CN112516317A

CN112516317A - Pharmaceutical composition for preventing and treating cancer and application thereof

Info

Publication number: CN112516317A
Application number: CN202011458469.1A
Authority: CN
Inventors: 潘斌; 李宇同; 陈果; 卓育敏
Original assignee: First Affiliated Hospital of Jinan University
Current assignee: First Affiliated Hospital of Jinan University
Priority date: 2020-12-10
Filing date: 2020-12-10
Publication date: 2021-03-19
Anticipated expiration: 2040-12-10
Also published as: CN112516317B

Abstract

The invention provides a pharmaceutical composition for preventing and treating cancers, in particular prostate cancer. The invention fully discloses the function of the ANT2 protein in prostate cancer cells and a target gene related to the protein for regulating and controlling the prostate cancer cells, clarifies a novel mechanism for regulating and controlling the prostate cancer by the ANT2 and finds a key target point for inhibiting the prostate cancer. The invention deeply researches the specific mechanism of ANT2 in the processes of prostate cancer occurrence, development, migration, invasion, apoptosis and the like, defines the regulation and control function of miR-137 on ANT2 expression, and determines the influence of miR-137 and ANT2 on the apoptosis, proliferation, migration and invasion capabilities of prostate cancer cells. The invention has completely new exposition to the generation and development mechanism of the prostatic cancer, provides a completely new idea for the development of related medicaments in the later period and the clinical diagnosis and treatment, and has great social significance and market prospect.

Description

Pharmaceutical composition for preventing and treating cancer and application thereof

Technical Field

The invention belongs to the field of biological medicines, relates to a pharmaceutical composition for preventing and treating cancers and application thereof, and particularly relates to a pharmaceutical composition for preventing and treating prostate cancer and application thereof.

Background

The existing research finds that the abnormal energy metabolism of mitochondria is closely related to tumorigenesis. In tumor cells, mitochondrial aerobic respiration is inhibited or disrupted due to the cell being in a poorly differentiated state or environmental factors, and the glycolytic pathway takes its place. This phenomenon, known as the Warburg effect, was proposed as early as the 20 th century, and was demonstrated in an increasing number of tumor types. The energy metabolism of tumor cells has recently received great attention, and related proteins are considered as novel tumor markers. The knowledge of the energy metabolism of tumor cells is of great significance to the early diagnosis and targeted therapy of tumors.

In any breathing mode, ATP produced in mitochondria and in cytoplasm is exchanged by ANT protein (adenosine transporter). ANTs are a mitochondrial inner membrane protein and are essential for the alteration of energy metabolism during tumor cell growth. The human ANT family protein comprises four subunits: ANT 1-4; ANT1, ANT2, ANT3 are very homologous in structure; ANT4 has approximately 60% protein sequence homology with the other three subunits. Each ANT subtype has different expression at different stages of development and differentiation due to cell specific tissue specificity. ANT1 is expressed primarily in muscle tissue, heart and brain; ANT3 is expressed widely in all cells; ANT4 is specifically present mainly in testis and sperm; ANT2 is specifically expressed in poorly differentiated cells such as lymphocytes or in cells with the ability to differentiate such as kidney cells and liver cells. The research finds that: ANT2 is distributed abnormally in tumor cells, and is highly expressed in breast cancer, non-small cell lung cancer and liver cancer, especially hormone-related cancer, however, the relevance and action mechanism of ANT2 on the development of tumor cells are not clear.

Prostate cancer (PCa) is one of the most common tumors of the urinary system, and the incidence rate is also increasing year by year. Although the treatment means such as surgery and radical radiotherapy have good curative effect on early-stage limited prostate cancer, for prostate cancer patients who adopt endocrine therapy, the median remission time of the treatment is 18-24 months later, the patients gradually develop Castration Resistant Prostate Cancer (CRPC), the clinical treatment is troublesome, and the restraint is often not good, so that the treatment fails and the prognosis is not good. However, the molecular mechanism of prostate cancer development and metastasis is not clear, and the related role and influence of ANT2 in the prevention, treatment and prognosis process of prostate cancer are not studied, and no effective treatment means is available for clinical treatment. Therefore, it is important to elucidate the molecular mechanism of prostate cancer development and to find key targets and drugs for treating prostate cancer.

Disclosure of Invention

The invention aims to solve the technical problems that the molecular mechanism of the occurrence, development and metastasis of cancer, particularly prostatic cancer, is not clear enough and an effective treatment means is lacked in the prior art, so that the mechanism of the occurrence and development of prostatic cancer is researched, and a novel prevention and treatment means is provided for prostatic cancer.

In order to solve the above technical problems, the present invention is achieved by the following technical solutions.

In a first aspect, the present invention provides a pharmaceutical composition for preventing and/or treating cancer, comprising an ANT2 inhibitor.

Preferably, the cancer is selected from one or more of lung cancer, kidney cancer, intestinal cancer, stomach cancer, lymph cancer, liver cancer, prostate cancer; most preferably, the cancer is selected from prostate cancer.

Preferably, the ANT2 inhibitor is selected from one or more of siRNA designed based on ANT2 gene (siANT 2), miR-137 and/or miR-137 mimetics (miR-137 mimics).

Preferably, the sequence of the siRNA (siANT 2) designed based on the ANT2 gene is shown as SEQ ID NO. 1.

Preferably, the sequence of the miR-137mimics (miR-137 mimics) is shown in SEQ ID NO: 2.

Preferably, the pharmaceutical composition further comprises one or more of cisplatin, cyclophosphamide, 5-fluorouracil, adriamycin and mitomycin.

The second aspect of the present invention provides the use of the above pharmaceutical composition for the preparation of a medicament for the prevention and/or treatment of cancer.

In a third aspect, the present invention provides a pharmaceutical formulation for preventing and/or treating cancer, comprising an ANT2 inhibitor and at least one pharmaceutically acceptable carrier.

Preferably, the ANT2 inhibitor is selected from one or more of siRNA designed based on ANT2 gene, miR-137 and/or miR-137mimics (miR-137 mimics).

Preferably, the sequence of the miR-137mimics (miR-137 mimics) is shown as SEQ ID NO: 2.

Preferably, the pharmaceutical preparation further comprises one or more of cisplatin, cyclophosphamide, 5-fluorouracil, adriamycin and mitomycin.

Preferably, the dosage form of the pharmaceutical preparation is selected from one or more of tablets, capsules, injections, sprays, aerosols, powders, gels and suppositories.

Preferably, the pharmaceutically acceptable carrier is selected from one or more of fillers, disintegrants, lubricants, binders, colorants, preservatives, flavors, antioxidants, solvents.

In a fourth aspect, the present invention provides the use of an ANT2 inhibitor for the manufacture of a medicament for the prevention and/or treatment of cancer.

The fifth aspect of the invention provides miR-137 and/or miR-137mimics (application of miR-137mimics in preparing medicines for preventing and/or treating cancers).

The prior art is not clear about the cause and mechanism of the occurrence and development of cancer, particularly prostatic cancer, and similarly, the role of ANT2 in cancer, particularly prostatic cancer, is not reported, and the specific regulation mechanism of ANT2 in the activities of prostatic cancer cell occurrence, proliferation, migration, invasion, apoptosis and the like is not clarified.

The inventor finds that ANT2 plays a key role in glycolytic metabolism of tumor cells through a large amount of research, and ANT2 protein is low expressed in normal prostate tissue and high expressed in prostate cancer tissue, wherein the mRNA level of ANT2 in the prostate cancer is more than 3 times that of the normal prostate tissue. This was further verified by immunohistochemistry of clinical patient specimens showing significantly higher levels of ANT2 protein in prostate cancer compared to prostate cyst patient specimens and correlated with the pathological grade of the tumor. Western blot assays also demonstrated high expression of ANT2 in prostate cancer tissues. Therefore, ANT2 is closely related to prostate cancer, can promote the occurrence and development of prostate cancer, and may be a potential target for prostate cancer treatment.

Further, the present inventors observed the expression of ANT2 in prostate cancer cell lines. The levels of ANT2 were elevated in the prostate cancer cell lines LNCaP, DU145, PC3 compared to normal prostate cells, consistent with their trend in tumor tissue. Aiming at mRNA sequence of Human ANT2, the inventor designs an interference fragment of siRNA, verifies the effectiveness and specificity of the siRNA fragment by transfecting LNCaP cells, and finds that after ANT2 gene is silenced, the multiplication capacity of the LNCaP cells is weakened. Therefore, the ANT2 is proved to be related to the prostate cancer, can promote the occurrence and the development of the prostate cancer, and can be a potential target for treating the prostate cancer.

In order to clarify the relation between ANT2 and prostate cancer, the inventor of the invention found through research that ANT2 is overexpressed in prostate cancer cells, the glycolysis level of the cells is remarkably increased, and the ANT3 overexpression has no influence. Oxygen stripping causes the mitochondrial respiratory chain to stop, resulting in the disappearance of the mitochondrial membrane potential Δ Ψ m, which ultimately leads to apoptosis; prostate cancer cells, however, survive under conditions in which oxidative phosphorylation is completely inhibited, and rely primarily on glycolysis to provide ATP to the mitochondria to maintain mitochondrial Δ Ψ m. The main function of ANT2 is to transport cytosolic ATP into the mitochondria and to maintain mitochondrial potential so that cells do not enter the apoptotic program. The high expression level of ANT2 in prostate cancer cells enables the tumor to survive in a hypoxic environment, and further, the ANT2 is determined to be an anti-apoptosis oncogene.

Furthermore, the inventor of the invention researches the mechanism of ANT2 protein for regulating the growth of prostate cancer cells, and finds that ANT2 is regulated and controlled by miR-137 as a target point, and miR-137 can obviously inhibit the expression of ANT 2.

microRNAs (miRNAs) are non-coding single-stranded small molecular RNAs which are highly conserved evolutionarily and about 22 nucleotides in length, and are degraded or translated through specific binding with target mRNAs to regulate and control genes after transcription. miRNAs regulate the behaviors of cell proliferation, differentiation, apoptosis and the like by regulating the expression of certain signal molecules in cell signals, such as transcription factors, cytokines, growth factors, pro-apoptosis and anti-apoptosis genes. In recent years, more and more miRNAs have been shown to play an important role in the development of cancer.

Based on this, the inventors of the present invention conducted extensive studies and found that miR-137 is a key factor for regulating ANT 2. The results of qPCR showed that the expression level of miR-137 was significantly reduced in prostate cancer samples, as found by analysis of clinical samples; the miR-137 can target ANT2 through bioinformatics analysis; the conserved miR-137 regulatory site exists in the UTR region of ANT2 predicted by Targetscan, and the expression of ANT2 can be remarkably inhibited by constructing a reporter gene containing a human ANT 23' UTR sequence and verifying miR-137 through transfer.

Compared with the prior art, the invention has the following technical effects:

(1) the invention fully discloses the function of the ANT2 protein in prostate cancer cells and a target gene related to the protein for regulating and controlling the prostate cancer cells, clarifies a new mechanism of regulating and controlling the prostate cancer by the ANT2, finds a key target point for inhibiting the prostate cancer, and provides a true experimental evidence and a scientific basis for understanding the pathogenesis of the prostate cancer and clinical treatment and drug development.

(2) The invention deeply researches the specific mechanism of ANT2 in the processes of prostate cancer occurrence, development, migration, invasion, apoptosis and the like, defines the regulation and control function of miR-137 on ANT2 expression, determines the influence of miR-137 and ANT2 on the apoptosis, proliferation, migration and invasion capabilities of prostate cancer cells, and specifically comprises the following steps: the expression level of miR-137in the prostate cancer is inhibited, so that the level of a target protein ANT2 is increased, the glycolysis rate of tumor cells is increased, and the energy supply is sufficient, thereby promoting the growth of the prostate cancer cells. And the level of miR-137 is improved, the expression of ANT2 can be obviously inhibited, the glycolysis of prostate cancer cells is further inhibited, the energy mitochondrial transport of tumor cells is cut off, and apoptosis is induced so as to inhibit the growth of the tumor cells. The invention has completely new exposition to the generation and development mechanism of the prostatic cancer, provides a completely new idea for the development of related medicaments in the later period and the clinical diagnosis and treatment, and has great social significance and market prospect.

Drawings

FIG. 1 is a graph comparing immunohistochemical staining of normal prostate tissue and prostate cancer tissue.

FIG. 2 is a diagram of the level of ANT2 protein in normal prostate tissue and prostate cancer tissue measured by fluorescence quantitative PCR.

FIG. 3 is a schematic diagram of fluorescence quantitative PCR detection of miR-137 level in normal prostate tissue and prostate cancer tissue.

FIG. 4 is a graph showing the WB assay for the protein level of ANT2 in normal prostate and prostate cancer tissues.

FIG. 5 is a graph showing the WB qualitative detection of the expression level of ANT2 in prostate cancer cells LNCaP, DU145, PC3 and normal prostate cells RWPE-1.

FIG. 6 is a graph showing the expression level of ANT2 in WB quantitative determination of prostate cancer cells LNCaP, DU145, PC3 and normal prostate cells RWPE-1.

FIG. 7 is a diagram showing the expression level of ANT2 in WB detection of ANT2 overexpression plasmid.

FIG. 8 is a graph showing the effect of ANT2 overexpression on the proliferation of DU145 cells.

Fig. 9 is a graphical representation of the effect of ANT2 overexpression on LNCaP cell proliferation.

FIG. 10 is a graph showing the WB assay for the expression level of ANT2 in LNCaP cells transfected with siANT 2.

FIG. 11 is a schematic representation of the effect of siANT2 on the proliferation of DU145 cells.

Fig. 12 is a graphical representation of the effect of siANT2 on LNCaP cell proliferation.

Fig. 13 is a schematic diagram of flow cytometry to detect the effect of siANT2 on DU145 apoptosis.

Fig. 14 is a schematic of the effect of sinant 2 on apoptosis in DU145 and LNCaP cells.

FIG. 15 is a schematic diagram showing the effects of ANT2 gene overexpression and ANT2 gene silencing on the migration and invasion abilities of DU145 cells, respectively.

FIG. 16 is a schematic diagram showing the effect of ANT2 gene overexpression and ANT2 gene silencing on the migration capacity of DU145 and LNCaP cells, respectively.

FIG. 17 is a schematic diagram showing the effect of ANT2 gene overexpression and ANT2 gene silencing on the invasion capacity of DU145 and LNCaP cells, respectively.

FIG. 18 is a schematic diagram showing the effect of ANT2 gene silencing on the ultra-high expression levels of Bax, Bcl-2 and Caspase-3 in DU145 cells.

FIG. 19 is a graph showing the effect of ANT2 gene overexpression on MMP-2, MMP-9, TIMP-1, and TIMP-2 levels in DU145 cells.

FIG. 20 is a graph showing the effect of ANT2 gene silencing on the levels of MMP-2, MMP-9, TIMP-1, and TIMP-2 in DU145 cells.

FIG. 21 is a graph showing the effect of miR-137Mimics on the expression level of ANT2 in DU145 and LNCaP cells.

FIG. 22 is a schematic diagram showing the effects of siANT2, miR-137Mimics and miR-137Inhibitor on ANT2 expression level in DU145 and LNCaP cells.

FIG. 23 is a schematic diagram showing the effect of WB detection on ANT2 expression level in DU145 cells by siANT2, miR-137Mimics and miR-137 Inhibitor.

FIG. 24 is a schematic diagram showing the effects of siANT2, miR-137Mimics and miR-137Inhibitor on ANT2 expression levels in DU145 and LNCaP cells.

FIG. 25 is a schematic diagram showing the effect of miR-137Mimics and ANT2 on the proliferation capacity of DU145 cells.

FIG. 26 is a schematic diagram showing the effect of miR-137Mimics and ANT2 on the proliferation capacity of LNCaP cells.

FIG. 27 is a schematic diagram showing the effects of miR-137Mimics and ANT2 on migration and invasion capabilities of DU145 cells.

FIG. 28 is a schematic diagram showing the influence of miR-137 interference and ANT2 gene overexpression on migration capacity of LNCaP and DU145 cells.

FIG. 29 is a schematic diagram showing the influence of miR-137 interference and ANT2 gene overexpression on the invasion capacity of LNCaP and DU145 cells.

FIG. 30 is a schematic diagram of tumor bodies in nude mice after miR-137 interference and ANT2 gene interference.

FIG. 31 is a graph showing the effect of miR-137 interference and ANT2 gene interference on tumor volume in nude mice.

FIG. 32 is a graph showing the effect of miR-137 interference and ANT2 gene interference on the size of a tumor in a nude mouse.

Detailed Description

In order to make the objects, technical solutions and effects of the present invention clearer and clearer, the present invention is further described in detail below with reference to examples. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

Cell lines listed in the context of the present invention, including PC3, LNCaP and DU145, were purchased from American Type Culture Collection (ATCC, Manassas, VA, USA) and cultured according to ATCC guidelines, unless otherwise specified. All cell lines were identified by short tandem repeat analysis of the chinese typical culture collection (wuhan) and verified for the presence of mycoplasma contamination using a PCR assay kit (shanghai Biothrive Sci) while being cryopreserved in liquid nitrogen and used for subsequent experiments. The reagents used in the present invention are commercially available. For the use of clinical specimens, informed consent is signed with patients, and related procedures and methods meet medical ethics requirements and quality management specifications of clinical trials of drugs. The experimental methods used in the present invention, such as tumor cell culture, animal experiments, Western blot, calcium phosphate precipitation transfection, molecular cloning, small molecule interference techniques, immunohistochemistry, immunofluorescent staining, flow cytometry, Transwell experiments, scratch experiments, Brdu labeling, etc., are all conventional methods and techniques in the art.

Representative results from selection of biological experimental replicates are presented in the context figure, and data are presented as mean ± SD and mean ± SEM as specified in the figure. All experiments were repeated at least three times. Data were analyzed using GraphPad Prism 5.0 or SPSS 20.0 software. And comparing the difference of the mean values of two or more groups by using a t test or an analysis of variance. p < 0.05 was considered a significant difference.

Example 1ANT2 and miR-137 expression level correlation study with prostate cancer

(1) Collecting the prostate cancer tissues and the tissues beside the prostate cancer which are removed by the operation of the prostate cancer patient, and signing an informed consent with the patient;

(2) dividing each tissue sample into two parts, freezing and storing one part in liquid nitrogen within 30 minutes of separation, and then rotating to-80 ℃; the other part was stored in 3.7% paraformaldehyde;

(3) samples at-80 ℃ are used for protein extraction and Western Blot (WB) and qPCR experiments; samples in paraformaldehyde were used for pathological sectioning and subsequent immunohistochemical staining.

Pathological diagnosis is based on the staging criteria established by the United states cancer Association (AJCC) for TNM staging. Collecting clinical follow-up data: age, sex, clinical grade, recurrence and metastasis, chemotherapy, pathological typing, tumor size and survival prognosis (at least 50 cases).

The experimental results are shown in fig. 1-5, wherein fig. 1 is a graph comparing immunohistochemical staining of normal tissue and prostate cancer tissue, showing high expression of ANT2 in prostate cancer tissue.

The transcription levels of ANT2 protein and miR-137in prostate cancer tissue were detected by fluorescent quantitative PCR using normal prostate tissue as a control, and the results are shown in FIG. 2 and FIG. 3, respectively. The results show that ANT2 is highly expressed in prostate cancer tissue, while miR-137 levels are significantly reduced in prostate cancer tissue.

Subsequently, normal prostate tissue and prostate cancer tissue were subjected to WB experiments to examine the ANT2 level therein, and the results are shown in fig. 4, which also showed high expression of ANT2 in prostate cancer.

Further, prostate cancer cells LNCaP, DU145, PC3 and normal prostate cells RWPE-1 were selected, and the expression level of ANT2 was examined by WB assay, and the results are shown in fig. 5 to 6. The results are consistent with the above results for prostate cancer tissues, i.e., ANT2 is highly expressed in all prostate cancer cells LNCaP, DU145, and PC 3.

According to the results, the protein level of ANT2 in the prostate cancer is obviously improved, the level of miR-137in the prostate cancer is obviously reduced, and the ANT2 is related to the pathological grading degree of the tumor (see table 1), and the expression levels of ANT2 and miR-137 are shown to have a close relation with the prostate cancer.

TABLE 1 degree of association of ANT2 with pathological grade of tumor

Example 2 Effect of ANT2 and ANT2 inhibitors on prostate cancer cell proliferation and apoptosis

Extracting RNA from prostate cancer cells (DU 145 and LNCaP cells), carrying out reverse transcription, carrying out PCR amplification on ANT2 cDNA, constructing the cDNA into a related vector, sequencing and carrying out protein expression verification to obtain an over-expression plasmid of ANT2, and verifying the effectiveness and specificity of the over-expression plasmid through WB detection, wherein the result is shown in FIG. 7.

After the cells were over-expressed with ANT2 at different concentrations and treated for 24, 48 and 72 hours, respectively, and then tested with CCK-8, the results are shown in fig. 8-9, and it can be seen that the proliferation potency of DU145 and LNCaP cells was significantly enhanced after ANT2 gene was over-expressed.

Further, siRNA (siANT 2) was designed and synthesized against mRNA sequence of Human ANT2, wherein the sequence of siANT2 is as shown in SEQ ID NO:1, GGUGACUGCCUGGUUAAGAUC, transfected into LNCaP cells, and the effectiveness and specificity of the siANT2 was verified by WB assay, the results are shown in FIG. 10.

Further, siANT2 fragments with different concentrations are respectively treated for 24 hours, 48 hours and 72 hours, and the cells are detected by methods such as CCK-8, Brdu labeling, flow cytometry and the like, and the results are shown in FIGS. 11-14, which shows that after the silencing of the ANT2 gene by the siANT2, the proliferation capacities of the DU145 and LNCaP cells are obviously weakened, the growth of prostate cancer cells can be obviously inhibited, the apoptosis of the cells can be induced, and the apoptosis rates of the DU145 and LNCaP cells are obviously increased, and the difference has statistical significance.

Example 3 Effect of ANT2 and ANT2 inhibitors on prostate cancer cell migration and invasion

DU145 and LNCaP cells are selected to carry out cell migration and invasion experiments, qPCR and WB are used for detecting the expression conditions of MMPs and TIMPs related genes in the cells, the matrix adhesion experiment is used for determining the cell adhesion capability, the scratch experiment is used for detecting the cell migration capability, and the Transwell invasion experiment is used for detecting the cell invasion capability. The results are shown in FIGS. 15-21.

FIGS. 15-17 show that the migration and invasion abilities of DU145 cells and LNCaP cells are significantly enhanced after ANT2 gene is over-expressed; after the ANT2 gene is silenced by using the siANT2, the migration and invasion capacities of DU145 and LNCaP cells are obviously reduced, and the difference has statistical significance.

As can be seen in FIG. 18, after ANT2 gene silencing, low Bax expression, high Bcl-2 expression and ultrahigh Caspase-3 expression are shown, indicating that the ANT2 gene silencing has significant enhancement on the induction of LNCaP and DU145 cell apoptosis.

According to FIGS. 19-20, it was found that MMP-2, MMP-9, TIMP-1, TIMP-2 were highly expressed after the ANT2 gene was overexpressed, indicating that the overexpression of ANT2 gene can enhance the migration and invasion abilities of DU145 and LNCaP cells; after ANT2 gene is silenced, MMP-2, MMP-9, TIMP-1 and TIMP-2 are shown to be low expressed, which shows that the silencing of ANT2 gene can obviously reduce the migration and invasion capacity of DU145 and LNCaP cells.

Example 4 study of action mechanism of miR-137 on prostate cancer cells

(1) Constructing an ANT 23' UTR (wild and mutant) driven dual-luciferase reporter gene (with the sequence of AAGCAAUA and AGAGAGCCAA), and using a pGL4-luc-Basic fluorescence reporter gene vector;

(2) plating cells of appropriate cell number into 12-well plates;

(3) after 24h, 0.5. mu.g of ANT 23' UTR (wild and mutant) driven dual luciferase reporter gene and 0.1. mu.g of pRL-TK (Promega) internal reference plasmid were co-transfected into cells using Lipofectamine 2000;

(4) after miR-137Mimics are added to treat different time points (24 and 48h), according to the instruction of Dual-luciferase Reporter Assaykit, TopCountNXYmicoplantuminescecenter is used for respectively measuring the activities of Firefol and Renilla, and the relative luciferase activity is obtained by taking the ratio of the activities, and the result is shown in figure 21.

FIG. 21 shows that the luciferase activity of miR-137Mimics is low in ANT 23 'UTR (wild) and the luciferase activity difference in ANT 23' UTR (mutant) is not statistically significant, which indicates that miR-137Mimics can reduce the promoter activity of ANT 23 'UTR (wild) region of LNCaP and DU145, but has no obvious influence on the promoter activity of ANT 23' UTR (mutant) region of LNCaP and DU 145.

After prostate cancer cells are treated for different time by siANT2 (shown as SEQ ID NO:1 and GGUGACUGCCUGGUUAAGAUC), miR-137Mimics (shown as SEQ ID NO:2 and UUAUUGCUUAAGAAUACGCUAG) and miR-137Inhibitor (shown as SEQ ID NO:3 and ACGCGUAUUCUUAAGCAAU) with different concentrations, the influence of miR-137 on the activity of an ANT 23' UTR region promoter is detected, and meanwhile, a target sequence of miR-137 is mutated to serve as a control, and the result is shown as figure 22. As can be seen from FIG. 22, ANT2 was highly expressed in the miR-137 Inhibitor-treated group, and ANT2 and ANT2 was lowly expressed in the miR-137 Mimics-treated group, indicating that ANT2 is the target gene of miR-137.

Furthermore, in DU145 and LNCaP cells cultured in vitro, miR-137Mimics and inhibitors are used for interfering the expression of miR-137, and ANT2 is silenced, and the results of detecting the cells by WB are shown in FIGS. 23-24. It can be seen that ANT2 is highly expressed in the miR-137 treatment group, while low expression is shown in the siANT2 and miR-137Mimics treatment groups, which shows that the effects of the siANT2 and miR-137Mimics are the same, so that the expression of ANT2 is reduced, the expression of ANT2 is obviously increased by miR-137Inhibitor, and further shows that ANT2 is a target gene of miR-137.

Example 5 Effect of miR-137/ANT2 on prostate cancer cell behavior and function

(2) plating cells of appropriate cell number into 12-well plates;

(4) after treatment with ANT2 or miR-137Mimics (sequence shown in SEQ ID NO:2, UUAUUGCUUAAGAAUACGCUAG) at different time points, detection is performed by CCK-8, Brdu labeling, Transwell experiments or scratch experiments, etc. The results are shown in FIGS. 25 to 29.

According to the results of fig. 25-27, after treatment with miR-137 mics + ANT2, the proliferation capacities of LNCaP and DU145 cells are reduced, and the migration and invasion capacities of DU145 cells are also remarkably reduced, which shows that miR-137 has a good inhibition effect on the activity of ANT2 and the proliferation, migration and invasion capacities of prostate cancer cells.

As can be seen from FIGS. 28 to 29, the migration and invasion abilities of LNCaP and DU145 cells were enhanced after the ANT2 gene was overexpressed; after the miR-137Mimics and ANT2 gene is used for overexpression treatment, migration and invasion capacities of LNCaP and DU145 cells are remarkably reduced, and the miR-137 has a good inhibition effect on the activity of ANT2 and the migration and invasion capacities of prostate cancer cells.

Example 6 Effect of miR-137/ANT2 on prostate cancer in vivo

(1) Randomly dividing 18 nude mice into 3 groups, each group comprises 6 mice; wherein group 1 was injected subcutaneously with normal PC3 cells, and

groups

2 and 3 were injected subcutaneously with ANT2 siRNA PC3 stable cell line;

(2) after tumorigenesis, 200. mu.l of physiological saline was injected to the tumor site every day for group 1 and

group

2, and 200. mu.l of miR-137Inhibitor (sequence shown in SEQ ID NO:3, ACGCGUAUUCUUAAGCAAU) was injected to the tumor site every day for group 3 mice;

(3) the growth status and body weight of each group of mice was recorded periodically, and one month later, the mice were sacrificed and tumor measurement volumes were collected.

The results of the experiment are shown in FIGS. 30-32. From the results, it was seen that tumor growth was significantly inhibited in nude mice after inoculation with the ANT2 siRNA PC3 stable cell line, compared to the control group 1. And after miR-137Inhibitor is injected to the tumor part of the group 3 mice, the tumor volume is obviously increased, and the inhibition of ANT2 and/or the activation of miR-137 can also obviously inhibit the growth of prostate cancer cells in vivo.

By combining the results, the invention fully discloses the function of the ANT2 protein in cancer cells, particularly prostate cancer cells, and a target gene related to the regulation of the protein, clarifies a novel mechanism for regulating the prostate cancer by the ANT2, and finds a key target point for inhibiting the prostate cancer. The invention deeply researches the specific mechanism of ANT2 in the processes of prostate cancer occurrence, development, migration, invasion, apoptosis and the like, defines the regulation and control function of miR-137 on ANT2 expression, and determines the influence of miR-137 and ANT2 on the apoptosis, proliferation, migration and invasion capabilities of prostate cancer cells. The invention has completely new exposition to the generation and development mechanism of the prostatic cancer, provides a completely new idea for the development of related medicaments in the later period and the clinical diagnosis and treatment, and has great social significance and market prospect.

The above detailed description section specifically describes the analysis method according to the present invention. It should be noted that the above description is only for the purpose of helping those skilled in the art better understand the method and idea of the present invention, and not for the limitation of the related contents. The present invention may be appropriately adjusted or modified by those skilled in the art without departing from the principle of the present invention, and the adjustment and modification also fall within the scope of the present invention.

Sequence listing

<110> river south university subsidiary first hospital (Guangzhou Chinese hospital)

<120> a pharmaceutical composition for preventing and treating cancer and use thereof

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ggugacugcc ugguuaagau c 21

<210> 2

<211> 22

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

uuauugcuua agaauacgcu ag 22

<210> 3

<211> 19

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

acgcguauuc uuaagcaau 19

Claims

1. A pharmaceutical composition for preventing and/or treating cancer, comprising an ANT2 inhibitor.

2. The pharmaceutical composition of claim 1, wherein the cancer is selected from one or more of lung cancer, kidney cancer, intestinal cancer, stomach cancer, lymph cancer, liver cancer, prostate cancer; most preferably, the cancer is selected from prostate cancer.

3. The pharmaceutical composition of claim 2, wherein the ANT2 inhibitor is selected from one or more of siRNA designed based on ANT2 gene, miR-137 and/or miR-137 mimetics.

4. The pharmaceutical composition of any one of claims 1 to 3, wherein the pharmaceutical composition further comprises one or more of cisplatin, cyclophosphamide, 5-fluorouracil, doxorubicin, and mitomycin.

5. Use of a pharmaceutical composition according to any one of claims 1 to 4 for the preparation of a medicament for the prevention and/or treatment of cancer.

6. A pharmaceutical formulation for the prevention and/or treatment of cancer, comprising an ANT2 inhibitor and at least one pharmaceutically acceptable carrier.

7. The pharmaceutical preparation according to claim 6, wherein the cancer is selected from one or more of lung cancer, kidney cancer, intestinal cancer, stomach cancer, lymph cancer, liver cancer, prostate cancer; most preferably, the cancer is selected from prostate cancer.

8. The pharmaceutical preparation of claim 6, further comprising one or more of cisplatin, cyclophosphamide, 5-fluorouracil, doxorubicin, and mitomycin.

Use of an ANT2 inhibitor for the manufacture of a medicament for the prevention and/or treatment of cancer.

Use of miR-137 and/or a miR-137 mimetic for the manufacture of a medicament for the prevention and/or treatment of cancer.