancer according to claim 2, wherein: the probe primer aiming at the CDH1 gene is FAM-GGGTTGTATGAGTATAGGCC-BHQ1, and is shown as SEQ ID NO.6 in the sequence table.

9. The primer for screening early lung cancer according to claim 1, wherein: the detection primers of the beta-actin are as follows:

beta-actin-F: GGAGGTTTAGTTTTTTGGATT, as shown in SEQ ID NO.7 of the sequence list;

beta-actin-R: CAATAAAACCTACTCCTCCCTTA, as shown in SEQ ID NO.8 of the sequence list;

10. A kit comprising a primer for early lung cancer screening according to claim 1.