CN112501168B

CN112501168B - SgTPS5 gene promoter and application thereof

Info

Publication number: CN112501168B
Application number: CN202011334671.3A
Authority: CN
Inventors: 余纽; 陈朝黎; 杨锦昌; 李荣生
Original assignee: Research Institute of Tropical Forestry of Chinese Academy of Forestry
Current assignee: Research Institute of Tropical Forestry of Chinese Academy of Forestry
Priority date: 2020-11-24
Filing date: 2020-11-24
Publication date: 2022-09-27
Anticipated expiration: 2040-11-24
Also published as: CN112501168A

Abstract

The invention discloses a SgTPS5 gene promoter and application thereof. Belongs to the technical field of biological engineering. The promoter can drive the expression of a target gene in a plant vegetative tissue part, and the nucleotide sequence of the promoter is shown as SEQ ID NO.1 and is the promoter of SgTPS5 gene. The promoter can be applied to gene engineering for expressing plant nutrition tissue parts and producing secondary metabolites. Compared with the prior art, the invention has the following beneficial effects: the promoter can be used for expressing a large amount of target genes in plant nutritional tissue parts without driving the genes to be expressed in seeds, and avoids influencing plant propagation due to mass production of heterologous metabolites in reproductive organs, so that effective gene resources are provided for accurately expressing a large amount of plant secondary metabolites, and the promoter can be used for efficiently producing important secondary metabolites.

Description

SgTPS5 gene promoter and application thereof

Technical Field

The invention relates to the technical field of biological engineering, in particular to a SgTPS5 gene promoter and application thereof.

Background

Plant secondary metabolites are a class of nonessential small molecule organic compounds produced by secondary metabolism and normally functioning in plant growth and development, and the production and distribution of the small molecule organic compounds usually have the specificity of species, organs, tissues and growth and development stages.

A promoter is a DNA sequence located upstream of a structural gene and contains conserved sequences required for specific binding of RNA polymerase and initiation of transcription. Homeopathic elements in the promoter sequence control the expression of downstream genes by specifically binding to transcription factors.

At present, a promoter commonly used in genetic engineering is a constitutive CaMV35S promoter, and the promoter drives a target gene to be expressed in all tissues and development stages of a plant, so that a large number of heterologous metabolites are generated, and the normal growth of the plant is greatly influenced. However, other plant promoters identified by classification at present have the problems of low expression activity, limited expression parts and the like.

In conclusion, the technical problem to be solved by the present invention is to provide a promoter that can specifically express in vegetative tissue sites.

Disclosure of Invention

In view of the fact that the promoter in the prior art can drive the gene to be expressed in all tissues and organs of a plant, waste of metabolism in the plant body can be caused, and certain burden and harm can be caused to the normal growth of the plant, the technical problem to be solved by the invention is to provide the promoter specifically expressed in the vegetative tissue part, wherein the promoter is the promoter of the SgTPS5 gene.

In order to achieve the purpose, the invention adopts the following technical scheme:

a promoter is characterized by being capable of driving the expression of a target gene in a plant vegetative tissue part, and the nucleotide sequence of the promoter is shown as SEQ ID NO.1 and is the promoter of SgTPS5 gene.

The terpene synthase is a key enzyme in the synthetic pathway of plant secondary metabolites, and for the research of a terpene synthase TPS gene promoter, the terpene synthase TPS gene promoter can lay a good foundation for explaining the expression specificity of terpene metabolites, and simultaneously provides effective gene resources for accurately expressing a large amount of plant secondary metabolites, and has important significance for the efficient production of important secondary metabolites.

An expression vector containing the promoter.

A host cell containing the above expression vector.

The promoter is applied to gene engineering for expressing and producing secondary metabolites by utilizing plant nutritive tissue parts.

Preferably, the plant vegetative tissue parts are leaves, glandular hairs and roots.

Preferably, the secondary metabolite is a terpenoid.

According to the technical scheme, compared with the prior art, the invention has the following beneficial effects: the promoter can be used for expressing a large amount of target genes in plant nutritional tissue parts such as leaves and glandular hairs without driving the genes to be expressed in seeds, and avoids influencing plant propagation due to mass production of heterologous metabolites in reproductive organs, thereby providing effective gene resources for accurately expressing a large amount of plant secondary metabolites and being used for high-efficiency production of important secondary metabolites.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the provided drawings without creative efforts.

FIG. 1 is a diagram showing an electrophoresis of RT-PCR in example 1 of the present invention;

FIG. 2 is a diagram showing a colony PCR electrophoresis in example 1 of the present invention;

FIG. 3 is the enzyme cutting electrophoresis chart of the prokaryotic expression vector pET30a-SgTPS5 of the embodiment 2 of the invention;

FIG. 4 is a diagram showing the expression result of SgTPS5 protein analyzed by SDS-PAGE in example 3 of the present invention;

FIG. 5 is a diagram showing the purification results of protein supernatant of SgTPS5 in SDS-PAGE analysis in expanded culture in example 3 of the present invention;

FIG. 6 is a photograph showing the results of SgTPS5 protein purification by SDS-PAGE and Western Blot analysis in example 3 of the present invention;

FIG. 7 is a GC-MS total ion flow diagram of the reaction product of the SgTPS5 enzyme in example 4 of the present invention;

FIG. 8 is a GC-MS mass spectrum of the product of the SgTPS5 enzyme reaction in example 4 of the present invention;

FIG. 9 is a diagram showing a third PCR reaction product in example 5 of the present invention;

FIG. 10 accompanying drawing is the cloning and colony PCR of the SgTPS5 promoter fragment in example 6 of the present invention;

FIG. 11 is a drawing showing a map of the expression vector of pCambia1301 in example 6 of the present invention;

FIG. 12 is a diagram showing the tissue expression specificity of the ProTPS5 promoter in example 7 of the present invention;

FIG. 13 is a drawing showing the expression of the 35S promoter in Arabidopsis flowers and seeds according to example 7 of the present invention (pictures from Holtorf S, Apel K, Bohlmann H.Complex of differential compatibility and expression for the overexpression of genes in Arabidopsis thaliana. plant Mol biol.1995 Nov; 29(4): 637-46).

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Phantamax super-fidelity DNA Polymerase high fidelity enzyme from Vazyme; pMD19(simple) subcloning vector was purchased from TAKARA; t4 ligase was purchased from thermofisher; promoter Walking kit Genome Walking kit (codeno.6108) was purchased from Takara corporation; the plant genome DNA extraction kit was purchased from Tianmu. The drug not mentioned is a conventional experimental drug purchased from a commercial channel; the unrecited experimental method is a conventional experimental method, and is not described in detail herein.

Example 1 cloning of the SgTPS5 Gene

Extracting RNA of the stem tissue of the phoebe nanmu, and synthesizing cDNA by reverse transcription reaction of reverse transcriptase M-MLV. The cDNA was used as a template, and PCR amplification was carried out using a phanta max super-fidelity DNA Polymerase high-fidelity enzyme. The primer sequences used were as follows:

the forward primer 1 is: 5'-GGGGTACCATGTCAGTTGCAGCGTTAG-3', respectively; SEQ ID No. 2;

the reverse primer 1 is: 5'-GCTCTAGATCATGCGACAGGATTTATGAGC-3'; SEQ ID NO. 3.

The PCR reaction system (total volume 50. mu.L) is shown in Table 1.

TABLE 1 PCR reaction System

ddH ₂ O	17μL
		2×Phanta Max Buffer	25μL
dNTP Mix(10mM each)	1μL
		Template DNA	2μL
Forward primer 1 (10. mu.M)	2μL
		Reverse primer 1 (10. mu.M)	2μL
Phanta Max Super-Fidelity DNA Polymease(1U/μl)	1μL

The PCR reaction program is: 30s at 95 ℃; (95 ℃ for 15s, annealing temperature of 45-55 ℃ for 15s, extension of 72 ℃ for 1min) x 39 cycles; finally, the extension is carried out at 72 ℃ for 5 min.

The PCR product is detected by 1% agarose gel electrophoresis, the result is shown in figure 1, M in figure 1 is DNA marker DL2000, and the electrophoresis result shows that the single size of the amplified gene band is correct and accords with the expectation.

A reaction is carried out on a PCR product of the SgTPS5 gene amplified by phanta max super-fidelity DNA Polymerase high-fidelity enzyme, 1 ATP adaptor is added on each side of the PCR product, and then pMD19(simple) subcloning vector is connected. The PCR product was ligated with pMD19(simple) subcloning vector using T4 ligase in the reaction system shown in Table 2.

TABLE 2 ligation reaction System

ddH ₂ O	The volume is fixed to 20 mu L
		10×T4 DNA Ligase buffer	2μL
T vector
		20～100ng
Insert fragment			The molar ratio of the T carrier to the T carrier is 1: 1-5: 1
	T4 DNA ligase	1μL

And putting the system into a constant-temperature water bath kettle at the temperature of 22 ℃ for reacting for more than 60min or overnight at the temperature of 4 ℃ to obtain a connecting product. And then the ligation product is transformed into escherichia coli and is subjected to positive cloning identification.

The transformation conditions were: adding 5 mul of the ligation product into 200 mul of the competent cells, mixing the materials gently and performing ice bath for 30 min; quickly putting into 42 deg.C water bath, thermally shocking for 90s, immediately putting on ice for 2 min; adding 800 μ L LB culture medium, culturing at 37 deg.C for 1 h; and (3) centrifuging the bacterial liquid at 6000rpm for 2min, removing the supernatant, suspending the thallus, coating the thallus on an LB (Luria Bertani) flat plate containing antibiotics (Amp), and performing inversion dark culture at 37 ℃ for 12-16 h. And screening positive clones by colony PCR.

The screening method comprises the following steps: single colonies were randomly picked from the transformation plates and cultured in liquid medium in 1.5mL centrifuge tubes. Each tube is numbered, 1. mu.L of each tube is used as a template for PCR detection, the remaining culture is stored at 4 ℃, and colonies which are detected to be positive are stored on a plate or a glycerol tube for later use. The primer sequences used were as follows:

forward primer 2: 5'-CGCCAGGGTTTTCCCAGTCACGAC-3', respectively; SEQ ID No. 4;

reverse primer 2: 5'-AGCGGATAACAATTTCACACAGGA-3'; SEQ ID NO. 5.

The PCR reaction system is as follows: mu.L of the bacterial solution, forward primer 2,

reverse primer

2, 1 Xbuffer, 0.25mM dNTP mix, 0.5. mu.L of Ex Taq DNA polymerase, and PCR amplification was performed after mixing.

The PCR procedure was: 5min at 94 ℃; 30s at 94 ℃, 1min at 55 ℃, 1min at 72 ℃, 30s, and 35 cycles; extension for 10min at 72 ℃.

The colony PCR result is shown in FIG. 2, wherein M in FIG. 2 is DNA marker DL2000, and No. 1-8 are positive bacteria. And selecting positive monoclonal colonies, extracting plasmids, and then delivering to sequencing. Through sequencing analysis, the cloned sesquiterpene synthetase gene SgTPS5 contains 1674 bases, and the coded protein is named as sesquiterpene synthetase SgTPS5 and has 557 amino acids in total. And thus, the positive bacterium which is obtained by successfully transforming the recombinant plasmid in which the sesquiterpene synthetase gene SgSTPS5 is inserted into the pMD19 cloning vector into prokaryotic cell Escherichia coli Top10 is named as Top10-SgTPS 5.

The nucleotide sequence of SgTPS5 is as follows:

ATGTCAGTTGCAGCGTTAGCAATTGCTACTTCCACACCTTCATCTTTTGTTCCTCGTCGTTCTGCAAATTATCATCCTAGCGTTTGGGGAGACCATTTCATTAAATATGCTTCTCAGCCTTTGGAAGCAGATGAGGAAATGGAGGACCATATTGAAACATTGAAAGAAATTGTGAGGAAAATGCTTGTCCCCGCAACTGATAGGCCTTTAACAAAAGTTAAGTTGATTGATTCAATCCAACGTTTGGGTGTGTACTATCATTTTGAAAGTGAGATAGATGAAGTGTTGTGTCAAATTCAGAAGAATTATGTAAAGGATGGTCTAATAACTCTCAATGAGGATCTCCATGCTTTGGCTCTTCTCTTTAGGTTACTAAGGCAGCAAGGATATCACGTTTCACCTGATGTGTTCAACAAGTTCAAAGATGAGCAAGGAAAAATCAGTGAAACAATTACCAATGATGTTGAAGGAATGCTAAGCTTATATGAAGCTGCACATCTCAGGATACATGGAGAAGACATATTAGATGAAGCCCTTGATTTTACTTCCACTCATCTTAAGTTTTTAACCACCCAATTGAGTGATTCTTATGCCGGAAAAGTCATTCAAAGCTTAAAGTGGCCTCTGCGGAGGAGGCTTCCTAGGCTGGAGTCTTGGCACTACTTTTCTACTTACCGGGAAGATCCTTCGCACAATGAAACTTTACTGGACTTTGCAAAGTCGGATTTCAATAGGGTGCAAAAGCTACACCAGAGGGAAATTGGAAACCTCTCAAAGTGGTGGAAGGATTTAGATTTCGCTACGAAACTACCTTTCGCGCGCAATAGGTTGGTGGAGGCTTACTTTTGGATAATGGGAGTCTATTTCGAGCCTTCCTACTCACTTGCTAGAAGGATAATGACCAAAGTGATATCATTGACATCAATTCTTGATGATACATACGATGTGTACGGTACACTTGATGAACTAGAACTTCTCACTGAAGCGATCGACAAGTGGGACATCTCTTGCATGGATTTTCTTCCAGAGTACATGAAGCTTATTTATCAACAGCTCTTGGATGTTTATGATGAAATTGAGCGAGAGACAGCAAAAGAAGGAAGAGCTTTCTGTGTAAATTACGGAAAAGAAGAAATGAGAAAAGTGACTCGAGCTTACTTGGCTGAAGCCAAATGGTTCCACAACAACTATACACCAACATTGGAGGAGTATATGAAGGTCGCACAAGTATCTTCGGGTTATCGTATGCTTACAACAGTATCCTTCATTGGCATGGGATCCATAGCTACTGAGGAGGCCTTCAAATGGGTAGCCAAAGATCCGAAAATTGTTAAAGGTTCCTTAGTTATTTGCAGACTCATGGACGACATTGTTTCCAATAAGCTTGAGCAAGAGAGAGGGCATGTTGTTTCAGCTCTGGAATGCTACATGAAGCAACATGGTACAACCGAGGAAGAAACCATTGTTGAATTTCGCAGACGAGTTGAAAATGCATGGAAGGATATAAACGAGGATTGCCTTCAACCTTTCGAAGTGGCAAAGCCTCTGCTGATGCGAAGTCTGAACATGTCGCGCGTAATTCATCTTCTTTATACGGATTATGATTGCTACACTCACTCTGCTGGAAATACAAAGAAGAACATTGAAGCCTTGCTCATAAATCCTGTCGCATGA；SEQ ID NO.6。

the amino acid sequence encoded by SgTPS5 is as follows:

MSVAALAIATSTPSSFVPRRSANYHPSVWGDHFIKYASQPLEADEEMEDHIETLKEIVRKMLVPATDRPLTKVKLIDSIQRLGVYYHFESEIDEVLCQIQKNYVKDGLITLNEDLHALALLFRLLRQQGYHVSPDVFNKFKDEQGKISETITNDVEGMLSLYEAAHLRIHGEDILDEALDFTSTHLKFLTTQLSDSYAGKVIQSLKWPLRRRLPRLESWHYFSTYREDPSHNETLLDFAKSDFNRVQKLHQREIGNLSKWWKDLDFATKLPFARNRLVEAYFWIMGVYFEPSYSLARRIMTKVISLTSILDDTYDVYGTLDELELLTEAIDKWDISCMDFLPEYMKLIYQQLLDVYDEIERETAKEGRAFCVNYGKEEMRKVTRAYLAEAKWFHNNYTPTLEEYMKVAQVSSGYRMLTTVSFIGMGSIATEEAFKWVAKDPKIVKGSLVICRLMDDIVSNKLEQERGHVVSALECYMKQHGTTEEETIVEFRRRVENAWKDINEDCLQPFEVAKPLLMRSLNMSRVIHLLYTDYDCYTHSAGNTKKNIEALLINPVA*；SEQ ID NO.7。

example 2 codon optimization and full Gene Synthesis of sesquiterpene synthetase Gene SgTPS5, construction of expression vector and transformation of prokaryotic cells

The amino acid sequence of the SgTPS5 protein is optimized by adopting codon optimization software, and the base sequence of the encoding gene is shown as SgTPS 5-optimized. The full-length sequence of the sesquiterpene synthetase gene SgTPS5 after codon optimization is synthesized by adopting a full-gene synthesis method. The nucleotide sequence of SgTPS5-optimized is as follows:

ATGAGCGTTGCGGCACTGGCAATTGCAACCAGTACCCCGAGTAGTTTCGTTCCGCGTCGTAGCGCGAATTATCATCCGTCTGTCTGGGGCGATCATTTCATCAAATATGCGAGTCAACCGCTGGAAGCTGACGAAGAAATGGAAGACCACATCGAGACCCTGAAAGAGATCGTCCGTAAAATGCTGGTTCCGGCAACCGATCGTCCGCTGACCAAAGTCAAACTGATCGATAGCATCCAGCGTCTGGGCGTTTATTACCACTTCGAGAGCGAAATCGACGAAGTCCTGTGCCAGATCCAGAAAAACTACGTCAAAGACGGCCTGATTACCCTGAACGAAGATCTGCACGCACTGGCACTGCTGTTTCGTCTGCTGCGTCAACAAGGTTATCACGTTTCCCCGGATGTCTTCAACAAATTCAAAGACGAGCAGGGCAAAATCAGCGAAACCATCACCAACGACGTCGAAGGTATGCTGAGTCTGTACGAAGCAGCACATCTGCGTATTCACGGCGAAGATATCCTGGACGAAGCACTGGATTTTACCAGCACCCATCTGAAATTCCTGACCACCCAACTGAGCGATAGCTACGCAGGCAAAGTTATTCAGAGCCTGAAATGGCCGCTGCGTCGTCGTCTGCCGCGTCTGGAAAGCTGGCATTACTTCAGCACCTACCGCGAAGATCCGAGTCATAACGAAACCCTGCTGGATTTCGCGAAAAGCGACTTTAACCGCGTCCAGAAACTGCATCAGCGCGAAATTGGTAACCTGTCCAAATGGTGGAAAGACCTGGACTTTGCGACCAAACTGCCGTTTGCACGTAACCGTCTGGTCGAAGCGTATTTCTGGATCATGGGCGTCTATTTTGAACCGAGCTATAGCCTGGCCCGCCGTATTATGACCAAAGTTATCAGCCTGACCAGTATTCTGGACGATACCTACGACGTTTACGGTACCCTGGACGAACTGGAACTGCTGACCGAAGCTATCGACAAATGGGACATCAGCTGCATGGATTTTCTGCCGGAGTACATGAAACTGATCTACCAGCAGCTGCTGGACGTTTACGACGAAATCGAACGCGAAACCGCGAAAGAAGGTCGCGCGTTTTGCGTTAATTACGGCAAAGAAGAAATGCGCAAAGTTACCCGCGCATATCTGGCCGAAGCGAAATGGTTCCACAACAACTATACCCCGACCCTGGAAGAATATATGAAAGTTGCGCAGGTTAGCTCTGGCTATCGTATGCTGACCACCGTTTCCTTCATTGGCATGGGTAGCATTGCGACCGAAGAAGCCTTCAAATGGGTCGCGAAAGACCCGAAAATCGTCAAAGGTAGTCTGGTTATTTGCCGTCTGATGGACGACATCGTCTCCAACAAACTGGAGCAGGAACGCGGTCACGTTGTTTCTGCACTGGAATGTTACATGAAACAGCACGGCACCACCGAAGAAGAAACCATTGTCGAATTTCGCCGTCGCGTTGAAAACGCCTGGAAAGACATCAACGAGGACTGTCTGCAGCCGTTTGAAGTTGCTAAACCGCTGCTGATGCGTTCTCTGAACATGAGTCGCGTTATCCACCTGCTGTACACCGATTACGACTGTTATACCCATAGCGCGGGCAACACCAAAAAGAACATCGAGGCGCTGCTGATCAATCCGGTTGCATAA；SEQ ID NO.8。

the optimized SgTPS5 gene and the plasmid pET30a are subjected to double enzyme digestion through restriction enzyme sites Nde I and Hind III respectively, wherein the enzyme digestion system is as follows: nde I and HindIII are respectively 1 mu L, the optimized SgTPS5 gene concentration is 0.3 mu g, the plasmid pET30a concentration is 1 mu g, sterilized double distilled water is added to 30 mu L, and the enzyme cutting time is 1 h. And after enzyme digestion, purifying and recovering by using a nucleic acid purification and recovery kit to obtain the optimized SgTPS5 gene fragment subjected to double enzyme digestion and the plasmid pET30 a.

Connecting the optimized SgTPS5 gene fragment after enzyme digestion to an expression vector plasmid pET30a after enzyme digestion, wherein the connection reaction conditions are as follows: optimized SgTPS5 gene and pET30a plasmid (the molar ratio is 3:1) are connected with Buffer and T4 DNA ligase in a 1x mode, after mixing, the mixture is placed at 15 ℃ for 16h to complete the connection reaction, and recombinant plasmid pET30a-SgTPS5 (recombinant plasmid after the optimized SgTPS5 gene is inserted into expression vector pET30 a) is obtained. The recombinant plasmids were then transformed into the E.coli Top10 and E.coli BL21(DE3) clonal strains. Selecting positive colonies obtained by screening antibiotic (kan), extracting plasmids, confirming the accuracy of the final expression vector by an enzyme cutting method, as shown in figure 3, and sequencing to obtain positive bacteria, namely Top10-SgTPS5(2) and BL21-SgTPS5, successfully transforming the recombinant plasmid of the optimized SgTPS5 gene inserted into the pET30a expression vector into prokaryotic cells.

The well-constructed BL21-SgTPS5 strain is cultured in a large scale, firstly, the single clone BL21-SgTPS5 is selected and inoculated into 4mL LB culture medium (containing 50 mug/mL kanamycin sulfate), the temperature is 37 ℃, the rpm is 200, and the strain is cultured until OD is reached ₆₀₀ And (3) 0.5-0.8, adding IPTG (isopropyl thiogalactoside) with the final concentration of 0.1mM into a test tube culture solution, and then respectively placing the test tube culture solution at 15 ℃ and 37 ℃ for induced expression to obtain a bacterial solution for expressing the sesquiterpene synthetase SgTPS5 in a large amount.

Example 3 prokaryotic expression, protein purification and protein quality inspection of Phoebe Mach sesquiterpene synthase SgTPS5

Taking the bacterial liquid which is induced in the embodiment 2 and expresses a large amount of sesquiterpene synthetase SgTPS5, centrifuging at 12000rpm for 5min, removing the supernatant, adding PBS liquid to resuspend and precipitate, finally adding SDS-PAGE protein loading buffer solution, heating the sample at 100 ℃ for 10min, centrifuging, taking the supernatant and performing electrophoresis.

And (3) performing 100V stabilized voltage electrophoresis 10min before electrophoresis, after the bromophenol blue indicator enters the separation gel, performing 200V stabilized voltage electrophoresis until the bromophenol blue band moves to 1cm away from the bottom of the gel, taking out the gel, dyeing the gel with Coomassie brilliant blue dyeing solution, and then transferring the gel into a decoloring solution, and decoloring until the background is clear. The results are shown in FIG. 4, where M in FIG. 4 is protein marker, Lane 0 is control, Lane 1 is induced at 15 ℃ for 16h, Lane 2 is induced at 37 ℃ for 16h, and the arrow indicates the target protein SgTPS 5.

4L of the expression strain was cultured in an enlarged manner to OD as described in example 2 ₆₀₀ When the concentration was 0.8, the cells were induced at 15 ℃ for 16 hours with the addition of 0.1mM IPTG. The whole bacteria were sonicated with 50mM Tris (pH8.0), 300mM NaCl, 50mM Imidazole 1% Triton X-100, 1mM DTT, 1mM PMSF while the Ni-IDA affinity column was equilibrated with 50mM Tris (pH8.0), 300mM NaCl, 50mM Imidazole buffer, after which the target protein was eluted with different concentrations of Imidazole in the equilibration buffer and each eluted fraction was collected for SDS-PAGE analysis. The analysis result is shown in figure 5, wherein M in figure 5 is protein marker, Lane 1 is supernatant obtained after the whole bacteria are broken and centrifuged, Lane 2 is effluent obtained after the supernatant is incubated with Ni-IDA, Lane 3-4 is elution components of 50mM Imidazole, Lane 5-6 is elution components of 100mM Imidazole, Lane 7-10 is elution components of 300mM Imidazole, and the arrow indicates target protein.

Purifying by Ni-IDA affinity chromatography, collecting Lane 9-10 with good purity and concentration, dialyzing into 1 × PBS, 10% Glycerol, filtering with 0.22 μm membrane after the completion of dialysis at pH7.4, and subpackaging and freezing at-80 ℃. Solubility of the protein of interest the protein concentration was determined to be 0.956mg/ml using BSA as a standard and by the Bradford method.

Protein Western-blot detection operation flow of Machilus thunbergii sesquiterpene synthetase SgTPS5 is referred to protein electrophoresis experiment technology Guo Yao Jun, and results are shown in FIG. 6, Lane M in left picture ₁ Is SDS-PAGE protein Marker, Lane 1 is BSA protein, Lane 2 is SgTPS5 protein(ii) a Lane M in the right panel ₂ Is a Western-blot Marker, and the antibody is Anti-His.

Example 4 Biochemical function of SgTPS5

Farnesyl pyrophosphate (FPP) or geranyl pyrophosphate (GPP) is taken as a substrate, and an enzymatic reaction system is as follows: 25mM Tris-HCI (pH7.4), 5mM Dithiothreitol (DTT), 100mM potassium chloride, 5mM magnesium chloride, 10% glycerol, and a substrate concentration of 50. mu.M, 50. mu.g of SgTPS5 protein, which is the synthases for the Machilus thunbergii sesquiterpenes purified in example 3, was added and the mixture was allowed to react at 37 ℃ for 1 hour. After the reaction is finished, extracting volatile substances for 30min by using a solid phase microextraction SPME fiber PDMS 100 mu m headspace, desorbing at 250 ℃ for 3min, and injecting. The catalytic products were detected using a GC-MS combination (Agilent GC-MS 7890B-5977A).

The gas chromatographic column is HP-5MS (30m multiplied by 0.25mm), the flow rate of carrier gas high-purity He is 1.0mL/min, and the temperature rising program is as follows: keeping the temperature at 50 ℃ for 1min, raising the temperature to 80 ℃ at the speed of 5 ℃/min, keeping the temperature for 1min, raising the temperature to 220 ℃ at the speed of 10 ℃/min, keeping the temperature for 10min, keeping the temperature at a sample inlet at 250 ℃, keeping the temperature of an ion source EI 70eV at 230 ℃, keeping the temperature at an interface at 250 ℃, keeping the collection mass range at 30-200 amu, retrieving data through a NIST 14 mass spectrum library, comparing the data with a standard spectrogram, and identifying the peak of each component.

The sample total ion flow pattern is shown in FIG. 7. When FPP is used as a substrate, peaks appear at retention times of 15.37, 15.82, 15.98, 16.43, 16.88, 16.98, 17.14, 17.44, 17.73, 17.51, 17.54 and 17.79, respectively, and the results of NIST 14 data search library search and comparison show that the corresponding compounds are α -Cubebene (α -cube), α -Copaene (α -Copaene), β -Copaene (β -Copaene), β -Caryophyllene (β -Caryophyllene), lupinene (Humulene), epi- β -Caryophyllene (epi- β -Caryophyllene), γ -ylarene (γ -murylene), α -ylarene (α -murylene) and δ -cadinene (δ -cadidinediene). When GPP is taken as a substrate, a peak appears at the retention time of 14.00, and the result shows that the corresponding compound is Geraniol (Geraniol) through NIST 14 data retrieval spectrum library retrieval comparison. The GC-MS mass spectrum is shown in FIG. 8. Therefore, the Machilus thunbergii sesquiterpene synthetase SgTPS5 is a multifunctional enzyme, can catalyze FPP to synthesize 9 sesquiterpenes, and can catalyze GPP to synthesize 1 monoterpene.

Example 5 cloning of the SgTPS5 promoter

The promoter Walking kit is Genome Walking kit (codeno.6108), and the detailed method refers to the kit instruction. The method comprises the following specific steps: according to the SgTPS5 genome DNA sequence, three equidirectional and higher-annealing-temperature specific primers and four uniquely-designed lower-annealing-temperature degenerate primers provided in the kit, namely AP1, AP2, AP3 and AP4 are respectively designed to carry out thermal asymmetric PCR reaction. The sequences of the specific primers were as follows:

SP1:5'-AAAAGATGAAGGTGTGGAAGTAGC-3'；SEQ ID NO.9；

SP2:5'-GAGAGATAACTTGGGCTTCTTGGC-3'；SEQ ID NO.10；

SP3:5'-GAAATATTATAATGAGCAGGGATG-3'；SEQ ID NO.11。

usually, at least one degenerate primer and the specific primer can be subjected to a thermal asymmetric PCR reaction by utilizing the difference of annealing temperatures, and the flanking sequence of the known sequence can be obtained by three nested PCR reactions. If the length obtained by one experiment can not meet the experiment requirement, the flanking sequence can be continuously obtained according to the sequence information obtained by the first step.

Extracting genome DNA of leaves of the Machilus thunbergii by using a plant genome DNA extraction kit, accurately quantifying by OD (origin-to-destination) determination, taking a proper amount as a template, taking an AP1 primer as an upstream primer and an SP1 primer as a downstream primer, and carrying out a first 1st PCR reaction. Then, the 1st PCR reaction solution was diluted 100 times, and 1. mu.L of the diluted solution was used as a template for a 2nd PCR reaction, and the 2nd PCR reaction was carried out using AP1 Primer as an upstream Primer and SP2 Primer as a downstream Primer. And (3) diluting the 2nd PCR reaction solution by 1-1000 times, taking 1L as a template of the 3rd PCR reaction, and carrying out the 3rd PCR reaction by taking AP1 Primer as an upstream Primer and SP3 Primer as a downstream Primer. 5L of each 1st, 2nd and 3rd PCR reaction solution was electrophoresed through 1% agarose gel, and the electrophoresis pattern is shown in FIG. 9, where M in FIG. 9 is DNA marker DL2000 and the arrow indicates the third round of PCR reaction product. Clear electrophoresis bands are recovered by cutting gel, and the PCR products are subjected to DNA sequencing by using SP3 Primer as a Primer. Finally obtaining the SgTPS5 upstream promoter sequence ProTPS5 with the length of 2033 bp.

The promoter sequence of SgTPS5 is as follows:

CTGAATATTAAATTAGTACAATTTTAATCTCTACTTATTTAAATTTTCTCAAAATTGCATTTAAGTTTACGTTTTATATTTGGCGTGTTTCCCATGGAAAGATAAGAACTTTTAGCGTTACTTTTATACTAAAATTCAATTCTACTCCCATATAAATATGGTTAATTATATTATTTTTTAACATAATAATCTAATTTGATAAAAAAATATTTATTTTATAGAAAATAAATTATTTTTGAAAAAACTCAAAGTACTAAATTAAAAAAATACACTTTACAACATTTATTATTTATATAAAAATAACACAAAATTTTCAATGCATAAGGCCGGAATTCTTTTCTCGCTAAAAATTTCTATATTACTAATAAAATGGGAGTATGAAAGCTGCAAAATTTTGGCCTATTAGTGGTTCACCTGGAATGTCAAATTTTTACACTGCTTCTGTAGTCTTCGCTTTCTTTTCTGGATAAGAAAATTTCACCGACGGGCGCGGAGGGTAGGACTCCCTTTTCGGGGGGACCAAAAAATTTATTAAAACTTTTTTTAGTATGGTAGGAAATTAGAATCATTATAAAATAAGTTGAACCAAATTTTTATTTGTCCTTATTAAATTCACAAATTTAGGTTTAAGTTTGACTATTAAACAAATCTAATTGTGCTTAAACAAAGTTTAACATATTTAATGGGTTATTTTCAATAAAATAACAATTTAAAAAAATGGAAAATAAATTTTTTTTTAAACACACTTCTCTCTCTCTTTTTCTCTCTTTTATTTTTTAGTTTGATTTCTTTCTATTTTTCTTGTTTTTCCAAAAATAAGAAAACACAATGATACTTAGGAAATGTTTGATAGTATTAAAATGTTTAGCACTAGATTTTAATTGTTGAAACCATTTAAGTACTAAGGTTTCATTTGTTTTTAGAAAACAATTTCCATAAAAAAACTCATTTTTTAATATATGAGTTAAGGAGTATCATCTATTTTTACATATTGTGATTAAAATAAGGACAAAAATTAGGTATAGCTTCTTTTGTATTTTTTATAAGGTTTTCTATTCAAATTATAATATGTGTATTAATTATTGTATTATAATTAAAATATTAATAATTATTACAATCATCAAATTAAAATTTTTAATAGTTAATAAAATAATTAATATACATATTATATTCTAAATGGAGAATTTTACGGCAAATACTTAAGGAATATTACTTAAGTTTTATCCTTAAAATTGTAATTAATAGAACTATAGTAGTGGGGGAAAACAATTCCTTCTTTGAAAAAAAGAATTATCTTTCATAAAATTCATTATATTTAATATTGAATACATTAACTATTTTCCACATCTTGATCTATAGAAAATATTTTTTTTACCAAAATAAATGAAGTCTAAATTTATAGTGTTTGAATAGTTTTGTATTGAATTACGTTAATAGTTTGAAATTTTTATTAACGAATATTGAAAATTTATAAAATTTCAAAATTATCTTTGATTATGATTTTATAAATTATACACATCAAATCTTTAAATGTTATGATATATATTATATATTTAATATTCAATTATTATTCTAACAATAAAGATAATATTTAACATATTTGTCCAATAAAATCTCTCTAAAATAAGAGAAGTTGCTAAATGTTATTAAACAAATTTAATAAAATTTCATTTAATTTAATATTTATTTTTAATAAATTATATAAATAGGATCTAATTCTAAATTTGAACCTATCCATTTAACTATTAACATCCCTGCTCATTATAATATCTCATATATTTATTTTATTTTCTAGATGGGGCTAAATTAATAAAAGAAATCACAAAAATAAAATTACATATATATTTTATTTTTTTTTGAAAATTTATGGGGCCCATGGCTCCCTAATAATGAGGAGGCTGCGTCCCTGTTCACCGAGTTAAACTATAAATGCCAAGTAAGCCCAAGTTATCTCTCAGCTCAAAACCCGTCCATTCATCCAATTTCATAGCACTCTTTCTCATAAGCAGAAGTAACGGAAAAAGGCGAAGAAT；SEQ ID NO.1。

example 6 construction of SgTPS5 promoter expression vector and genetic transformation

Primers were designed based on the promoter sequence of SgTPS5 ProTPS5, and the sequences of the primers were as follows:

ProTPS5-f2:5’-TCCTCTAGAGTCGACCTGCAGGTTTACGTTTTATATTTGGC-3’；SEQ ID NO.12；

ProTPS5-r1:5’-TTACCCTCAGATCTACCATGGATTCTTCGCCTTTTTCCGTTAC-3’；SEQ ID NO.13。

the genomic DNA of the Machilus thunbergii is taken as a template, and phanta max super-fidelity DNA Polymerase high-fidelity enzyme is adopted for PCR amplification, the result is shown in FIG. 10A, M in FIG. 10A is DNA marker DL2000, and Lane 1-2 is a PCR amplification product. And performing gel electrophoresis on the PCR products, wherein the results show that the PCR products are amplified to a single band and have similar sizes. And cutting and recovering the strip glue to obtain the SgTPS5 promoter sequence ProTPS 5.

A PCR purified product of ProTPS5 gene amplified by phanta max super-fidelity high fidelity enzyme is firstly added with A reaction, 1 ATP joint is respectively added on two sides of the product, and then pMD19(simple) subclone vector is connected to obtain the T cloning vector plasmid of ProTPS 5. The T cloning vector plasmid of ProTPS5 and the pCambia1301 vector plasmid were digested simultaneously with PstI and NcoI (using the corresponding restriction enzymes from Thermo or Takara).

The cleavage reaction system is shown in Table 3.

TABLE 3 digestion system

Components	Volume (mu L)
		10×Buffer	2
Plasmids	5
		KpniI	2
BamHI/XbaI	2
		ddH ₂ O	Constant volume is 40

After the enzyme digestion products are respectively purified and recovered, T4 DNA ligase which is the same as the T vector is adopted for connection, and the process is the same as the above. Selecting 8 resistant clones of each Escherichia coli transformed by the ligation product, amplifying by using primers on both sides of the insertion position of the vector,

the primer sequences used were as follows:

forward primer 2: 5'-CGCCAGGGTTTTCCCAGTCACGAC-3', respectively; SEQ ID No. 4;

reverse primer 2: 5'-AGCGGATAACAATTTCACACAGGA-3'; SEQ ID NO. 5.

As shown in FIG. 10B, M in FIG. 10B is DNA marker DL2000, and Lane 1-8 are colony PCR amplification products. Randomly selecting 1 positive clone for sequencing, wherein the sequencing result is consistent with the sequence. Thus, a positive bacterium obtained by successfully transforming the recombinant plasmid in which the promoter sequence of SgTPS5, ProTPS5, was inserted into the expression vector pCambia1301 (FIG. 11) into prokaryotic cells was named Top10-ProSgTPS5, and a positive bacterium in which the recombinant plasmid in which the promoter sequence of SgTPS5, ProTPS5, was inserted into the expression vector pCambia1301, was successfully transformed into Agrobacterium cells by freeze-thaw method was named 4404-ProSgTPS LBA 5.

Arabidopsis plants were transformed by Agrobacterium-mediated method. The transformation method comprises the following steps: a single colony of Agrobacterium containing the expression vector of LBA4404-ProSgTPS5 was picked and inoculated into a tube, shaken at 28 ℃ and 200 rmp. Transferring to a triangular flask containing 50mL of LB liquid culture medium in the evening of the day, and shaking the bacteria at 28 ℃ overnight. Transferring into 250mL LB liquid culture medium the next day, shaking to noon, transferring into centrifuge tube, and adding H ₂ O balance, and centrifugation at 5000rmp for 5min at 25 ℃. The supernatant was discarded, 50mL of the conversion solution was added to the precipitate, and the cells were suspended in a shaker for 5 min. After dispersion, 250mL of the transformation solution was added and OD was measured ₆₀₀ About 0.8, thus obtaining the transformed bacterium liquid. After most plants are bolting, cutting off the whole main bolt at the base part of the inflorescence, removing the top advantages, growing 4-6 new side bolts at the axillary bud part after about 1 week, and carrying out transformation when the side bolts form buds and partially bloom or form 1-2 pod. And (3) soaking the wild plant inflorescence in the transformed bacterium liquid for 20 seconds, wrapping by using a preservative film, and storing in a dark place. And (5) inoculating the membrane after the night, and normally maintaining.

Example 7 expression specificity of the SgTPS5 promoter in plants

The transgenic T0 generation seeds harvested in example 6 were stored in a refrigerator at 4 ℃ for about 1 week. A screening medium was prepared. And (3) according to the plant resistance in the constructed vector, preparing an MS culture medium added with screening pressure, wherein the kanamycin screening pressure is 50 mg/L. Taking a proper amount of transgenic T0 generation seeds, putting the transgenic T0 generation seeds into a 1.5ml centrifuge tube, sterilizing for 5min by using 75% alcohol, and washing for 5 times by using sterile water. In an ultraclean bench, the sterilized seeds were spread on the prepared MS medium with added screening pressure, and dispersed uniformly in 0.05% agarose water. Air-drying, and sealing with parafilm. And placing the flat plate fully paved with the seeds under the conditions of illumination of 16L/8D and temperature of 22-24 ℃ to germinate the seeds. Transplanting after the first true leaves of the seedling are unfolded and rooted. Transplanting the seedling with true leaf and root to seedling soil mixed with grass carbon, vermiculite and pearlite.

And screening the harvested transgenic T2 generation seeds by the same method, and carrying out GUS staining observation on screened positive plants. Placing the prepared arabidopsis thaliana plant into a cell culture dish, adding a staining solution to immerse the test material, sealing a cover, vacuumizing, incubating for 12h in an incubator at 37 ℃ until blue appears, and washing in water once. And transferring the infected test material into 70% ethanol for decolorization for 2-3 times, removing chlorophyll, replacing decolorization liquid every 1 hour until the negative control material is white, and observing and taking a picture by using a microscope. The results are shown in FIG. 12. The results show that the ProSgTPS5 promoter can drive GUS gene to express in seedling leaf, leaf surface glandular hair, root vascular tissue, petal and pod bottom, but not in reproductive organs including pollen, stamen and pistil. Compared with 35S promoter (Holtorf S, Apel K, Bohlmann H.Complex of secondary consistent and index molecules for the overexpression of genes in Arabidopsis thaliana. plant Mol biol.1995 Nov; 29(4):637-46.), the promoter can be used for mass expression of a target gene in plant vegetative tissue parts such as leaves and glandular hairs without driving the gene to be expressed in seeds, and can be used for in vivo precise production of important secondary metabolites of plants because of influence on plant propagation due to mass production of heterologous metabolites in reproductive organs.

The embodiments in the present description are described in a progressive manner, each embodiment focuses on differences from other embodiments, and the same and similar parts among the embodiments are referred to each other.

The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Sequence listing

<110> tropical forestry research institute of China institute of forestry science

<120> SgTPS5 gene promoter and application thereof

<160> 13

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2033

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ctgaatatta aattagtaca attttaatct ctacttattt aaattttctc aaaattgcat 60

ttaagtttac gttttatatt tggcgtgttt cccatggaaa gataagaact tttagcgtta 120

cttttatact aaaattcaat tctactccca tataaatatg gttaattata ttatttttta 180

acataataat ctaatttgat aaaaaaatat ttattttata gaaaataaat tatttttgaa 240

aaaactcaaa gtactaaatt aaaaaaatac actttacaac atttattatt tatataaaaa 300

taacacaaaa ttttcaatgc ataaggccgg aattcttttc tcgctaaaaa tttctatatt 360

actaataaaa tgggagtatg aaagctgcaa aattttggcc tattagtggt tcacctggaa 420

tgtcaaattt ttacactgct tctgtagtct tcgctttctt ttctggataa gaaaatttca 480

ccgacgggcg cggagggtag gactcccttt tcggggggac caaaaaattt attaaaactt 540

tttttagtat ggtaggaaat tagaatcatt ataaaataag ttgaaccaaa tttttatttg 600

tccttattaa attcacaaat ttaggtttaa gtttgactat taaacaaatc taattgtgct 660

taaacaaagt ttaacatatt taatgggtta ttttcaataa aataacaatt taaaaaaatg 720

gaaaataaat ttttttttaa acacacttct ctctctcttt ttctctcttt tattttttag 780

tttgatttct ttctattttt cttgtttttc caaaaataag aaaacacaat gatacttagg 840

aaatgtttga tagtattaaa atgtttagca ctagatttta attgttgaaa ccatttaagt 900

actaaggttt catttgtttt tagaaaacaa tttccataaa aaaactcatt ttttaatata 960

tgagttaagg agtatcatct atttttacat attgtgatta aaataaggac aaaaattagg 1020

tatagcttct tttgtatttt ttataaggtt ttctattcaa attataatat gtgtattaat 1080

tattgtatta taattaaaat attaataatt attacaatca tcaaattaaa atttttaata 1140

gttaataaaa taattaatat acatattata ttctaaatgg agaattttac ggcaaatact 1200

taaggaatat tacttaagtt ttatccttaa aattgtaatt aatagaacta tagtagtggg 1260

ggaaaacaat tccttctttg aaaaaaagaa ttatctttca taaaattcat tatatttaat 1320

attgaataca ttaactattt tccacatctt gatctataga aaatattttt tttaccaaaa 1380

taaatgaagt ctaaatttat agtgtttgaa tagttttgta ttgaattacg ttaatagttt 1440

gaaattttta ttaacgaata ttgaaaattt ataaaatttc aaaattatct ttgattatga 1500

ttttataaat tatacacatc aaatctttaa atgttatgat atatattata tatttaatat 1560

tcaattatta ttctaacaat aaagataata tttaacatat ttgtccaata aaatctctct 1620

aaaataagag aagttgctaa atgttattaa acaaatttaa taaaatttca tttaatttaa 1680

tatttatttt taataaatta tataaatagg atctaattct aaatttgaac ctatccattt 1740

aactattaac atccctgctc attataatat ctcatatatt tattttattt tctagatggg 1800

gctaaattaa taaaagaaat cacaaaaata aaattacata tatattttat ttttttttga 1860

aaatttatgg ggcccatggc tccctaataa tgaggaggct gcgtccctgt tcaccgagtt 1920

aaactataaa tgccaagtaa gcccaagtta tctctcagct caaaacccgt ccattcatcc 1980

aatttcatag cactctttct cataagcaga agtaacggaa aaaggcgaag aat 2033

<210> 2

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ggggtaccat gtcagttgca gcgttag 27

<210> 3

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gctctagatc atgcgacagg atttatgagc 30

<210> 4

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cgccagggtt ttcccagtca cgac 24

<210> 5

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

agcggataac aatttcacac agga 24

<210> 6

<211> 1674

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

atgtcagttg cagcgttagc aattgctact tccacacctt catcttttgt tcctcgtcgt 60

tctgcaaatt atcatcctag cgtttgggga gaccatttca ttaaatatgc ttctcagcct 120

ttggaagcag atgaggaaat ggaggaccat attgaaacat tgaaagaaat tgtgaggaaa 180

atgcttgtcc ccgcaactga taggccttta acaaaagtta agttgattga ttcaatccaa 240

cgtttgggtg tgtactatca ttttgaaagt gagatagatg aagtgttgtg tcaaattcag 300

aagaattatg taaaggatgg tctaataact ctcaatgagg atctccatgc tttggctctt 360

ctctttaggt tactaaggca gcaaggatat cacgtttcac ctgatgtgtt caacaagttc 420

aaagatgagc aaggaaaaat cagtgaaaca attaccaatg atgttgaagg aatgctaagc 480

ttatatgaag ctgcacatct caggatacat ggagaagaca tattagatga agcccttgat 540

tttacttcca ctcatcttaa gtttttaacc acccaattga gtgattctta tgccggaaaa 600

gtcattcaaa gcttaaagtg gcctctgcgg aggaggcttc ctaggctgga gtcttggcac 660

tacttttcta cttaccggga agatccttcg cacaatgaaa ctttactgga ctttgcaaag 720

tcggatttca atagggtgca aaagctacac cagagggaaa ttggaaacct ctcaaagtgg 780

tggaaggatt tagatttcgc tacgaaacta cctttcgcgc gcaataggtt ggtggaggct 840

tacttttgga taatgggagt ctatttcgag ccttcctact cacttgctag aaggataatg 900

accaaagtga tatcattgac atcaattctt gatgatacat acgatgtgta cggtacactt 960

gatgaactag aacttctcac tgaagcgatc gacaagtggg acatctcttg catggatttt 1020

cttccagagt acatgaagct tatttatcaa cagctcttgg atgtttatga tgaaattgag 1080

cgagagacag caaaagaagg aagagctttc tgtgtaaatt acggaaaaga agaaatgaga 1140

aaagtgactc gagcttactt ggctgaagcc aaatggttcc acaacaacta tacaccaaca 1200

ttggaggagt atatgaaggt cgcacaagta tcttcgggtt atcgtatgct tacaacagta 1260

tccttcattg gcatgggatc catagctact gaggaggcct tcaaatgggt agccaaagat 1320

ccgaaaattg ttaaaggttc cttagttatt tgcagactca tggacgacat tgtttccaat 1380

aagcttgagc aagagagagg gcatgttgtt tcagctctgg aatgctacat gaagcaacat 1440

ggtacaaccg aggaagaaac cattgttgaa tttcgcagac gagttgaaaa tgcatggaag 1500

gatataaacg aggattgcct tcaacctttc gaagtggcaa agcctctgct gatgcgaagt 1560

ctgaacatgt cgcgcgtaat tcatcttctt tatacggatt atgattgcta cactcactct 1620

gctggaaata caaagaagaa cattgaagcc ttgctcataa atcctgtcgc atga 1674

<210> 7

<211> 557

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 7

Met Ser Val Ala Ala Leu Ala Ile Ala Thr Ser Thr Pro Ser Ser Phe

1 5 10 15

Val Pro Arg Arg Ser Ala Asn Tyr His Pro Ser Val Trp Gly Asp His

20 25 30

Phe Ile Lys Tyr Ala Ser Gln Pro Leu Glu Ala Asp Glu Glu Met Glu

35 40 45

Asp His Ile Glu Thr Leu Lys Glu Ile Val Arg Lys Met Leu Val Pro

50 55 60

Ala Thr Asp Arg Pro Leu Thr Lys Val Lys Leu Ile Asp Ser Ile Gln

65 70 75 80

Arg Leu Gly Val Tyr Tyr His Phe Glu Ser Glu Ile Asp Glu Val Leu

85 90 95

Cys Gln Ile Gln Lys Asn Tyr Val Lys Asp Gly Leu Ile Thr Leu Asn

100 105 110

Glu Asp Leu His Ala Leu Ala Leu Leu Phe Arg Leu Leu Arg Gln Gln

115 120 125

Gly Tyr His Val Ser Pro Asp Val Phe Asn Lys Phe Lys Asp Glu Gln

130 135 140

Gly Lys Ile Ser Glu Thr Ile Thr Asn Asp Val Glu Gly Met Leu Ser

145 150 155 160

Leu Tyr Glu Ala Ala His Leu Arg Ile His Gly Glu Asp Ile Leu Asp

165 170 175

Glu Ala Leu Asp Phe Thr Ser Thr His Leu Lys Phe Leu Thr Thr Gln

180 185 190

Leu Ser Asp Ser Tyr Ala Gly Lys Val Ile Gln Ser Leu Lys Trp Pro

195 200 205

Leu Arg Arg Arg Leu Pro Arg Leu Glu Ser Trp His Tyr Phe Ser Thr

210 215 220

Tyr Arg Glu Asp Pro Ser His Asn Glu Thr Leu Leu Asp Phe Ala Lys

225 230 235 240

Ser Asp Phe Asn Arg Val Gln Lys Leu His Gln Arg Glu Ile Gly Asn

245 250 255

Leu Ser Lys Trp Trp Lys Asp Leu Asp Phe Ala Thr Lys Leu Pro Phe

260 265 270

Ala Arg Asn Arg Leu Val Glu Ala Tyr Phe Trp Ile Met Gly Val Tyr

275 280 285

Phe Glu Pro Ser Tyr Ser Leu Ala Arg Arg Ile Met Thr Lys Val Ile

290 295 300

Ser Leu Thr Ser Ile Leu Asp Asp Thr Tyr Asp Val Tyr Gly Thr Leu

305 310 315 320

Asp Glu Leu Glu Leu Leu Thr Glu Ala Ile Asp Lys Trp Asp Ile Ser

325 330 335

Cys Met Asp Phe Leu Pro Glu Tyr Met Lys Leu Ile Tyr Gln Gln Leu

340 345 350

Leu Asp Val Tyr Asp Glu Ile Glu Arg Glu Thr Ala Lys Glu Gly Arg

355 360 365

Ala Phe Cys Val Asn Tyr Gly Lys Glu Glu Met Arg Lys Val Thr Arg

370 375 380

Ala Tyr Leu Ala Glu Ala Lys Trp Phe His Asn Asn Tyr Thr Pro Thr

385 390 395 400

Leu Glu Glu Tyr Met Lys Val Ala Gln Val Ser Ser Gly Tyr Arg Met

405 410 415

Leu Thr Thr Val Ser Phe Ile Gly Met Gly Ser Ile Ala Thr Glu Glu

420 425 430

Ala Phe Lys Trp Val Ala Lys Asp Pro Lys Ile Val Lys Gly Ser Leu

435 440 445

Val Ile Cys Arg Leu Met Asp Asp Ile Val Ser Asn Lys Leu Glu Gln

450 455 460

Glu Arg Gly His Val Val Ser Ala Leu Glu Cys Tyr Met Lys Gln His

465 470 475 480

Gly Thr Thr Glu Glu Glu Thr Ile Val Glu Phe Arg Arg Arg Val Glu

485 490 495

Asn Ala Trp Lys Asp Ile Asn Glu Asp Cys Leu Gln Pro Phe Glu Val

500 505 510

Ala Lys Pro Leu Leu Met Arg Ser Leu Asn Met Ser Arg Val Ile His

515 520 525

Leu Leu Tyr Thr Asp Tyr Asp Cys Tyr Thr His Ser Ala Gly Asn Thr

530 535 540

Lys Lys Asn Ile Glu Ala Leu Leu Ile Asn Pro Val Ala

545 550 555

<210> 8

<211> 1674

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

atgagcgttg cggcactggc aattgcaacc agtaccccga gtagtttcgt tccgcgtcgt 60

agcgcgaatt atcatccgtc tgtctggggc gatcatttca tcaaatatgc gagtcaaccg 120

ctggaagctg acgaagaaat ggaagaccac atcgagaccc tgaaagagat cgtccgtaaa 180

atgctggttc cggcaaccga tcgtccgctg accaaagtca aactgatcga tagcatccag 240

cgtctgggcg tttattacca cttcgagagc gaaatcgacg aagtcctgtg ccagatccag 300

aaaaactacg tcaaagacgg cctgattacc ctgaacgaag atctgcacgc actggcactg 360

ctgtttcgtc tgctgcgtca acaaggttat cacgtttccc cggatgtctt caacaaattc 420

aaagacgagc agggcaaaat cagcgaaacc atcaccaacg acgtcgaagg tatgctgagt 480

ctgtacgaag cagcacatct gcgtattcac ggcgaagata tcctggacga agcactggat 540

tttaccagca cccatctgaa attcctgacc acccaactga gcgatagcta cgcaggcaaa 600

gttattcaga gcctgaaatg gccgctgcgt cgtcgtctgc cgcgtctgga aagctggcat 660

tacttcagca cctaccgcga agatccgagt cataacgaaa ccctgctgga tttcgcgaaa 720

agcgacttta accgcgtcca gaaactgcat cagcgcgaaa ttggtaacct gtccaaatgg 780

tggaaagacc tggactttgc gaccaaactg ccgtttgcac gtaaccgtct ggtcgaagcg 840

tatttctgga tcatgggcgt ctattttgaa ccgagctata gcctggcccg ccgtattatg 900

accaaagtta tcagcctgac cagtattctg gacgatacct acgacgttta cggtaccctg 960

gacgaactgg aactgctgac cgaagctatc gacaaatggg acatcagctg catggatttt 1020

ctgccggagt acatgaaact gatctaccag cagctgctgg acgtttacga cgaaatcgaa 1080

cgcgaaaccg cgaaagaagg tcgcgcgttt tgcgttaatt acggcaaaga agaaatgcgc 1140

aaagttaccc gcgcatatct ggccgaagcg aaatggttcc acaacaacta taccccgacc 1200

ctggaagaat atatgaaagt tgcgcaggtt agctctggct atcgtatgct gaccaccgtt 1260

tccttcattg gcatgggtag cattgcgacc gaagaagcct tcaaatgggt cgcgaaagac 1320

ccgaaaatcg tcaaaggtag tctggttatt tgccgtctga tggacgacat cgtctccaac 1380

aaactggagc aggaacgcgg tcacgttgtt tctgcactgg aatgttacat gaaacagcac 1440

ggcaccaccg aagaagaaac cattgtcgaa tttcgccgtc gcgttgaaaa cgcctggaaa 1500

gacatcaacg aggactgtct gcagccgttt gaagttgcta aaccgctgct gatgcgttct 1560

ctgaacatga gtcgcgttat ccacctgctg tacaccgatt acgactgtta tacccatagc 1620

gcgggcaaca ccaaaaagaa catcgaggcg ctgctgatca atccggttgc ataa 1674

<210> 9

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

aaaagatgaa ggtgtggaag tagc 24

<210> 10

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gagagataac ttgggcttct tggc 24

<210> 11

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gaaatattat aatgagcagg gatg 24

<210> 12

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

tcctctagag tcgacctgca ggtttacgtt ttatatttgg c 41

<210> 13

<211> 43

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

ttaccctcag atctaccatg gattcttcgc ctttttccgt tac 43

Claims

1. A promoter is characterized by being capable of driving the expression of a target gene in a plant vegetative tissue part, and the nucleotide sequence of the promoter is shown as SEQ ID NO.1 and is the promoter of SgTPS5 gene.

2. An expression vector comprising the promoter of claim 1.

3. Use of the promoter of claim 1 for genetic engineering of plant vegetative tissue site expression and production of secondary metabolites.

4. The use of claim 3, wherein the vegetative tissue parts of plants are leaves, glandular hairs and roots.

5. The use of claim 3, wherein said secondary metabolite is a terpenoid.