CN112522107A - Stable and efficient monospore separation method for plasmodiophora brassicae, which is a strong parasitic protozoon - Google Patents

Abstract

The invention provides a stable and efficient strong-parasitic protozoon plasmodiophora brassicae monospore separation method which comprises the steps of preparing a relatively pure spore suspension by an improved sucrose gradient centrifugation method, calculating the concentration of the spore suspension by means of a blood counting plate, obtaining monosomus spores by an agar blocking plane capillary blotting method on the basis of the spore suspension with a certain concentration, and then inoculating the monosomus spores to robust root hairs of an susceptible variety ECD-05 pregermination 2-3d in an ECD system. Compared with the prior relevant research method, the method mainly solves the problems that the single spore is tiny and is not easy to position under a microscope, the liquid drop method has too many layered visual fields and is easy to dry, the single spore cannot be accurately picked by microscopic operation and the like. The planar capillary blotting method can greatly reduce the visual field range to be checked in microscopic examination, and the partitioned agar is easy to grasp, does not need advanced automatic instrument and equipment, has strong operability, and can obviously improve the efficiency of monospore separation.

Description

Stable and efficient monospore separation method for plasmodiophora brassicae, which is a strong parasitic protozoon

Technical Field

The invention belongs to the technical field of microbial monospore separation, and particularly relates to a separation technology of strong parasitic protist plasmodiophora brassicae monosomresting spores which cannot be cultured in an artificial culture medium.

Background

The clubroot of cruciferous plants is a worldwide soil-borne disease caused by infection of Plasmodiophora brassica and is an important root disease of cruciferous plants. Plasmodiophora brassicae (p. brassicae) is an obligate living parasite, and Ainsworth formally classified plasmodiophora as a protist in 1995. Research shows that plasmodiophora exists pathogenic differentiation due to physiological species difference, and naturally existing populations are often highly mixed. Mananares et al found that pathotypes could be subdivided in the physiological races determined by the existing host discrimination method, and proposed that the results of the detection only with a single spore strain are closer to the true pathogenic ability of the races (Manzanares-Dauleux et al, 2001). Therefore, in the process of genetic analysis of disease resistance, the identification result obtained by the method of single spore isolation, host propagation expansion and establishment of the plasmodiophora monospora line to identify the physiological microspore isolates (SSI) of the plasmodiophora has more reference value.

The monospore separation and inoculation methods of pathogenic microorganisms are summarized as four main methods: the automatic system has the advantages that the success rate of the automatic system applied to monospore separation of plasmodiophora can reach 40% -50% under certain conditions; but its use is limited by laboratory conditions; the second is a direct capillary method, but is more suitable for microorganisms which can grow in an artificial culture medium and grow hyphae; thirdly, the glass needle method has high environmental conditions for manufacturing requirements, the application is limited by the requirements of spore size (the spore needs to be visible under a dissecting mirror), and the operation is complicated; and fourthly, the method is a convenient and rapid plate coating method, but is not suitable for separating the strong parasitic plasmodiophora. In addition, monospore separation of plasmodiophora has also been reported, and a capillary perforation method, a marking method and a diluent dropping method are mainly used, and have certain theoretical support when viewed alone, but most of the methods are time-consuming and labor-consuming, poor in operability and high in separation difficulty. For example, a capillary tube punching method needs stable micromanipulation, one surface of water agar with single spores is difficult to take out and is infected with root hairs, a single spore in an imprinting method needs to be transferred and checked for multiple times, liquid drops are layered in a diluting liquid drop method during microscopic examination, focal length needs to be continuously adjusted for detailed searching, and under the condition of large magnification, the position of a slide needs to be adjusted for repeatedly checking multiple visual fields.

Disclosure of Invention

In view of the above, the invention aims to establish a stable and efficient method for separating plasmodiophora brassicae monospora of a strong parasitic protozoon, which can realize simple, convenient, stable and efficient separation of tiny monosomnious spores which cannot grow in an artificial culture medium under the condition of no special equipment requirement.

The technical scheme of the invention is realized as follows:

(A) cleaning root nodule, decomposing, sterilizing surface, squeezing to obtain homogenate, filtering, and centrifuging to obtain concentrated pure spore suspension.

(B) A2% g/ml water agar solution was prepared and boiled in a sterilized can to be completely clear without air bubbles. The pipette sucks 1ml onto a slide (placed in an oven in advance and dried for more than 30min), quickly covers the slide with a cover slip of a certain size, and prepares a plurality of water agar planes (which can be placed in a 10cm by 10cm plastic culture dish paved with wet filter paper and sealed for storage for about d).

(C) Calculating the concentration of concentrated spore suspension with blood counting plate, diluting with sterile water to obtain 10% concentration⁵～10⁶Blot solution/ml.

(D) Clean sharp scalpel firing sterilization, with the uneven edge of agar plane excision thickness, the piecemeal is 1 ~ 3 mm's fritter afterwards, and then absorbs the even blotting liquid of above-mentioned step (C) of a certain amount of whirlpools with the capillary of internal diameter 0.3mm, and the blotting is several on the water agar waste material, guarantees the stability of blotting afterwards, keeps capillary level or slightly tilt up 15 jiaos, and the agar plane becomes under the vertically state with the capillary, to every fritter blotting.

(E) And (3) searching the blotted agar plane block under a microscope for an agar block with single spores, positioning the agar block to be suspected of having the single spores, and checking whether the periphery of the blot is clean and only has the single spores under a low multiple. Part of the targets with interferents were checked at high magnification to confirm that there was only one single spore.

(F) And (E) grabbing the single spores obtained in the step (E) by using a pointed forceps under a 10 x/5 x objective lens, temporarily transferring the single spores onto a cover glass placed in a plastic culture dish paved with wet filter paper, and inoculating all the obtained single spores onto the root hairs of robust 2-3-day-old ECD-05 seedlings until the whole agar plane is inspected.

Further, in the step (a), the nodules must reach a stage of attack rich in dormant spores, and on the basis of this, the more nodules, the more spore precipitates obtained by extraction, and are easily separated from the supernatant.

Further, the density gradient centrifugation is: adding clear water for centrifugation for 2 times, dissolving the precipitate in 5ml of 50 wt% sucrose solution for centrifugation, taking the supernatant and the outermost layer off-white precipitate which tends to be dissolved, adding sterile water for centrifugation, and repeating the centrifugation for 2-3 times until the supernatant is clear. The resulting precipitate was dissolved in 10-15ml of sterile water.

Furthermore, the operation of preparing the water agar plane in the step (B) is as fast as possible, and the plane has no bubbles and uniform thickness as possible. Slides and 10cm by 10cm plastic petri dishes can be pre-heated in an oven at 55 ℃ for 30 min.

Further, the concentration of the blotting solution in step (C) must be controlled to 10⁵～10⁶In the/ml range, which correlates well with the number of agar blocks containing single spores on one slide, the concentration of spore suspension can be calculated from the haemocytometer and diluted to this concentration range.

Further, in the step (D), before blotting, blotting is performed on water agar waste for several times, so as to ensure the stability of subsequent blotting.

Furthermore, the inner diameter of the capillary used in the step (D) is 0.3mm, the imprinting ring is basically covered under a 20X objective lens, and the inspection of a small block can be completed without excessively moving the objective table.

And (E) confirming the single-spore agar block in the step (E) under different magnification, preferably according to the size and shape of the plasmodiophora elata resting spores and the characteristics of slightly blue light and the like presented in the focusing process: the agar block with single spores was looked for under 20 × objective, the periphery of the blot was checked for cleanliness under 10 × objective, and only one single spore was confirmed and free of errors under 40 × objective. The polysporated agar blocks were discarded without much sight once confirmed.

Further, the single spore small blocks are transferred to a cover glass in a plastic culture dish paved with wet filter paper for temporary storage, and the humidity needs to be ensured during the temporary storage.

And (F) temporarily storing the small single spore blocks in the step (F) to ensure that the humidity is prevented from preventing the small single spore blocks from being clamped after drying and preventing the agar plane from being visible by naked eyes, and during inoculation, the plane containing the single spores is in contact with the root hairs.

The inoculated seedlings in the step (F) are still kept in a small 3.5cm culture dish paved with wet filter paper and are cultured for 48 hours in the dark at the temperature of 25 ℃.

In all the steps, the instruments need to be sterilized and dried at a certain temperature to ensure that the instruments are free from plasmodiophora brassicae pollution, and the instruments are mutually isolated one by one to prevent mutual pollution.

The invention provides a stable and efficient strong parasitic protozoon plasmodiophora brassicae monospore separation method, which comprises the steps of firstly preparing relatively pure spore suspension by using an improved sucrose gradient centrifugation method, calculating the concentration of the spore suspension by using a blood counting plate, obtaining single dormant spores (single resting spore) by using an agar block planar capillary blotting method (agar print on agar plates) based on the spore suspension with a certain concentration, and then inoculating the single dormant spores to robust root hairs of an susceptible variety ECD-05 germination accelerating 2-3d in an ECD system. Compared with the prior relevant research method, the method mainly solves the problems that the single spore is tiny and is not easy to position under a microscope, the liquid drop method has too many layered visual fields and is easy to dry, the single spore cannot be accurately picked by microscopic operation and the like. The planar capillary blotting method can greatly reduce the visual field range to be checked in microscopic examination, and the partitioned agar is easy to grasp, does not need advanced automatic instrument and equipment, has strong operability, and can obviously improve the efficiency of monospore separation.

Drawings

FIG. 1 is a schematic diagram (A-J) of a required article and important steps, wherein A is the required article, B is 2% water agar, C is a schematic diagram of a preparation cooling process of an agar plane, D is a qualified agar plane, E is agar after partitioning, F is a schematic diagram of a capillary imprinting process, G is an agar patch which is sedimenting after imprinting, H is an agar patch which is confirmed to have only one dormant spore after microscopic observation, and I is a schematic diagram of root hairs of a robust 2-3-day-old ECD-05 seedling inoculated with a single spore; j is ECD05 plant in hydroponic culture after single spore inoculation.

FIG. 2 is a microscopic blot agar patch of monospore (B, C) and polyspore (A, D) (white arrows indicate the location of the spores).

FIG. 3 shows the average time per single spore microscopic examination (A) and the agar patch single spore ratio (B) of blots of different concentrations.

FIG. 4 shows minimal swelling roots caused by single-spore inoculation of ECD05, ECD05-CK is a control group simulating inoculation of 1ml of sterile nutrient solution, JJB 2-4T 3, JJ-B1-2T 3 and JJ-B1T 3 are third-generation ECD05 subcultured plant diseased roots obtained by single-spore inoculation of pathogen from Kyujiang, ZJLSJY E5-5T 3 and ZJLSYE 5-5T 3 are third-generation ECD05 subcultured plant diseased roots obtained by single-spore inoculation of pathogen from Kyun Lishui, Zhejiang (white arrows indicate the positions of the swelling roots).

FIG. 5 shows the PCR detection result (A, D) of the single spore inoculated progeny, the white mark indicates the plant detected as positive, B is the result of the alignment of the sequence amplified by primer No. 3 with the database reference sequence, C is the sequence amplified by primer No. 3, and the dashed box indicates the primer sequence. E is the alignment of the sequence amplified by primer No. 6 with the database reference sequence (the dashed boxes at the beginning and end indicate the primer sequences).

Detailed Description

For clear and complete description of the technical solutions in the present invention, it is obvious that the inventor combines the embodiments to describe, but the following embodiments describe only some embodiments of the present invention, not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Example (b):

(A) preparation of a pure spore suspension:

cleaning and thoroughly decomposing the collected diseased roots, filling a 50ml centrifuge tube, treating for 1min by using 70 vol% alcohol, then treating for 20min by using 10% NaClO, and washing for 3 times by using sterile water; squeezing the root nodule into pulp by a juicer, fixing eight layers of gauze on the can bottle, and filtering for the first time; laying eight layers of gauze on the funnel, and filtering the filtrate for the second time; collecting the filtrate in a 50ml centrifuge tube, balancing to 45ml, centrifuging for 15min, removing supernatant, adding water to 45ml, centrifuging at 4000rpm for 10min, and removing supernatant; repeating the steps once; dissolving the precipitate in 5ml 50 wt% sucrose solution, centrifuging at 3100rpm for 10min, collecting supernatant and off-white precipitate with outermost layer tending to dissolve, and adding sterile water to 45 ml; centrifuging at 4000rpm for 10min, and discarding the supernatant; dissolving the precipitate in 30ml sterile water, and centrifuging at 3100rpm for 10 min; repeating the steps for 2-3 times until the color turns clear; the resulting precipitate was dissolved in 10-15ml of sterile water and stored at 4 ℃.

(B) Preparation of host seedlings:

putting a certain amount of seeds into a 50ml centrifuge tube, adding 1% mercuric chloride 30ml, shaking table at 28 deg.C for 6-8 min, and washing with sterile water in an ultraclean bench for 8-10 times (2 min/time); sowing the seeds in small culture dishes of 3.5cm paved with wet filter paper, wherein one seed is sowed in each dish; and wrapping the culture dish with tinfoil, and putting the culture dish in an incubator at 28 ℃ for pregermination for 2-3 d.

(C) Preparation of agar plane:

dissolving 1g (0.5g) agar powder in 50ml (25ml) sterile water (FIG. 1B), and boiling until it is transparent and has no bubbles; a 1ml pipette, which sucks 1ml of water agar to a glass slide (placed in an oven for 30min), and quickly, horizontally and stably places a cover glass; this procedure was repeated to prepare several planes of water agar (FIG. 1C) (which was placed in 10cm by 10cm plastic petri dishes with moist filter paper and stored for about 2-3 days with a sealed mouth)

(D) Preparation of blotting solution:

pure spore suspension from example 1, 310Centrifuging at 0rpm for 7min, discarding the supernatant, adding 1ml of 2% fresh chloramine T, and treating at room temperature for 20 min; centrifuging at 3100rpm for 7min, discarding the supernatant, washing the precipitate with sterile water for 2 times, centrifuging at 3100rpm for 7min, discarding the supernatant, dissolving the precipitate in 30ml of antibiotic (100ml of ddH)₂To O water were added 2. mu.l of vancomycin hydrochloride stock solution (50mg/ml), 5. mu.l of colistin sulfate stock solution (20mg/ml), and 2.4. mu.l of cefotaxime sodium stock solution (250 mg/ml). ) Shaking, wrapping with tinfoil, and incubating at 25 deg.C in dark for 24 hr; washing with sterile water for 3 times, dissolving the precipitate in sterile water; diluting 1 μ l with 100 times, counting on a blood counting plate, calculating to obtain spore concentration of suspension according to blood counting plate principle, and diluting part to 10⁵～10⁶The blotting solution is prepared per ml (the blotting solution is too thin to be stored for a long time).

(E) Partitioning and capillary blotting of agar plates:

burning and sterilizing a clean sharp scalpel, cutting off edges with uneven thickness on an agar plane, and then dividing the agar plane into small blocks with the thickness of 1-3 mm, wherein an average slide is 50-120 small blocks (figure 1E); further, a certain amount of uniformly vortexed blotting solution is absorbed by a capillary tube with the inner diameter of 0.3mm, the waste water agar is subjected to blotting for several times, the stability of subsequent blotting is ensured, the capillary tube is kept horizontal, and each small block of blotting is subjected to blotting under the condition that the agar plane is vertical (if the surface tension of the water agar is large, the outflow of the blotting solution is obvious, the opening at the other end of the capillary tube is blocked by a forefinger so as to ensure the stability of the blotting, and the blotting solution is only positioned within the outer diameter of the capillary tube as much as possible) (fig; after blotting, the plates were returned to 10cm plastic petri dishes to stabilize sedimentation and prevent the agar from losing water too quickly (FIG. 1G).

(F) Microscopic examination of blotted agar patches:

and (3) quickly searching the blotted agar plane block under a microscope by using a 20X objective lens for an agar block with single spores, positioning the agar plane block to be suspected of having the single spores, and checking whether the periphery of the blot is clean and only has the single spores under a 10X objective lens. Part of the targets with the interfering substances can be checked and confirmed to have only one single spore under a 40X objective; microscopic examination needs to be carried out according to the size and shape of dormant spores of plasmodiophora brassicae and the characteristics of slightly blue light and the like presented in the focusing process, and the multi-spore agar block is directly discarded without looking more once being confirmed. (FIG. 2)

Table 1 shows the time of microscopic examination of a part of single spores, and counts the proportion of agar small blocks containing single spores in the total small blocks on the glass slide, and the spore suspension after counting by the haemocytometer is diluted by integral multiple to be used as the blotting solution, and the concentration is from 1.25 to 10⁵/ml～1.35*10⁶The/ml was not equal, as can be seen from the bar graph (FIG. 3), when the concentration of the blotting solution was 6X 10⁵At/ml, the average time per single spore microscopic examination is the shortest and the probability of single spores being contained on the slide is greater. The concentration of the blotting solution of the agar plane block blotting method is 10⁵～10⁶Effective per ml, with concentration of 6 to 10⁵The separation efficiency is best when the concentration is about/ml.

TABLE 1 efficiency of single spore isolation of different concentrations of blotting solution

In the table: JX-JJ, ZJ-LS-ECD05, ZJ-LS and WL respectively represent the third generation ECD05 subculture plants and greenling obtained by monospore inoculation of Lishui pathogen in Jiangxi Jiujiang and Zhejiang.

(G) Isolation inoculation and co-culture of single dormant spores:

the obtained single spores were picked with a tip tweezers under a 10 x/5 x objective lens, temporarily transferred onto a cover glass placed in a plastic petri dish paved with wet filter paper (fig. 1H), after the whole agar plane was inspected, all the obtained single spores were inoculated onto the root hairs of robust 2-3 day-old ECD-05 seedlings (fig. 1I), the inoculated seedlings were still kept in a 3.5cm small petri dish paved with wet filter paper, the petri dish was wrapped with tinfoil paper, and co-cultured for 48H at 25 ℃ in the dark.

(H) Water culture and subculture propagation:

transferring into Hoagland nutrient solution for water culture for 21d (FIG. 1J); transferring to substrate culture for 42d (first generation) (16h illumination 23 deg.C, light intensity 8000lx, 8h dark 20 deg.C, air humidity 75%); digging out disease roots, washing with flowing water, checking disease conditions, and recording the serial numbers of suspected diseased plants; cutting diseased roots and pouring the roots back to the original pot; covering a thin substrate layer, uniformly spreading, watering and moisturizing, and rotting in the dark for 2-5 days; soaking seeds in ECD-05 warm soup for germination for 2-3 d; digging a hole at the rotten part of the diseased root by the bagged, subpackaged and sterilized medium-sized gun heads, and planting seedlings with good germination accelerating condition and vigorous roots; substrate culture 42d (second generation, and so on); if the suspected disease is detected, marking is carried out, and a small amount of the suspected disease is filled in a sterilized 2ml centrifugal tube for PCR detection.

(I) Pathogen detection for monospore inoculation of ECD05

And (3) phenotype observation: preparing newspaper which is sterilized and dried by high-pressure steam at the temperature of 121 ℃ for 20 min; disposable PE gloves; a plurality of trays (baking in an oven at 60-70 ℃ for more than 1h) are provided, and label numbers are pasted; the filter papers are separately placed in a clean tray, and 2-3 filter papers are stacked. Wearing the multilayer disposable PE gloves with rubber gloves, taking out the whole basin soil, grabbing the upper part of the ground with the left hand, cleaning with the right hand to expose the main root system, pouring the spilled substrate into the original bowl, discarding the layer of newspaper and the disposable gloves contacting the substrate, and carrying out next strain. Isolation of each plant is achieved, and mutual pollution among single spore systems is avoided (excavated roots are placed on a tray according to the serial number sequence, and the serial numbers correspond to pots and roots one by one). Washing the roots with running water, washing the root substrate, placing the root substrate in a tray paved with filter paper, sequentially corresponding one to one, checking the disease occurrence condition, and recording the number of suspected disease plants.

Sampling and PCR detection: single-spore inoculated ECD05 diseased roots a small amount of root tissue was taken in a 2ml centrifuge tube where a slight heel was observed:

DNA extraction by DNA fast extraction: adding 200 μ l of DNA extraction buffer solution and magnetic beads into the centrifuge tube with the tissue, and crushing the tissue with a crusher (65Hz, 120 sec); transferring all the ground tissue fluid into a 1.5ml centrifuge tube, and centrifuging for 8min at 13000 rpm; preparing a new 1.5ml centrifuge tube, adding 100 mul of isopropanol into each tube, taking 100 mul of supernatant, transferring into the centrifuge tube containing equal volume of isopropanol, gently shaking for about 50 times, and standing for 5min at room temperature; centrifuging at 13000rpm for 6min, and removing supernatant; washing precipitate with 1ml 70 vol% ethanol twice (shaking up and down 20 times, centrifuging at 13000rpm for 3min, discarding supernatant, repeating once, separating for 1min), sucking liquid, air drying precipitate for 5min, addingInto 25-50. mu.l ddH₂O, at-20 ℃ for later use.

And (3) PCR detection: 1.1XT3 Super Mix PCR (available from Ogaku Bio Inc.) reaction System as follows: 44 μ l 1.1xT3 super Mix, 2 μ l Template, 2 μ l Primer F, 2 μ l Primer R; the program is set as pre-denaturation at 98 ℃ for 2min and 30sec, 35-cycle amplification is carried out (denaturation at 98 ℃ for 10sec, annealing at 55 ℃ for 10sec, and extension at 72 ℃ for 10sec), and finally, full extension at 72 ℃ for 2min ensures complete amplification of fragments; the PCR products were separated by electrophoresis on a 0.8 wt% agarose gel and the product of the intended band was aligned for sequencing.

The results of the observation showed: 479 materials inoculated by single spore are obviously detected to have swollen roots and partial materials suspected of having very slight symptoms by PCR detection, 7 pairs of primers (the sequence and the source of the primers are shown in table 2) are used for amplifying the materials inoculated by single spore and propagated, host DNA about 750bp is amplified by PCR of the primer No. 1 and the primer No. 3, a small strip is a specific strip of plasmodiophora (figures 5A-C), the detection of the materials inoculated by single spore is realized, the amplification effect of the primers No. 3 and No. 6 is better, wherein the fragment of the amplification product of the primer No. 6 is small, a specific fragment can be well amplified in all materials containing the plasmodiophora brassicae (figure 5A, D, E), and the primer No. 6 is adopted for later-stage mass detection. The single spore is separated and inoculated with the ECD05 root hairs in batches to 479, the total 16 ECD05 which is confirmed to be inoculated with the single spore of the tiny phymatosis root can be obviously observed, and the existence of pathogenic bacteria can be detected by PCR in certain materials without obvious tiny phymatosis root (figure 5E), the quantity is up to 124, and the number accounts for 25.25% of the total survival (the statistical data is shown in Table 3), which indicates that the single spore separation technology system established by the invention is stable and efficient.

Table 2 seven pairs of primers for detecting plasmodiophora brassicae and sources thereof

Primer pair numbering	Primer name	Primer sequence (5'to3')	Source of primers
				1	ITS1	TCCGTAGGTGAACCTGCGG	(Poplar, 2003)
	ITS4	TCCTCCGCTTATTGATATGC
				2	YPWprimer1	GAAGATGCCCACGCCGTCGT	(Poplar et al, 2002)
	YPWprimer2	ATCTGTTCAGCAAAGCGTCGA
				3	YPWprimer3	AGGTGAACCTGCGGAAGGAT	(Poplar, 2003)
	YPWprimer4	TTCAGCGGGTAATCCTACCT
				4	PbITS1	ACTTGCATCGATTACGTCCC	(Faggian et al.,1999)
	PbITS2	GGCATTCTCGAGGGTATCAA
				5	PbITS6	CAACGAGTCAGCTTGAATGC	(Faggian et al.,1999)
	PbITS7	TGTTTCGGCTAGGATGGTTC
				6	Plasmo-3	ATTTTCGAACCATCCTAGCC	(Kageyama et al.,2003)
	Plasmo-4	GGTCGCTTCGTTCAAGCTAT
				7	WFZ-U	GTACCACTCACTAGCCAGAA	(Wangxiangshan, 2012)
	WFZ-D	AGTACATCAACGACAGCACC

TABLE 3 Single spore inoculation of ECD05 for detection of pathogen and disease onset

The above description is only exemplary of the present invention and should not be taken as limiting the invention, as any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims (6)

1. A stable and efficient method for separating plasmodiophora brassicae monospora of strong parasitic protozoon is characterized by comprising the following steps:

(A) cleaning root nodule of Brassica napus of strong parasitic protozoon, decomposing, sterilizing surface, squeezing to obtain homogenate, filtering, and centrifuging with density gradient to obtain concentrated pure spore suspension.

(B) A2% g/ml water agar solution was prepared and boiled in a sterilized can to be completely clear without air bubbles. Then, a pipette gun sucks 1ml of the solution onto a glass slide, and the glass slide is quickly covered with the solution to prepare a plurality of water agar planes.

(C) Calculating the concentration of concentrated spore suspension with blood counting plate, diluting with sterile water to obtain 10% concentration⁵～10⁶Blot solution/ml.

(D) And (3) cutting off edges with uneven thickness of the agar plane, then partitioning into small blocks with the thickness of 1-3 mm, further sucking a certain amount of blotting liquid uniformly swirled in the step (C) by using a capillary tube with the inner diameter of 0.3mm, keeping the capillary tube horizontal or inclining at an angle of 15 degrees, and blotting each small block in a state that the agar plane is vertical to the capillary tube.

(E) And (3) searching the blotted agar plane block under a microscope for an agar block with single spores, positioning the agar block to be suspected of having the single spores, and checking whether the periphery of the blot is clean and only has the single spores under a low multiple. Part of the targets with interferents were checked at high magnification to confirm that there was only one single spore.

(F) And (3) grabbing the single spores under a microscope by using a pointed-end tweezers, transferring the single spores onto a cover glass in a plastic culture dish paved with wet filter paper, and inoculating all the obtained single spores onto robust 2-3-day-old ECD05 seedling root hairs after the whole agar plane is inspected.

(G) And (4) carrying out dark culture on the inoculated ECD05 for 48h, carrying out water culture for 21d, and carrying out matrix culture for 42d, and then checking the morbidity condition to continue subculture propagation.

(H) Phenotypic observation combined with PCR detection confirmed the presence or absence of pathogen proliferation in the host.

2. The stable and efficient monosporal isolation method of plasmodiophora brassicae, a strong parasitic protozoan organism according to claim 1, wherein the density gradient centrifugation is: adding clear water for centrifugation for 2 times, dissolving the precipitate in 5ml of 50 wt% sucrose solution for centrifugation, taking the supernatant and the outermost layer off-white precipitate which tends to be dissolved, adding sterile water for centrifugation, and repeating the centrifugation for 2-3 times until the supernatant is clear. The resulting precipitate was dissolved in 10-15ml of sterile water.

3. The stable and efficient method for isolating plasmodiophora brassicae, a strong parasitic protozoon, as claimed in claim 1, wherein in step (D), before blotting, the waste water agar is blotted several times to ensure the stability of subsequent blotting.

4. The method for isolating single spores of plasmodiophora brassicae as claimed in claim 1, wherein in step (E), the agar block with single spores is searched under 20 × objective lens, whether the periphery of the blot is clean or not is checked under 10 × objective lens, and only one single spore is confirmed and is free from errors by checking under 40 × objective lens.

5. The method for separating the single spores of the plasmodiophora brassicae, which is a stable and efficient strong parasitic protozoon, as claimed in claim 1, wherein the small single spore pieces are transferred to a cover glass in a plastic culture dish paved with wet filter paper for temporary storage, and the humidity is ensured during the temporary storage.

6. The stable and efficient method for separating plasmodiophora brassicae, a strong parasitic protozoon, according to claim 1, wherein the seedlings inoculated in the step (F) are still kept in a small 3.5cm culture dish paved with wet filter paper and are co-cultured for 48 hours at 25 ℃ in the dark.

Images