CN112516149B - Application of estradiol benzoate or pharmaceutically acceptable salt thereof in preparation of anti-coronavirus drugs - Google Patents
Application of estradiol benzoate or pharmaceutically acceptable salt thereof in preparation of anti-coronavirus drugs Download PDFInfo
- Publication number
- CN112516149B CN112516149B CN202010706969.6A CN202010706969A CN112516149B CN 112516149 B CN112516149 B CN 112516149B CN 202010706969 A CN202010706969 A CN 202010706969A CN 112516149 B CN112516149 B CN 112516149B
- Authority
- CN
- China
- Prior art keywords
- estradiol benzoate
- cov
- sars
- coronavirus
- pharmaceutically acceptable
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/56—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
- A61K31/565—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids not substituted in position 17 beta by a carbon atom, e.g. estrane, estradiol
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
Abstract
The invention discloses application of estradiol benzoate or pharmaceutically acceptable salt thereof in preparation of anti-coronavirus drugs. The invention provides the application of the estradiol benzoate or the pharmaceutically acceptable salt thereof in preparing the anti-coronavirus medicament for the first time, and the application expands the application range of the estradiol benzoate. In particular to provide a new medicine for inhibiting the new coronaries caused by SARS-CoV-2 under the condition of the global epidemic of the new coronaries.
Description
Technical Field
The invention relates to the technical field of medicines, in particular to application of estradiol benzoate or pharmaceutically acceptable salt thereof in preparation of medicines for resisting coronaviruses.
Background
There are 6 previously known human coronaviruses, human coronaviruses HCoV-229E, HCoV-OC43, HCoV-NL63 and HCoV-HKU1, and severe acute respiratory syndrome coronaviruses SARS-CoV and middle east respiratory syndrome coronavirus MERS-CoV, respectively. SARS-CoV-2 is the 7 th currently known coronavirus capable of infecting human, is a single-stranded RNA positive-strand enveloped beta-coronavirus, and has a genome of about 26-32 kb in length. SARS-CoV-2 entry into host cells is mediated by a transmembrane Spike S glycoprotein (S), which is cleaved into S1 and S2 subunits by the action of host cell membrane surface protease, wherein S2 is a coronavirus evolution conserved domain, having heptapeptide repeat sequence 1 (Heptad repeat regions, HR1) and heptapeptide repeat sequence 2 (Heptad repeat regions, HR2), responsible for mediating fusion of the virus with the cell membrane, and S1 can bind to ACE2 receptor on the cell membrane surface, thus the S protein possesses both receptor binding activity and membrane fusion activity. Thus, inhibition of the activity of the S protein prevents the virus from entering the host cell, and the S1 and S2 subunits can be used as targets for antiviral drug screening. At present, no specific medicine aiming at SARS-CoV-2 exists, and no medicine is approved to be marketed.
Estradiol benzoate (Estradiol benzoate, EB) is an estrogenic agent. Has similar effect to estradiol, and can promote endometrial hyperplasia, strengthen uterine smooth muscle contraction, promote mammary gland development and proliferation: high doses inhibit prolactin release, act against androgens, and increase calcium deposition in bone. The composition is mainly used for supplementing estrogen deficiency, such as atrophic vaginitis, vaginal dryness, female gonadal dysfunction, menopausal vasomotor symptoms, primary ovarian failure and the like. There is no application of estradiol benzoate and estradiol benzoate analogues in resisting coronavirus.
Disclosure of Invention
The invention aims to provide a novel anti-coronavirus drug.
In order to achieve the above purpose, the technical scheme adopted by the invention is as follows: in one aspect, the invention provides an application of estradiol benzoate or pharmaceutically acceptable salt thereof in preparing an anti-coronavirus medicament, wherein the molecular formula of the estradiol benzoate is C 25 H 28 O 3 Molecular weight is 376.49, and structural formula is
In another aspect, the invention provides an estradiol benzoate orApplication of pharmaceutically acceptable salt thereof in preparation of medicines for inhibiting coronavirus from entering target cells, wherein the molecular formula of estradiol benzoate is C 25 H 28 O 3 Molecular weight is 376.49, and structural formula is
In yet another aspect, the invention provides the use of an estradiol benzoate analog or a pharmaceutically acceptable salt thereof in the manufacture of a medicament against coronavirus.
In yet another aspect, the invention provides the use of an estradiol benzoate analog or a pharmaceutically acceptable salt thereof in the preparation of a medicament for inhibiting coronavirus entry into a target cell.
In a further aspect, the present invention provides an anti-coronavirus pharmaceutical composition comprising as an active substance estradiol benzoate having the formula C 25 H 28 O 3 Molecular weight is 376.49, and structural formula is
In still another aspect, the present invention provides a pharmaceutical composition for inhibiting coronavirus entry into a target cell, comprising as an active agent estradiol benzoate having the formula C 25 H 28 O 3 Molecular weight is 376.49, and structural formula is
In yet another aspect, the present invention provides an anti-coronavirus pharmaceutical composition comprising an estradiol benzoate analog or a pharmaceutically acceptable salt thereof as an active substance.
In yet another aspect, the present invention provides a pharmaceutical composition for inhibiting coronavirus entry into a target cell, which contains an estradiol benzoate analog or a pharmaceutically acceptable salt thereof as an active substance.
Further, the estradiol benzoate analogs include 17α -estradiol, 17β -estradiol, estradiol cyclopentanecarboxylate, estradiol dipropionate, and estradiol valerate.
Further, the coronaviruses include HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1, severe acute respiratory syndrome coronavirus SARS-CoV, severe acute respiratory syndrome coronavirus 2SARS-CoV-2 and middle east respiratory syndrome coronavirus MERS-CoV; preferably, the coronavirus is SARS-CoV-2.
Further, the pharmaceutical composition is injection, gel, tablet or patch.
The invention has the following beneficial effects:
the invention discovers the application of the estradiol benzoate and the estradiol benzoate analogues in preparing the anti-coronavirus medicines for the first time, and the application expands the application range of the estradiol benzoate and the estradiol benzoate analogues. The invention uses the estradiol benzoate as antiviral drug, the experiment shows that the estradiol benzoate can effectively inhibit SARS-CoV-2 on the in vitro cultured cell Vero-E6, and half of the effective concentration EC 50 6.72. Mu.M; estradiol benzoate for inhibiting SARS-CoV-2 entry phase, and inhibiting SARS-CoV-2S pseudovirus infection 293T/ACE2 cells, half inhibition concentration IC 50 0.27. Mu.M; estradiol benzoate has no obvious cytotoxicity in the effective concentration range. Therefore, can be used for preparing anti-SARS-CoV-2 medicine.
Drawings
FIG. 1 is a graph showing the inhibition ratio of Estradiol Benzoate (EB) to SARS-CoV-2 at various concentrations in example 1 of the present invention, wherein the abscissa represents the concentration of estradiol benzoate and the ordinate represents the inhibition ratio of estradiol benzoate to SARS-CoV-2 against the solvent set, and the median effective concentration EC of estradiol benzoate to inhibit SARS-CoV-2 is calculated from the inhibition ratio 50 Values.
FIG. 2 is a graph showing the inhibition ratio of the entry of the SARS-CoV-2S pseudovirus by Estradiol Benzoate (EB) at various concentrations in example 2 of the present invention, wherein the abscissa represents the concentration of estradiol benzoate and the ordinate represents the inhibition ratio of the entry of the SARS-CoV-2S pseudovirus by estradiol benzoate against the solvent set, and the median inhibition concentration IC50 value of the entry of the SARS-CoV-2S pseudovirus by estradiol benzoate is obtained.
FIG. 3 is a graph of the viability of Estradiol Benzoate (EB) versus Vero-E6 cells in example 3 of the invention, wherein the abscissa represents the concentration of estradiol benzoate and the ordinate represents the percent cell viability of Vero-E6 cells following administration of varying concentrations of estradiol benzoate in a solvent set as a control.
FIG. 4 is a graph showing the inhibition of the cell activity of Estradiol Benzoate (EB) on 293T/ACE2 cells according to example 3 of the present invention, wherein the abscissa represents the concentration of estradiol benzoate and the ordinate represents the inhibition percentage of the activity of estradiol benzoate on 293T/ACE2 cells at different concentrations in a solvent set as a control, and the median lethal dose CC of estradiol benzoate on 293T/ACE2 cells was obtained 50 Values.
Detailed Description
For a better understanding of the present invention, the following description will be given with reference to the accompanying drawings and specific examples, but the present invention is not limited to the following examples.
Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.
The following examples are presented to evaluate the activity of estradiol benzoate against SARS-CoV-2 and to confirm that estradiol benzoate has the ability to resist SARS-CoV-2 infection and also has the effect of inhibiting SARS-CoV-2 from entering target cells by constructing in vitro cell infection models of the active toxins of SARS-CoV-2 and the pseudoviruses of SARS-CoV-2, and to provide an application of estradiol benzoate in the preparation of anti-novel coronavirus drugs.
The Vero-E6 and 293T cells adopted by the invention are purchased from American ATCC, and the 293T cells which stably over-express the humanized SARS-CoV-2 receptor protein ACE2 are constructed and stored by the unit.
The cell growth culture solution adopted in the embodiment of the invention comprises the following components: DMEM basal medium, to which fetal bovine serum 10% total volume and ampicillin/streptomycin 1% total volume were added, was stored at 4 ℃ and pre-heated in a 37 ℃ water bath prior to use.
The estradiol benzoate used in the examples of the present invention was purchased from Shanghai Tao Su Biochemical technology Co., ltd, and the purity was >99%.
SARS-CoV-2 used in the examples of the present invention was isolated and amplified for storage in infected subjects from the institute of Whan virus.
Pseudo virus packaging plasmid and source thereof in the embodiment of the invention: the pseudovirus packaging skeleton plasmid pNL4-3. Luc.R-E-is identified and stored for southern medical university, and the disclosed optimized full-length SARS-CoV-2S protein core plasmid pcDNA3.1-SARS-CoV-2-Spike is given benefit by the land teaching of Shanghai double denier university.
The single luciferase detection kit used in the embodiments of the invention is purchased from PROMEGA company in America and comprises cell lysate and luciferase reaction substrate.
Pharmacological experiment part
EXAMPLE 1 in vitro detection of the inhibitory Activity of estradiol benzoate on SARS-CoV-2
1. Drug inhibition activity assay:
1) Taking Vero-E6 cells in logarithmic growth phase, 3 x 10≡5 cells/well, inoculating into 48-well plate, 37 deg.C, 5% CO 2 Culturing overnight.
2) Drug pre-incubation: the drug was diluted with DMEM medium containing 2% total volume of fetal bovine serum. The initial concentration of drug was set at 200 μm (solvent DMSO), the drug was diluted three-fold, 3 duplicate wells were set per concentration, and 6 drug gradients (200, 66.67, 22.22, 7.41, 2.47, 0.82 μm) total; solvent dimethyl sulfoxide (DMSO) was set as a control group, which was diluted with DMEM medium containing 2% fetal bovine serum total volume, and the same volume of dimethyl sulfoxide was administered. After removal of the cell supernatant 1) 100. Mu.l of diluted drug was added per well to the experimental group in the 48-well plate, 100. Mu.l of diluted DMSO was added to the control group, and incubated at 37℃for 1h.
3) Viral infection: mu.l of SARS-CoV-2 virus dilution (multiplicity of infection MOI=0.05) was added to each well of the 48-well plate and incubation was continued for 1h at 37 ℃. The infectious agent supernatant was removed well and the cells were washed once with 200. Mu.l PBS. 200 μl of the culture medium containing the drug at the corresponding concentration was added again to the wells, and the culture was continued for 24 hours, and 150 μl of the cell culture supernatant was collected for measurement. Viral copy number was determined using qRT-PCR.
4) For specific procedures for viral RNA extraction, reference is made to Takara MiniBEST Viral RNA/DNA Extraction Kit (Code No. 9766):
a. cleavage of the virus: mu.l of PBS (pH 7.4) solution was added to 150. Mu.l of the cell culture supernatant to make up to 200. Mu.l. 200. Mu.l of VGB buffer, 20. Mu.l of Proteinase K and 1.0. Mu.l of Carrier RNA were added, mixed well and lysed well in a water bath at 56℃for 10 min. 200 μl of absolute ethanol is added into the lysate, and the mixture is thoroughly sucked and stirred.
b. And (3) column passing: spin Column was mounted on a Collection Tube, the solution was transferred to Spin Column, centrifuged at 12,000rpm for 2 minutes, and the filtrate was discarded.
c. Washing 1: 500 μl RWA buffer was added to Spin Column, centrifuged at 12,000rpm for 1 min, and the filtrate was discarded.
d. Washing 2: to Spin Column, 700. Mu.l RWB buffer was added, centrifuged at 12,000rpm for 1 min, and the filtrate was discarded. (RWB buffer with the specified volume of 100% ethanol added). RWB buffer was added around the Spin Column wall.
e. Repeating the operation step d.
f. Spin Column was mounted on a Collection Tube and centrifuged at 12,000rpm for 2 minutes.
g. Eluting: place Spin Column on New 1.5. 1.5ml RNase free collection tube, add 30. Mu.l RNase free dH in the center of Spin Column membrane 2 O, standing at room temperature for 5 minutes. RNA was eluted by centrifugation at 12,000rpm for 2 minutes.
5) For specific procedures for reverse transcription of viral RNA, reference Takara PrimeScriptTM RT reagent Kit with gDNA Eraser (Code No. RR047A):
a. removing genomic DNA from the eluate: the reaction system was prepared on ice according to the following ingredients
| Reagent(s) | Volume (mul) |
| 5*gDNA Eraser Buffer | 2.0 |
| gDNA Eraser | 1.0 |
| Total RNA | 3.0 |
| RNase Free dH 2 O | 4.0 |
| Total volume | 10.0 |
The sample was allowed to react at 42℃for 2min.
b. Reverse transcription reaction:
the sample was incubated at 37℃for 15min and then heated at 85℃for 5sec.
6) qPCR detection of viral copy number: reference Takara TBPremix Ex Taq TM II (TliRNaseH Plus, code, no. RR820A) (using standard curve method: alreadyRBD plasmids with known copy numbers were used as standards, and specific primers targeted RBD). The reaction system was prepared on ice according to the following ingredients:
| reagent(s) | Volume (mul) |
| TB Green Premix Ex Taq II(Tli RNaseH Plus)(2X) | 10 |
| Forward Primer(10μM) | 1 |
| Reverse Primer(10μM) | 1 |
| ROX Reference Dye(50X) | 0.4 |
| cDNA template | 1 |
| Sterilizing water | 6.6 |
| Total volume | 20 |
The primer sequences were as follows:
RBD upstream Primer (Forward Primer): CAATGGTTTAACAGGCACAGG (SEQ ID NO: 1)
RBD downstream Primer (Reverse Primer): CTCAAGTGTCTGTGGATCACG (SEQ ID NO: 2)
And (3) detecting: ABI7500 quantitative PCR instrument
Pre-denaturation: 95 ℃,30 seconds, 1 cycle; and (3) PCR amplification: 95 ℃,5 seconds, 40 cycles; annealing: 60 ℃ for 30-34 seconds; recording.
2. Results: as shown in fig. 1;
the copy number of each sample was calculated from the standard curve. Drug treatment group inhibition was calculated using DMSO group copy number as reference. Then according to the inhibition rate of different concentration medicine treatment group, using prism8.0 software to fit medicine inhibition rate curve, and calculating half effective concentration EC of Estradiol Benzoate (EB) acting on SARS-CoV-2 activity 50 6.27. Mu.M.
EXAMPLE 2 detection of the inhibitory Activity of estradiol benzoate against entry of SARS-CoV-2S pseudovirus
1. The method comprises the following steps:
1) SARS-CoV-2S pseudovirus packaging:
HEK-293T cells in logarithmic growth phase 4X 10≡5/ml and 2ml per well were evenly seeded in 6-well plates. 37 ℃ and 5% CO 2 The cells were cultured in a cell incubator for 24 hours. Fresh medium was replaced half an hour before transfection, and 100. Mu.l of blank DMEM medium was used to prepare plasmid dilutions and transfection reagent (Polyjet) dilutions, respectively, at the following ratios per well (plasmid DNA was extracted using endotoxin-free extraction kit):
pNL4-3.Luc.R-E- 1000ng
pcDNA3.1-SARS-CoV-2-S 500ng
PolyJet 6μl
the specific preparation method comprises the following steps: the pNL4-3. Luc.R-E-plasmid and pcDNA3.1-SARS-CoV-2-Spike plasmid were simultaneously added to 100. Mu.l of blank DMEM medium and mixed, and Polyjet was diluted and mixed with 100. Mu.l of blank DMEM medium. Polyjet dilutions were added to plasmid dilutions and mixed well, incubated at room temperature for 10 min, and added well to HEK-293T cells. After culturing for 48 hours at 37 ℃, collecting the supernatant virus liquid, centrifuging for 10 minutes at 4000rpm, and filtering by a sterile filter head with the diameter of 0.45 mu m to obtain the SARS-CoV-2 pseudovirus.
2) Pseudo-virus inhibition assay:
293T cells (293T/ACE 2) overexpressing SARS-CoV-2 receptor ACE2 in logarithmic growth phase were plated uniformly in 96-well cell plates at 1x 10≡4 cells/well. The cells were cultured in a 37℃incubator for 24 hours.
The initial concentration of the drug was set at 20. Mu.M, and 8 concentration gradients were diluted 2-fold with DMEM medium containing 2% fetal bovine serum total volume, 20, 10, 5, 2.5, 1.25, 0.625, 0.3125, 0.15625. Mu.M, respectively. A DMSO solvent control was set at 60 μl per well volume, 3 duplicate wells per concentration. Mu.l of pseudovirus solution was added to the diluted drug and allowed to act at room temperature for 30 minutes, 100. Mu.l/well was added to ACE2/293T cells, and incubated at 37℃for 48 hours. The medium was removed, the cells were washed once with 100. Mu.l/well sterile PBS (pH 7.4), 50. Mu.l 1 Xcell lysate was added to each well, and lysed by shaking at room temperature for 15 minutes. Transferring 40 μl/well of the cleavage supernatant to a 96-well white ELISA plate, adding an equal volume of diluted luciferase substrate according to a single luciferase detection kit specification, immediately detecting a fluorescence value by an ELISA reader, and judging the activity of the estradiol benzoate in inhibiting virus adsorption. Calculating inhibition rate according to the corresponding relation between the fluorescence value and the drug concentration, drawing a curve, and calculating half inhibition concentration IC of the estradiol benzoate 50 。
2. Results: as shown in fig. 2;
the inhibition rate of the drug-treated group was calculated from the fluorescence values using the DMSO solvent group as a control. Then according to the inhibition rate of different concentration medicine treatment groups, using prism8.0 software to fit medicine inhibition rate curve, and calculating half inhibition concentration IC of Estradiol Benzoate (EB) for inhibiting SARS-CoV-2S protein pseudovirus from entering target cell 50 0.27. Mu.M.
EXAMPLE 3 cytotoxicity detection of estradiol benzoate
1. The method comprises the following steps:
1) Cell inoculation:
Vero-E6, 293T-ACE2 cells in logarithmic growth phase were seeded at 100. Mu.L/well in 96-well plates and cultured overnight with cell density adjusted to 1X 10≡4 cells/well.
2) Drug concentration design:
Vero-E6 cells: the initial concentration of the drug was set at 200. Mu.M (200, 66.66, 22.22, 7.41, 2.47, 0.82. Mu.M) using a 3-fold ratio dilution of DMEM medium containing 2% fetal bovine serum by total volume to 6 concentration gradients prior to dosing; 100 μl of diluted drug per well was added to Vero-E6 cells in 96-well plates in 1) respectively, with a final volume of 200 μl per well. 3 duplicate wells were set for each drug concentration. The DMSO solvent treated group served as a blank.
293T-ACE2 cells: the initial concentration of the drug was set to 100. Mu.M (100, 50, 25, 12.5, 6.25, 3.13, 1.56, 0.78. Mu.M) using a 2-fold ratio of DMEM medium containing 2% fetal bovine serum to total volume prior to administration, and 100. Mu.L of the diluted drug per well was added to 293T-ACE2 cells in 96-well plates in 1) with a final volume of 200. Mu.L per well. 3 duplicate wells were set for each drug concentration. The DMSO solvent treated group served as a blank.
3) Detecting absorbance:
after 48h incubation in incubator, 10. Mu.L of CCK-8 working solution was added to each well and incubation in incubator was continued for 3 hours. The absorbance at 450nm was measured by a microplate reader.
4) According to the measured OD value, the survival rate of Vero-E6 cells and the inhibition rate of the drugs on 293T-ACE2 cells under the action of the drugs with various concentrations are calculated respectively compared with a control group.
2. Results: as shown in fig. 3 and 4;
estradiol Benzoate (EB) had no significant toxic effect on Vero-E6 cells (fig. 3) at 200 μm and within the effective concentration range.
Estradiol Benzoate (EB) has a half-lethal dose CC50 of 39.80 μm for 293T/ACE2 cells (fig. 4), and has no significant toxic effect on 293T/ACE2 cells within a range of effective concentrations to inhibit SARS-CoV-2 pseudovirus entry.
The foregoing is merely a specific embodiment of the present invention and not all embodiments, and any equivalent modifications of the technical solution of the present invention that will be obvious to those skilled in the art from reading the present specification are intended to be encompassed by the claims of the present invention.
SEQUENCE LISTING
<110> university of medical science in south China
Wuhan Institute of Virology, Chinese Academy of Sciences
GUANGZHOU INSTITUTE OF RESPIRATORY HEALTH
<120> use of estradiol benzoate or a pharmaceutically acceptable salt thereof for the preparation of an anti-coronavirus medicament
<130> CP120010399C
<160> 2
<170> PatentIn version 3.3
<210> 1
<211> 21
<212> DNA
<213> artificial sequence
<400> 1
caatggttta acaggcacag g 21
<210> 2
<211> 21
<212> DNA
<213> artificial sequence
<400> 2
ctcaagtgtc tgtggatcac g 21
Claims (2)
1. Use of estradiol benzoate or a pharmaceutically acceptable salt thereof for the manufacture of an anti-coronavirus medicament, said estradiol benzoate having formula C 25 H 28 O 3 Molecular weight is 376.49, and structural formula isThe coronavirus is SARS-CoV-2.
2. Use of estradiol benzoate of formula C or a pharmaceutically acceptable salt thereof for the manufacture of a medicament for inhibiting coronavirus entry into a target cell 25 H 28 O 3 Molecular weight is 376.49, and structural formula isThe coronavirus is SARS-CoV-2。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010706969.6A CN112516149B (en) | 2020-07-21 | 2020-07-21 | Application of estradiol benzoate or pharmaceutically acceptable salt thereof in preparation of anti-coronavirus drugs |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010706969.6A CN112516149B (en) | 2020-07-21 | 2020-07-21 | Application of estradiol benzoate or pharmaceutically acceptable salt thereof in preparation of anti-coronavirus drugs |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112516149A CN112516149A (en) | 2021-03-19 |
| CN112516149B true CN112516149B (en) | 2023-07-18 |
Family
ID=74978791
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010706969.6A Active CN112516149B (en) | 2020-07-21 | 2020-07-21 | Application of estradiol benzoate or pharmaceutically acceptable salt thereof in preparation of anti-coronavirus drugs |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112516149B (en) |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| UY29185A1 (en) * | 2004-11-02 | 2006-05-31 | Schering Ag | SOLID ORAL DOSAGE FORMS CONTAINING A LOW ESTRADIOL DOSE |
-
2020
- 2020-07-21 CN CN202010706969.6A patent/CN112516149B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN112516149A (en) | 2021-03-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112552379A (en) | Application of synthetic peptide in preparing medicine for preventing and treating novel coronavirus infection | |
| WO2021233239A1 (en) | Application of active ingredient of root of ligulilobe sage or pharmaceutically acceptable salt thereof in preparing antiviral drug | |
| CN112516132B (en) | Application of salvianolic acid C or pharmaceutically acceptable salt thereof in preparing antiviral drug | |
| CN112516149B (en) | Application of estradiol benzoate or pharmaceutically acceptable salt thereof in preparation of anti-coronavirus drugs | |
| CN112516131A (en) | Application of salvianolic acid B or its pharmaceutically acceptable salt in preparing anti-SARS-CoV-2 medicine | |
| CN111374985B (en) | Medical application of phenazopyridine hydrochloride | |
| CN112516124B (en) | Application of tanshinol or its pharmaceutically acceptable salt in preparing antiviral medicine | |
| CN107619434B (en) | Polypeptide Z2 and application thereof in preparing polypeptide inhibitor for Zika virus infection | |
| CN113230261A (en) | Application of dihydrotanshinone I or pharmaceutically acceptable salt thereof in preparation of anti-coronavirus medicines | |
| WO2019141263A1 (en) | Broad-spectrum polypeptide against enterovirus and application thereof | |
| EP3352764B1 (en) | Combination therapy for ev71 infection | |
| CN113502288B (en) | Antisense oligonucleotides and their use in inhibiting novel coronaviruses | |
| CN113018303A (en) | Application of tanshinone IIA sodium sulfonate injection in preparation of antiviral drugs | |
| CN103709232B (en) | A kind ofly suppress the polypeptide of AIDS viral infection activity and relevant phage thereof | |
| WO2022261852A1 (en) | Application of gossypol and derivatives and analogues thereof in preparation of anti novel coronavirus and similar rna virus products | |
| CN108210497B (en) | Application of compound MLN4924 in preparation of bunyaviridae phlebovirus inhibitor | |
| CN110711202A (en) | Application of PHB2 gene or protein inhibitor in preparation of porcine circovirus 2 resistant drugs | |
| CN112516144A (en) | Application of itraconazole or pharmaceutically acceptable salt thereof in preparation of anti-coronavirus medicines | |
| CN113750219B (en) | Application of TMEM184C in preparation of medicine for preventing or treating Japanese encephalitis virus infection | |
| CN117562887A (en) | Application of 4-octyl itaconic acid in preparation of medicines and/or feed additives for treating porcine enterocoronavirus infection | |
| CN113712984B (en) | Application of PNPT 1-based small molecule inhibitor combination in preparation of antiviral drugs | |
| CN114796208B (en) | Application of rapamycin in preparing medicament for preventing or treating crucian hematopoietic necrosis | |
| CN112516133A (en) | Application of salvianolate for injection in preparing antiviral drug | |
| CN113876751B (en) | Application of hypocrellin B in preparation of medicine for preventing and treating African swine fever | |
| CN113116893B (en) | New application of OGG1 small molecule inhibitor in treating African swine fever |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |