CN112501358A

CN112501358A - Primer probe combination and kit for detecting 9 children digestive tract pathogens

Info

Publication number: CN112501358A
Application number: CN202110153617.7A
Authority: CN
Inventors: 董晓艳; 熊永清; 王洪
Original assignee: Aike Ruite Biomedical Technology Nanjing Co ltd
Current assignee: Aike Ruite Biomedical Technology Nanjing Co ltd
Priority date: 2021-02-04
Filing date: 2021-02-04
Publication date: 2021-03-16
Anticipated expiration: 2041-02-04
Also published as: CN112501358B

Abstract

The invention relates to a primer probe combination and a kit for detecting 9 children digestive tract pathogens, wherein the primer combination, the probe combination and the kit can realize one-time reaction and simultaneously detect a plurality of common viruses causing digestive system infection, are the most comprehensive detection method for the children digestive tract virus infection at present, have high efficiency and strong specificity, and provide a basis for auxiliary diagnosis for clinical examination. Through the technical scheme, the technical problem that diagnosis and research on virus pathogens related to the digestive tract infection of children in the prior art are insufficient can be solved.

Description

Primer probe combination and kit for detecting 9 children digestive tract pathogens

Technical Field

The invention belongs to the field of pathogenic microorganism molecular biology, and particularly relates to a multiple fluorescence quantitative PCR kit for detecting and distinguishing children digestive tract infection virus nucleic acid series and a detection method of the kit.

Background

Digestive tract infection is a common disease, is particularly common in clinical pediatrics, has the annual increasing trend of incidence rate, is only second to respiratory infection, and is mostly caused by the infection of pathogens such as bacteria, viruses, fungi or parasites. The virus can be developed all year round, and common viruses are adenovirus (AdV), astrovirus (AsV), Norovirus (NV), Rotavirus (RV), saxovirus (SaV), Cytomegalovirus (CMV), coxsackievirus A (CoxA 16), enterovirus 71 (EV 71), human coronavirus (Hcov) and the like. The disease caused by the infection of the digestive tract is infectious diarrhea, for example, rotavirus often causes infantile diarrhea; norovirus is the virus which most commonly causes viral gastroenteritis worldwide and is accompanied by clinical symptoms such as abdominal pain, diarrhea, vomiting and the like. Most of the digestive tract viruses have the characteristics of strong infectivity, acute morbidity, short incubation period and the like, seriously harm human health, have particularly obvious influence on children and are important reasons for causing death and disability of the children. With the development of science and technology, more new pathogenic digestive tract viruses are discovered, which causes great difficulty in diagnosis and treatment of clinically relevant diseases.

In addition, digestive tract infection can cause malnutrition of the infant patient, which in turn affects the normal growth and development of the infant patient, and the effects are particularly obvious in developing countries. Therefore, the problem of infection and prevalence of digestive tract pathogens has attracted much attention and interest from countries around the world.

The method can accurately judge the types of the pathogens of the digestive tract infection in time, and has important significance for early discovery of infectious sources, control of epidemic diseases and effective development of clinical treatment.

For many years, hospitals and laboratories around the world routinely detect common pathogens in the digestive tract by methods such as pathogen isolation culture methods and immunological examinations, but the detection methods have many defects which are difficult to overcome.

The traditional pathogen separation method has the disadvantages of complicated operation steps, high requirement on conditions, long detection period and relatively difficult guarantee of experimental safety and result accuracy; the immunological detection method usually adopts enzyme-linked immunosorbent assay, has the advantages of intuition, mature technology and good specificity, but has the limitations of time consumption, complex operation, low sensitivity, high false positive and the like on the clinical reference value.

In recent years, the introduction of molecular biology techniques such as real-time fluorescence PCR techniques and the like has greatly improved the current situation of detecting and identifying pathogens. The common fluorescence PCR detection has better sensitivity and specificity, improves the clinical identification level, but the technology is mainly aimed at single or a plurality of pathogens in the practical application process, and various detection kits are needed for synchronous detection of various pathogens, so the operation is inconvenient and the cost is higher. Aiming at the characteristics of digestive tract infection pathogens, an efficient, rapid, simple and specific detection method is established to meet the requirements of epidemic situation screening and clinical detection, and is the key point of the current digestive tract infectious disease prevention and treatment work, so that a multiple fluorescence quantitative PCR technology is developed at the same time.

The multiplex fluorescence quantitative PCR is a multiplex joint detection developed on the basis of a real-time fluorescence quantitative PCR technology, and can realize the amplification and the specific detection of a plurality of gene sequences in the same reaction tube. In the application of clinical pathogen detection, dozens or even hundreds of associated pathogens in the same specimen can be synchronously detected, which is beneficial to accurately judging the state of an illness and realizing early, rapid and accurate treatment of the disease. Successful implementation of multiplex PCR technology requires solving several key technical problems: (1) because multiple primer/probe combinations are required, the design needs to avoid cross-linking between different primers/probes. (2) Avoiding cross-homology of each set of primers/probes to other target and non-target nucleic acid sequences to prevent false positive results. (3) The optimal amplification conditions for each amplicon are different, and the reaction conditions need to be optimized to ensure that each amplicon can be successfully amplified under a single amplification condition. (4) An internal control is required as a reference to exclude interference from aspects such as nucleic acid extraction.

At present, no product capable of carrying out synchronous PCR detection on various digestive tract infection virus pathogens of the children exists, and an effective method for ensuring detection accuracy and specificity is provided. The invention is the most comprehensive detection product for pathogens related to the infection of the children digestive tract viruses in the market.

Disclosure of Invention

The invention aims at the technical problems and provides a primer and probe combination for detecting 9 pathogens related to the infection of the children digestive tract viruses according to statistical research. Viral pathogens include adenovirus (AdV), astrovirus (AsV), Norovirus (NV), Rotavirus (RV), zakivus (SaV), Cytomegalovirus (CMV), coxsackievirus a (CoxA 16), enterovirus type 71 (EV 71), human coronavirus (Hcov).

The second object of the present invention is to provide primers and probes for the above pathogen markers.

The third purpose of the invention is to provide the application of the primer probe combination of the marker in the preparation of a kit for diagnosing pathogens related to the virus infection of the digestive tract of children or assisting in the diagnosis.

The pathogen marker and the application of the primer probe combination thereof in the preparation of products for diagnosing the infection of the digestive tract viruses of children can solve the technical problem that the diagnosis research of specific pathogens related to the infection of the digestive tract viruses in the prior art is still insufficient.

It is a fourth object of the present invention to provide a kit for the diagnosis or assisted diagnosis of childhood digestive tract viral infections. The technical problem that the detection specificity of pathogen markers related to the virus infection of the digestive tract of children is not strong in the prior art is solved.

A primer probe combination for synchronously detecting 9 pathogens related to virus infection of children digestive tract comprises an upstream primer sequence of adenovirus (AdV) as shown in SEQ ID NO.1, a downstream primer sequence as shown in SEQ ID NO.2 and a probe sequence as shown in SEQ ID NO. 3; the upstream primer sequence of the astrovirus (AsV) is shown as SEQ ID NO.4, the downstream primer sequence is shown as SEQ ID NO.5, and the probe sequence is shown as SEQ ID NO. 6; the sequence of an upstream primer of Norovirus (NV) is shown as SEQ ID NO.7, the sequence of a downstream primer is shown as SEQ ID NO.8, and the sequence of a probe is shown as SEQ ID NO. 9; the upstream primer sequence of Rotavirus (RV) is shown as SEQ ID NO.10, the downstream primer sequence is shown as SEQ ID NO.11, and the probe sequence is shown as SEQ ID NO. 12; the upstream primer sequence of the zakhstan virus (SaV) is shown as SEQ ID NO.13, the downstream primer sequence is shown as SEQ ID NO.14, and the probe sequence is shown as SEQ ID NO. 15; the upstream primer sequence of Cytomegalovirus (CMV) is shown as SEQ ID NO.16, the downstream primer sequence is shown as SEQ ID NO.17, and the probe sequence is shown as SEQ ID NO. 18; the upstream primer sequence of the coxsackievirus A (CoxA 16) is shown as SEQ ID NO.19, the downstream primer sequence is shown as SEQ ID NO.20, and the probe sequence is shown as SEQ ID NO. 21; the upstream primer sequence of enterovirus 71 (EV 71) is shown as SEQ ID NO.22, the downstream primer sequence is shown as SEQ ID NO.23, and the probe sequence is shown as SEQ ID NO. 24; the sequence of an upstream primer of the human coronavirus (Hcov) is shown as SEQ ID NO.25, the sequence of a downstream primer is shown as SEQ ID NO.26, and the sequence of a probe is shown as SEQ ID NO. 27; the upstream primer sequence of the housekeeping gene is shown as SEQ ID NO.28, the downstream primer sequence is shown as SEQ ID NO.29, and the probe sequence is shown as SEQ ID NO. 30.

Wherein, the 5 'end of the adenovirus (AdV) probe is marked with FAM luminescent group, and the 3' end is marked with fluorescence quenching group BHQ 1; the 5 'end of the astrovirus (AsV) probe is marked with a ROX luminescent group, and the 3' end of the astrovirus is marked with a fluorescence quenching group BHQ 2; the 5 'end of the Norovirus (NV) probe is marked with a FAM luminescent group, and the 3' end of the Norovirus (NV) probe is marked with a fluorescence quenching group BHQ 1; the 5 'end of the Rotavirus (RV) probe is marked with FAM luminescent group, and the 3' end is marked with fluorescence quenching group BHQA; the 5 'end of the zakhstan virus (SaV) probe is marked with a HEX luminescent group, and the 3' end of the zakhstan virus (SaV) probe is marked with a fluorescence quenching group BHQ 1; the 5 'end of the Cytomegalovirus (CMV) probe is marked with a HEX luminescent group, and the 3' end of the CMV probe is marked with a fluorescence quenching group BHQ 1; the 5 'end of the coxsackievirus A (CoxA 16) probe is marked with a HEX luminescent group, and the 3' end is marked with a fluorescence quenching group BHQ 1; the 5 'end of the enterovirus 71 (EV 71) probe is marked with a ROX luminescent group, and the 3' end of the probe is marked with a fluorescence quenching group BHQ 2; the 5 'end of the human coronavirus (Hcov) probe is marked with a ROX luminescent group, and the 3' end of the human coronavirus (Hcov) probe is marked with a fluorescence quenching group BHQ 2; the 5 'end of the housekeeping gene probe is marked with a CY5 luminescent group, and the 3' end is marked with a fluorescence quenching group BHQ 2.

Synchronous detection 9 childrenThe kit for pathogens related to the infection of the child digestive tract viruses comprises the primer probe combination, a virus pathogen marker standard substance, reverse transcriptase, a buffer solution, dNTPs and MgCl₂DEPC water and Taq enzyme.

Further, the final concentration of the primer in the amplification system is 100-1000 nM; the final concentration of the TaqMan probe in an amplification system is 50-500 nM.

Furthermore, the detection sample of the kit is feces.

Further, the concentration of the standard of the pathogen marker is 10¹³copies/ml。

The invention has the beneficial effects that:

the primer probe combination of the pathogen provided by the invention can be used as a marker for predicting and detecting the risk of digestive tract bacterial infection, has the advantages of high sensitivity and strong accuracy, provides a certain application value for diagnosing the digestive tract infection, and is greatly helpful for screening, preventing and treating the digestive tract infection of children in China.

In addition, the invention also provides a kit for diagnosing digestive tract virus infection, which comprises related reagents and instructions for use. The primer has strong specificity and high sensitivity. The method can be used for qualitatively detecting and distinguishing 9 viruses of the digestive tract of the children, is the most comprehensive method for detecting pathogens related to the digestive tract virus infection of the children at present, is rapid and accurate in detection and wide in application, and can be used for clinical diagnosis and treatment of detection results.

Drawings

FIG. 1 is an amplification curve of reaction tubes No.1, No.2 and No.3 for detecting 10 negative reference samples.

FIG. 2 is No.1 reaction tube detection 5X 10⁷copies/ml to 5X 10²Amplification curves for 6 reference samples of copies/ml gradient, wherein in FIG. 2, the amplification curves are 5X 10 from left to right⁷ copies/ml、5×10⁶ copies/ml、5×10⁵copies/ml、5×10⁴copies/ml、5×10³copies/ml、5×10²Amplification curves for references of copies/ml.

FIG. 3 is the No.2 reaction tube detection 5X 10⁷copies/ml to 5X 10²Amplification curves for 6 reference samples of copies/ml gradient, wherein in FIG. 3, the amplification curves are 5X 10 from left to right⁷ copies/ml、5×10⁶ copies/ml、5×10⁵copies/ml、5×10⁴copies/ml、5×10³copies/ml、5×10²Amplification curves for references of copies/ml.

FIG. 4 is the No.3 reaction tube detection 5X 10⁷copies/ml to 5X 10²Amplification curves for 6 reference samples of copies/ml gradient, wherein in FIG. 4, 5X 10 is shown from left to right⁷ copies/ml、5×10⁶ copies/ml、5×10⁵copies/ml、5×10⁴copies/ml、5×10³copies/ml、5×10²Amplification curves for references of copies/ml.

The specific implementation mode is as follows:

a virus positive control was used as a sample. The kit consists of a primer probe mixed solution, an RT-PCR buffer, a mixed enzyme solution, a positive quality control product and RNase-free water; RT-PCR buffer includes PCR buffer, dATP, dUTP, dCTP, dGTP and MgCl₂(ii) a The mixed enzyme solution comprises Hot Start Taq enzyme, reverse transcriptase and UNG enzyme; the positive quality control product contains plasmid or RAN particle corresponding to the amplification gene sequence of the digestive tract pathogen.

The final concentration of the primer in the amplification system is 100-1000 nM; the final concentration of the probe in the amplification system is 50-500 nM.

The reaction system of the kit is 30 mu L, and specifically comprises: nucleic acid template 7. mu. L, RT-PCR buffer 20. mu.L, mixed enzyme solution 1. mu.L and primer probe mixture 2. mu.L.

Operation and result judgment of the kit:

(1) adding 7 mu L of each sample DNA/RNA co-extraction template (extracted from the feces of children patients), RNase-free water and positive quality control substances into different PCR reaction tubes, adding 20 mu L of RT-PCR buffer, 1 mu L of mixed enzyme solution and 2 mu L of primer probe mixed solution into each tube to prepare a system, covering a tube cover, and placing the system into a fluorescent quantitative PCR instrument for fluorescent PCR detection.

(2) The conditions for PCR amplification reaction in the instrument were set as follows: reverse transcription is carried out for 15min at 55 ℃; pre-denaturation at 95 ℃ for 30 s; denaturation at 95 ℃ for 10 s; annealing at 60 ℃ for 30 s; 40 cycles.

(3) After the reaction is finished, setting the base line as automatic adjustment, and analyzing the detection result according to the amplification curve graph and the Ct value.

(4) And (3) judging the effectiveness:

the Ct value detected by the RNase-free water is Undet or 40, and the Ct value detected by the positive quality control product is less than or equal to 35, otherwise, the experiment is regarded as invalid;

(5) and (4) interpretation of results:

the Ct value of the sample detection hole is Undet or 40, the sample result is judged to be negative, the sample DNA/RNA extraction fails, the sample to be detected does not contain DNA/RNA or the content is lower than the detection limit;

the Ct value of the sample detection hole is less than or equal to 35, the sample result is judged to be positive to the corresponding pathogen, and the sample detection is successful;

and the Ct value of the sample detection hole is 35-40, the retest is required once, and if the Ct value is still 35-40, the sample detection hole is judged to be negative.

And (3) sensitivity verification:

6 linear sensitivity samples (concentrations of 5X 10, respectively) were taken⁷ copies/ml、5×10⁶ copies/ml、5×10⁵ copies/ml、5×10⁴copies/ml、5×10³copies/ml、5×10²copies/ml) were performed to verify the linearity of the reagents. The detection results are shown in FIGS. 2, 3 and 4.

As can be seen from FIGS. 2, 3 and 4, the linear sensitivity samples detected by the reaction tubes No.1, No.2 and No.3 were all positive, the linearity of the reagent was good, and the lowest detection limit reached 5X 10² copies/ml。

And (3) specificity verification:

10 negative samples of the digestive tract pathogens which are not covered by the kit are respectively detected, and the experimental result is shown in figure 1.

As can be seen from FIG. 1, 10 negative samples detected by the reaction tubes No.1, No.2 and No.3 have no amplification curve, and are all negative, which indicates that the reagent has good specificity and no cross reaction.

The designed primers and probes of each group are as follows:

reaction tube No. 1: primer probes for astrovirus (AsV), sapovirus (SaV), Rotavirus (RV) are shown in table 1:

TABLE 1

Pathogen type	Forward primer	Reverse primer	Taqman probe	Fluorescent markers
					Housekeeping gene	CGGGACCTGACTGACTACCT	CCTGGACTTCGAGCAAGAGA	AGCGCGGCTACAGCTTCACCA	Cy5
AsV	GAGATCTACCCAATAGAGCATCTG	CCGTGGTTCTGGTTTTGGTATC	AGTTAATACACAAAGCCAATGCCCTTC	ROX
					SaV	CTTCAAAGAGCTGAACAATCACG	GCGTGTGCAACCACAAAGG	GTGAACCTGGGACCCAGACC	HEX/VIC
RV	ATGCTTTTCAGTGGTTGCTG	GAAGTAGCAGCAACAACTGC	GGAGTCTACTCAGCAGATGGTAAGCTC	FAM

Reaction tube No. 2: primer probes for Norovirus (NV), Cytomegalovirus (CMV), enterovirus type 71 (EV 71) are shown in table 2:

TABLE 2

Pathogen type	Forward primer	Reverse primer	Taqman probe	Fluorescent markers
					Housekeeping gene	CGGGACCTGACTGACTACCT	CCTGGACTTCGAGCAAGAGA	AGCGCGGCTACAGCTTCACCA	Cy5
CMV	CATCTGAAACATAGCCGCCACA	CGATTTTATCCTGCCCAACCAC	CGCCGGGCACAGCGGCGGTAGAG	HEX/VIC
					NV	GCCGTTGCTGATGTCAGC	TTGTGGTTGTTTCACCACGTTG	GGATCTCGCCTTATGGCAAAGATCC	FAM
EV71	TAGTTGGTAGTCCTCCGGCC	GTCACCATAAGCAGCCAGTACAG	TCCTAACTGCGGAGCACACACC	ROX

Reaction tube No. 3: primer probes for adenovirus (AdV), coxsackievirus a (CoxA 16), human coronavirus (Hcov) are shown in table 3:

TABLE 3

Pathogen type	Forward primer	Reverse primer	Taqman probe	Fluorescent markers
					Housekeeping gene	CGGGACCTGACTGACTACCT	CCTGGACTTCGAGCAAGAGA	AGCGCGGCTACAGCTTCACCA	Cy5
Adv	CCATACGGGAGGGACAAGC	GGAGTTGGCGTACAGCATG	GCCAACTATCCATACCCCCTTATTGG	FAM
					CoxA16	AACCACCCCCATGCAGC	AATTCGCCCGTTTTGCTC	TTGTGCTTTCCAGTGTCGGTGCA	HEX/VIC
Hcov	TTATGGGTTGGGATTATcCTAAATGTGA	GTTGCATCACCACTGCTAGTACCACC	TCTATCGCCTTGCGAATGAATGTGCTCAAGT	ROX

The technical means disclosed in the invention scheme are not limited to the technical means disclosed in the above embodiments, but also include the technical scheme formed by any combination of the above technical features.

Sequence listing

<110> Aike Rui Te biomedical science and technology (Nanjing) Co., Ltd

<120> primer probe combination and kit for detecting 9 children digestive tract pathogens

<160> 30

<170> SIPOSequenceListing 1.0

<210> 1

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ccatacggga gggacaagc 19

<210> 2

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ggagttggcg tacagcatg 19

<210> 3

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gccaactatc cataccccct tattgg 26

<210> 4

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gagatctacc caatagagca tctg 24

<210> 5

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ccgtggttct ggttttggta tc 22

<210> 6

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

agttaataca caaagccaat gcccttc 27

<210> 7

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gccgttgctg atgtcagc 18

<210> 8

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ttgtggttgt ttcaccacgt tg 22

<210> 9

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ggatctcgcc ttatggcaaa gatcc 25

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

atgcttttca gtggttgctg 20

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gaagtagcag caacaactgc 20

<210> 12

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

ggagtctact cagcagatgg taagctc 27

<210> 13

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

cttcaaagag ctgaacaatc acg 23

<210> 14

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

gcgtgtgcaa ccacaaagg 19

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gtgaacctgg gacccagacc 20

<210> 16

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

catctgaaac atagccgcca ca 22

<210> 17

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

cgattttatc ctgcccaacc ac 22

<210> 18

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

cgccgggcac agcggcggta gag 23

<210> 19

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

aaccaccccc atgcagc 17

<210> 20

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

aattcgcccg ttttgctc 18

<210> 21

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

ttgtgctttc cagtgtcggt gca 23

<210> 22

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

tagttggtag tcctccggcc 20

<210> 23

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

gtcaccataa gcagccagta cag 23

<210> 24

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

tcctaactgc ggagcacaca cc 22

<210> 25

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

ttatgggttg ggattatcct aaatgtga 28

<210> 26

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

gttgcatcac cactgctagt accacc 26

<210> 27

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

tctatcgcct tgcgaatgaa tgtgctcaag t 31

<210> 28

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

cgggacctga ctgactacct 20

<210> 29

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 29

gcttctcctt aatgtcacgc a 21

<210> 30

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 30

cggctacagc ttcaccacca 20

Claims

1. A primer probe combination for detecting 9 children digestive tract pathogens is characterized in that: the upstream primer sequence of the adenovirus is shown as SEQ ID NO.1, the downstream primer sequence is shown as SEQ ID NO.2, and the probe sequence is shown as SEQ ID NO. 3; the upstream primer sequence of the astrovirus is shown as SEQ ID NO.4, the downstream primer sequence is shown as SEQ ID NO.5, and the probe sequence is shown as SEQ ID NO. 6; the sequence of the upstream primer of the norovirus is shown as SEQ ID NO.7, the sequence of the downstream primer is shown as SEQ ID NO.8, and the sequence of the probe is shown as SEQ ID NO. 9; the upstream primer sequence of the rotavirus is shown as SEQ ID NO.10, the downstream primer sequence is shown as SEQ ID NO.11, and the probe sequence is shown as SEQ ID NO. 12; the upstream primer sequence of the zakhstan virus is shown as SEQ ID NO.13, the downstream primer sequence is shown as SEQ ID NO.14, and the probe sequence is shown as SEQ ID NO. 15; the upstream primer sequence of the cytomegalovirus is shown as SEQ ID NO.16, the downstream primer sequence is shown as SEQ ID NO.17, and the probe sequence is shown as SEQ ID NO. 18; the upstream primer sequence of the coxsackievirus A is shown as SEQ ID NO.19, the downstream primer sequence is shown as SEQ ID NO.20, and the probe sequence is shown as SEQ ID NO. 21; the upstream primer sequence of the enterovirus 71 is shown as SEQ ID NO.22, the downstream primer sequence is shown as SEQ ID NO.23, and the probe sequence is shown as SEQ ID NO. 24; the upstream primer sequence of the human coronavirus is shown as SEQ ID NO.25, the downstream primer sequence is shown as SEQ ID NO.26, and the probe sequence is shown as SEQ ID NO. 27; the upstream primer sequence of the housekeeping gene is shown as SEQ ID NO.28, the downstream primer sequence is shown as SEQ ID NO.29, and the probe sequence is shown as SEQ ID NO. 30.

2. The primer-probe combination for detecting 9 childhood digestive tract pathogens according to claim 1, wherein: the 5 'end of the adenovirus probe is marked with FAM luminescent group, and the 3' end is marked with fluorescence quenching group BHQ 1; the 5 'end of the astrovirus probe is marked with a ROX luminescent group, and the 3' end of the astrovirus probe is marked with a fluorescence quenching group BHQ 2; the 5 'end of the norovirus probe is marked with FAM luminescent group, and the 3' end of the norovirus probe is marked with fluorescence quenching group BHQ 1; the 5 'end of the rotavirus probe is marked with FAM luminescent group, and the 3' end is marked with fluorescence quenching group BHQA; the 5 'end of the saporin virus probe is marked with a HEX luminescent group, and the 3' end of the saporin virus probe is marked with a fluorescence quenching group BHQ 1; the 5 'end of the cytomegalovirus probe is marked with a HEX luminescent group, and the 3' end of the cytomegalovirus probe is marked with a fluorescence quenching group BHQ 1; the 5 'end of the Coxsackie virus A probe is marked with an HEX luminescent group, and the 3' end of the Coxsackie virus A probe is marked with a fluorescence quenching group BHQ 1; the 5 'end of the enterovirus 71 type probe is marked with ROX luminescent group, and the 3' end is marked with fluorescence quenching group BHQ 2; the 5 'end of the human coronavirus probe is marked with a ROX luminescent group, and the 3' end of the human coronavirus probe is marked with a fluorescence quenching group BHQ 2; the 5 'end of the housekeeping gene probe is marked with a CY5 luminescent group, and the 3' end is marked with a fluorescence quenching group BHQ 2.

3. A kit for detecting 9 children digestive tract pathogens, which is characterized by comprising the primer probe combination of claim 1, a pathogen marker standard, reverse transcriptase, a buffer solution, dNTPs, MgCl₂DEPC water and Taq enzyme.

4. The kit for detecting 9 childhood digestive tract pathogens according to claim 3, wherein: the final concentration of the primer in the primer probe composition in the amplification system is 100-1000 nM; the final concentration of TaqMan probe in the amplification system is 50-500 nM.

5. The kit for detecting 9 childhood digestive tract pathogens according to claim 3, wherein the detection sample of the kit is feces.

6. The kit for detecting 9 childhood digestive tract pathogens according to claim 3, wherein the concentration of the standard of pathogen marker is 10¹³copies/μL。