CN112501130B - Preparation method and application of monoclonal antibody against tilapia T lymphocyte surface membrane protein CD3 epsilon - Google Patents

Abstract

The invention discloses a preparation method and application of a monoclonal antibody against tilapia T lymphocyte surface membrane protein CD3 epsilon. The hybridoma cell strain 2B2D7 is preserved in China Center for Type Culture Collection (CCTCC) in 20 days 8 months in 2020, with the preservation number of CCTCC NO: C2020134. the invention can specifically sort out the CD3 epsilon of the tilapia ⁺ The T lymphocyte population provides an important immunological tool for the research of the adaptive immune mechanism of tilapia.

Description

Preparation method and application of monoclonal antibody against tilapia T lymphocyte surface membrane protein CD3 epsilon

Technical Field

The invention belongs to the field of fish immunology, and particularly relates to a hybridoma cell strain 2B2D7 secreting monoclonal antibody against tilapia T lymphocyte surface membrane protein CD3 epsilon, a monoclonal antibody, and a preparation method and application thereof.

Background

T lymphocytes, which are the main performers of adaptive immune response, exert functions such as cellular immunity and immunoregulation, and eliminate infection of various pathogenic microorganisms such as bacteria and viruses in vivo. The T cell surface glycoprotein CD3 is a differentiation antigen marked by mature T cells and plays an important role in the aspects of development, activation, immune function execution and the like of the T cells. CD3 has five main chains of gamma, delta, epsilon, zeta and eta, wherein the epsilon chain of CD3 mainly receives antigen stimulation signals and mediates the transmission of immune signals. CD3 epsilon comprises 1 Ig-like (immunoglobulin-like) domain and 1 ITAM domain and is capable of forming a TCR-CD3 complex with CD3 gamma, CD3 delta, and CD3 zeta and T cell receptor alpha/beta and gamma/delta heterodimers. The CD3 subunit of the TCR-CD3 complex comprises two defined signaling domains, a proline-rich sequence and Immune Tyrosine Activating Motifs (ITAMs). Upon receiving antigenic stimulation, as co-receptors for TCR, tyrosine residues in the ITAMs of the CD3 epsilon complex are phosphorylated by downstream LCK and recruit ZAP70 to bind to CD3 epsilon, the T cell activating adaptor LAT is phosphorylated, recruiting multiple adaptors and effector molecules (e.g., SLP76, PLC γ 1, etc.) to form a LAT signaling complex, thereby mediating activation of downstream signaling pathways, including mTOR, caM, MAPK, and NF- κ B signaling pathways, among others.

In teleost, the CD3 epsilon molecule has already been cloned. Teleost CD3 epsilon also contains an Ig domain and ITAM activation motif, suggesting the potential for our teleost CD3 epsilon to be a specific molecular marker for T cells and a determinant in adaptive immune responses. However, the lack of antibody tools against teleost makes the study of teleost T cell immune mechanisms slow. Due to the complexity of transmembrane proteins, a large amount of proteins which keep complete natural structures and original functions are still difficult to express, so that the traditional monoclonal antibody preparation method is difficult to apply to the preparation process of the T lymphocyte surface membrane protein CD3 epsilon monoclonal antibody.

In recent years, tilapia (including nile tilapia Oreochromis niloticus) as an important freshwater aquaculture economic fish has increasingly significant importance in the aquaculture industry of China and even the world, however, with the continuous expansion of the aquaculture scale, the harm caused by diseases is more and more prominent, and the development of the tilapia aquaculture industry in China is seriously influenced. Research on the immune mechanism of tilapia is imminent. Therefore, the preparation of the Tilapia nilotica CD3 epsilon monoclonal antibody, the exploration of the T cell mediated adaptive immune response mechanism, and the preparation method has very important practical significance for fish disease prevention and treatment, vaccine development and filling in research on the adaptive immune evolution of teleost.

Disclosure of Invention

Aiming at the defects in the prior art, the invention provides a hybridoma cell strain 2B2D7 capable of stably secreting monoclonal antibodies against tilapia CD3 epsilon, a monoclonal antibody, a preparation method and application thereof, so that the monoclonal antibody can specifically identify tilapia T lymphocyte populations, and an important immunological tool is provided for research on adaptive immune mechanisms of teleost fish.

The technical scheme provided by the invention for solving the technical problems is as follows:

on the one hand, the hybridoma cell strain 2B2D7 secreting monoclonal antibodies against tilapia T lymphocyte surface membrane protein CD3 epsilon is provided, and the hybridoma cell strain 2B2D7 is preserved in China Center for Type Culture Collection (CCTCC) in 20 months at 8 and 2020 with the preservation number of CCTCC NO: C2020134.

also provides a preparation method of the hybridoma cell strain 2B2D7, which comprises the following steps:

infecting the cells by retrovirus containing tilapia T lymphocyte surface membrane protein CD3 epsilon gene;

taking the infected cells as antigens to carry out animal immunization;

and (3) after animal immunization, performing cell fusion, cell screening and cloning to obtain the hybridoma cell strain 2B2D7.

Preferably, the process for preparing the retrovirus containing the tilapia T lymphocyte surface membrane protein CD3 epsilon gene comprises the following steps: and (3) transfecting the cells by adopting a plasmid containing tilapia T lymphocyte surface membrane protein CD3 epsilon gene to obtain a retrovirus-containing supernatant.

Preferably, the cells comprise BOSC cells.

Preferably, the NIH/3T3 cell is transfected by a virus containing a CD3 epsilon gene of a surface membrane protein of a T lymphocyte of nile tilapia.

Also provides a monoclonal antibody of tilapia T lymphocyte surface membrane protein CD3 epsilon secreted by the hybridoma cell strain 2B2D7.

Also provides a preparation method of the monoclonal antibody, which comprises the following steps:

preparing ascites: taking a mouse, and injecting sterile paraffin oil into the abdominal cavity;

taking the hybridoma cell strain 2B2D7 as defined in claim 1 for resuspension, and then carrying out intraperitoneal injection on the mouse;

killing the mice, collecting ascites, centrifuging, subpackaging and storing;

and purifying ascites to obtain the monoclonal antibody for resisting tilapia T lymphocyte surface membrane protein CD3 epsilon.

Also provides an application of the monoclonal antibody in research on adaptive immune response of teleost.

Also provides an application of the monoclonal antibody in specifically recognizing the CD3 epsilon protein of teleost.

Also provides an application of the monoclonal antibody in activating T lymphocytes of teleost.

Also provides an application of the monoclonal antibody in preparing a fish disease prevention and treatment reagent/medicament.

Preferably, the fish disease control agent/drug comprises a fish disease control vaccine.

The invention adopts a retrovirus method for the first time to insert the complete nile tilapia CD3 epsilon gene fragment into a mouse homologous cell line NIH/3T3, so that the cell line can express nile tilapia CD3 epsilon protein on the cell surface, and the protein reduces the active nile tilapia CD3 epsilon protein in a natural state to the maximum extent; and a screening system combining flow cytometry, indirect immunofluorescence and semi-quantification is established, so that the monoclonal antibody for resisting the Nile tilapia CD3 epsilon is successfully prepared, the specificity of the monoclonal antibody is fully ensured, and an important tool is provided for the follow-up research of the action and mechanism of T lymphocytes in the adaptive immune response of teleost fish.

Drawings

FIG. 1 is a graph showing the effects of infection of NIH/3T3 cells under fluorescence microscopy, flow analysis and immunofluorescence assay;

FIG. 2 is a flow analysis result for detecting specific binding of fused cell culture supernatant in 2B2D7 wells and spleen leukocytes of Nile tilapia;

FIG. 3 is a diagram showing the result of specific binding of monoclonal antibody and CD3 epsilon protein on nile tilapia lymphocyte under a fluorescence microscope;

FIG. 4 shows CD 3. Epsilon ⁺ Cell population and CD3 epsilon ^- Cell-specific expression of various populations in a cell populationAgarose electrophoresis result picture of gene;

FIG. 5 shows CD 3. Epsilon. Before and after infection ⁺ Flow analysis results of T lymphocytes;

FIG. 6 shows CD3 epsilon in spleen leukocytes, peripheral blood leukocytes, intestinal leukocytes, and thymus ⁺ Flow analysis results of the cells;

FIG. 7 shows the phosphorylation and total protein expression levels of S6, NF-. Kappa. B p65 and Erk1/2 after in vitro stimulation of T lymphocytes by monoclonal antibodies.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is described in further detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and do not limit the invention.

Example 1:

the embodiment provides a hybridoma cell strain 2B2D7 secreting monoclonal antibodies against tilapia T lymphocyte surface membrane protein CD3 epsilon, wherein the hybridoma cell strain 2B2D7 is preserved in China Center for Type Culture Collection (CCTCC) in 2020, 8 and 20 months, and the preservation number is CCTCC NO: C2020134. and wherein said tilapia is nile tilapia (Oreochromis niloticus).

Further, the preparation method of the hybridoma cell strain 2B2D7 comprises the following steps:

cloning a Nile tilapia T lymphocyte surface membrane protein CD3 epsilon gene:

(1) extracting total RNA of the leukocyte of the tilapia nilotica, and selecting qualified RNA for reverse transcription to synthesize a cDNA template for later use;

(2) designing a primer pair set for PCR amplification, the primer pair set comprising: a forward primer F1 and a reverse primer R1, wherein the sequence of the forward primer F1 is CCGAAGATCTGCCACCATGCTCAGCATGGGTGTC (namely a nucleotide sequence shown in SEQ ID NO. 1), the sequence of the reverse primer R1 is CGGAATTCCTATCCCATCCTGTTGACC (namely a nucleotide sequence shown in SEQ ID NO. 2), an amplification reaction system is prepared, an amplification product is obtained by amplification according to a program, glue recovery is carried out on the amplification product, and the obtained recovery product is the separated Nile tilapia CD3 epsilon gene (hereinafter referred to as 'CD 3 epsilon gene'); "isolated" means that the gene has been isolated from the DNA sequences flanking it in its native state, and that the gene has been separated from components of the nucleic acid with which it is associated in its native state, and from proteins with which it is associated in the cell;

in this step, the amplification reaction system is 30-50. Mu.L comprising, by volume, 4-5% of the forward primer F1,4-5% of the reverse primer R1, 45-50% of 2 × PrimerSTAR DNA Polymerase,4-5% of the cDNA template, the remainder being dH2O;

and (3) amplification procedure: 95-98 ℃, 10-12s,55-58 ℃, 10-15s,70-75 ℃, 8-10s,32-40 cycles; adding 1 mu of LrTaq, and preserving heat for 20min at 72 ℃;

the sequence of the amplified Nile tilapia CD3 epsilon gene fragment is shown as SEQ ID NO.3, and the homology of the sequence and the Oreochromyis aureus CD3 epsilon sequence is 90.17 percent, the homology of the sequence and the Primulinachromys alburni urtoni is 87.59 percent, and the homology of the sequence and the Primulus zebrinia Maylandia zebra is 87.43 percent.

Construction of a Nile tilapia CD3 epsilon gene expression vector:

(1) mixing 4.5 μ L of the recovered product with a carrier linking system (0.5 μ L of PMD19T vector,5 μ L of solution I), and linking at 12-18 deg.C for 10-15h to obtain a first linking system;

(2) adding 10. Mu.L of the first ligation system to 50. Mu.L of DH 5. Alpha. Competent cells, ice-transforming for 30min, water-bathing for 45s at 42 ℃ and placing on ice for 2min;

(3) adding 200-400 μ L of fresh LB liquid culture medium, and shake culturing at 37 deg.C for 1h; coating and culturing 50-200 μ L of suspension in LB solid culture medium containing ampicillin resistance, and culturing overnight at 37 deg.C;

(4) after selecting positive monoclonal bacteria for sequencing, extracting a PMD19T plasmid (namely a CD3 epsilon-PMD 19T plasmid) containing a CD3 epsilon gene, and simultaneously adding 1 mu g of each of the CD3 epsilon-PMD 19T plasmid and a pMIGR1 empty plasmid into a double enzyme digestion system (containing 1 mu LBgl II, 1 mu LEcor I, 4 mu L3.1buffer, dH) ₂ Supplementing O to 40 mu L), carrying out enzyme digestion at 37 ℃ for 4h, and correspondingly obtaining two enzyme digestion products;

(5) mixing the two enzyme digestion products with 4.5 mu L of each enzyme digestion product and a DNA connection system (1 mu L T DNA Ligase,1 mu L T DNA Ligase Buffer), and connecting for 10-12h at 15-18 ℃ to obtain a second connection system;

(6) adding the second connection system into 50-100 μ L DH5 α competent cells, performing ice transformation for 30min, performing heat shock in 42 deg.C water bath for 40-45s, standing on ice for 2min, adding 300-500 μ L fresh LB culture medium, and performing shake culture for 1h;

(7) coating and culturing 50-200 μ L of bacterial liquid in LB solid culture medium containing ampicillin resistance, culturing overnight, and selecting positive monoclonal strain the next day;

(8) the positive monoclonal strains were subjected to scale-up culture and plasmid extraction to obtain a retroviral expression vector containing the CD 3. Epsilon. Gene (i.e., the pMIGR1-CD 3. Epsilon. Plasmid).

Retrovirus preparation:

(1) taking out the frozen BOSC cells from the liquid nitrogen, thawing, and then performing cell recovery and cell passage to obtain BOSC passage cells; the number of passages of the BOSC cells is 1-3;

(2) digesting BOSC passage cells at 37 ℃ by taking 500 mu L of pancreatin, re-suspending the cells by using 5mL of DMEM medium, centrifuging for 3min at 1000rpm, discarding the supernatant to obtain digested BOSC cell precipitates, re-suspending and counting the digested BOSC cell precipitates by using DMEM medium, and inoculating 2 × 10 cells on each 60mm culture plate (dish) ⁶ -2.5×10 ⁶ (ii) digesting the BOSC cells to complete a cell plate;

(3) when the confluency of BOSC cells cultured on the culture plate (dish) reached about 75-85%, the culture supernatant was discarded, 3mL of DMEM medium (1% double antibody, 10% FBS) containing 25. Mu.M chloroquine was slowly added, and the mixture was put in an incubator at 37 ℃;

(4) to the EP tube were added 3. Mu.g of retroviral expression vector (i.e., pMIGR1-CD 3. Epsilon. Plasmid), 1.5. Mu.g of pCL-ECO plasmid, and 30. Mu.L of 2.5M CaCl ₂ Supplementing the volume to 500 mu L with sterilized water to obtain a mixed system; then, slowly blowing bubbles into the mixed system in the EP tube by using a glass tube, and slowly dropwise adding 500 mu L of 2 XHEBS buffer solution in the process of blowing the bubbles to obtain a transfection system;

(5) uniformly mixing 1mL of transfection system, dropwise and uniformly adding the transfection system into a cell culture dish, and gently shaking the transfection system uniformly to perform transfection;

(6) the supernatant was discarded after 8h of transfection, 3mL of DMEM medium (1% double antibody, 10% fbs) was slowly added, and the DMEM medium (1% double antibody, 10% fbs) was periodically replaced 1-2 times;

(7) the supernatant was collected after 12h of the last replacement of DMEM medium (1% double antibody, 10% FBS), centrifuged at 1200rpm for 5-10min, the retrovirus-containing supernatant (i.e., retrovirus suspension) was collected and stored at-80 ℃ in aliquots.

NIH/3T3 cell infection:

(1) taking out the frozen NIH/3T3 cells from liquid nitrogen, thawing, and performing cell recovery and cell passage to obtain NIH/3T3 passage cells; the number of passages of the NIH/3T3 cells is 1-3;

(2) collecting 500 μ L pancreatin, digesting NIH/3T3 passage cells at 37 deg.C, re-suspending the cells with 5mL DMEM medium, centrifuging at 1000rpm for 3min, discarding the supernatant to obtain digested NIH/3T3 cell precipitate, re-suspending and counting the digested NIH/3T3 cell precipitate with DMEM medium, and inoculating 5.5 × 10 cells on each 100mm culture plate (dish) ⁵ -6×10 ⁵ Digested NIH/3T3 cells to complete a cell plate;

(3) when the confluency of NIH/3T3 cells cultured on the culture plate (dish) reached about 45-55%, the culture supernatant was discarded, and 5-10mL of DMEM medium (1% double antibody, 10% FBS) containing 5. Mu.M polybrene was slowly added;

(4) adding 550-650 mu L of retrovirus suspension into each culture plate, gently mixing, and culturing in an incubator at 37 ℃ to complete NIH/3T3 cell infection;

(5) 4h after retroviral infection, 1-2mL of polybrene (polybrene) -free DMEM medium (1% double antibody, 10% FBS) was added, mixed to terminate polybrene (polybrene) action, and periodically replaced with polybrene (polybrene) -free DMEM medium (1% double antibody, 10% FBS) 1-2 times;

(6) centrifuging after 48h of the last replacement of the DMEM medium (1% double antibody, 10% fbs) without polybrene (polybrene), collecting the cell pellet, digesting the cell pellet with 500 μ L of pancreatin at 37 ℃ for 1min; the cells were resuspended in 5mL DMEM medium, centrifuged at 1000rpm for 3min, the supernatant was discarded, the resulting cell pellet was resuspended in 10mL PBS, centrifuged at 1000rpm for 3min, repeated once, and finally the cells were resuspended in 200. Mu.L PBS to obtain transfected NIH/3T3 cells.

As shown in fig. 1, the transfection effect of transfected cells was detected by fluorescence microscopy, flow analysis and immunofluorescence respectively, wherein the transfected cells showed green positive reaction under the fluorescence microscope, indicating that transfected NIH/3T3 cells can express nile tilapia CD3 epsilon protein on the cell surface;

animal immunization:

using the transfected NIH/3T3 cells as antigen, and immunizing animals (including mice) by intraperitoneal injection, wherein the immunization dose is 10 ⁷ -2×10 ⁷ Cell/animal, immunization was performed in 4 divided portions, with 2 weeks for the first 2 immunizations and 1 week for the last 3 immunizations.

Cell fusion:

(1) after the animal immunization is finished for 3 days, removing cervical vertebrae to kill the animal, taking out thymus and spleen, and respectively preparing thymocyte suspension and spleen cell suspension;

(2) recovering SP2 cells one week before fusion, and subculturing the SP2 cells with proper density into a culture bottle one day before fusion; blowing off SP2 cells with 10mL of RPMI-1640 (-) during fusion; uniformly mixing the spleen cell suspension and the SP2 spleen cell suspension in a centrifugal tube according to the volume ratio of 10;

(3) placing the tube bottom of the centrifuge tube filled with the two cell precipitates which are mixed into paste in a water-containing beaker preheated in a water bath at 37 ℃ for heat preservation; sucking l mL of PEG solution preheated to 37 ℃, uniformly, slowly and completely dripping the PEG solution into the centrifuge tube within 90s, and then standing the PEG solution in a water bath for 90s;

(4) continuously dripping 10-15mL of RPMI-1640 (-) solution preheated to 37 ℃ into the centrifugal tube for 3-5 times to dilute the PEG to lose the effect; then adding RPMI1640 (-) liquid to 30-50mL, centrifuging at 800rpm for 5-8min, and discarding the supernatant to obtain cell precipitate;

(5) resuspending 3ml of the cell culture solution from the cell pellet obtained in the previous step (i.e., (4)) to obtain a cell resuspension solution, and freezing the cell resuspension solution; adding thymocyte suspension into the residual cell suspension, uniformly mixing to obtain a fused cell system, and dropwise adding the fused cell system into the wells of a cell culture well plate (such as a 96 well plate) according to 100 mu L/well;

(6) placing the well plate at 37 ℃ CO ₂ Culturing in an incubator with the concentration of 5%, observing the growth condition of cells under an inverted microscope in the culture process, and centrifugally collecting fused cell supernatant for later use when the fused cells grow over a 1/3 pore plate;

observation under an inverted microscope shows that the fused cells have good growth state, vigorous division, full and round appearance, strong refractivity, uniform cell size, good adherence and infinite division and proliferation capacity;

fusion cell screening and cloning:

detecting and screening the fusion cells by adopting flow cytometry, which specifically comprises the following steps:

(1) taking spleen of healthy Nile tilapia, cleaning, grinding, sieving with 200-mesh bolting silk, centrifuging at 2000rpm for 5min, discarding supernatant, obtaining cell sediment, re-suspending the obtained cell sediment by using L15 culture medium, adding the cell sediment to percoll separation liquid (4 mL 52 percoll +4mL 34 percent percoll), centrifuging at 500g and 23 ℃ for 35min, taking middle white annular layer cells, and cleaning by using L15 culture medium to obtain white blood cells;

(2) resuspending the leukocytes with FACS Buffer (PBS, 2% FBS) to obtain leukocyte suspension, adding leukocyte suspension into the wells of the cell culture well plate at a ratio of 100 μ L/well, culturing for a predetermined time, collecting leukocyte suspension, centrifuging at 2500rpm for 3min, and discarding the supernatant to obtain leukocyte precipitate;

(3) adding the collected fused cell supernatant into the leukocyte sediment as a primary antibody system, incubating for 30min at room temperature, and adding the SP2 cell culture supernatant into a control hole; centrifuging the incubated primary antibody system at 2500rpm for 3min, discarding the supernatant to obtain cell precipitate, and washing the cell precipitate twice with FACS Buffer;

(4) adding a fluorescent secondary antibody Goat Anti-Mouse IgG H & L (Alexa Fluor 647) (1: 2000) to wells of a cell culture well plate at a rate of 50. Mu.L/well, and incubating for 30min in ice in the absence of light;

(5) centrifuging the secondary antibody system incubated in the step (4) at 2500rpm for 3min, and discarding the supernatant; resuspending the primary antibody cell sediment washed in the step (3) again by 200 mu LFACS Buffer, centrifuging again, and repeatedly washing the obtained cell sediment once; resuspend the cell pellet at 200 μ L FACS Buffer/well and screen out positive wells by flow cytometry;

as shown in fig. 2, the flow analysis results show that: the 2B2D 7-well cell grouping is obvious, which indicates that the fusion cell in the well can secrete antibody, and the antibody can recognize the protein on the cell surface of a certain group;

cloning the fusion cells in the positive hole, which specifically comprises the following steps:

(1) killing the mouse by removing the cervical vertebra, taking out the thymus under the aseptic condition, grinding on a 200-mesh screen, and blowing and beating by using RPMI-1640 solution to form thymocyte suspension;

(2) centrifuging the thymocyte suspension at 1000rpm for 5min, removing supernatant, and re-suspending with preheated GIT culture solution;

(3) counting the cells in the positive hole by using a blood cell counting plate, then diluting the cells by using culture solution in a 10-fold gradient manner, taking out 100 fused cells, putting the fused cells into thymocyte suspension, uniformly blowing the fused cells by using a dropper, and adding the fused cells into the holes of a cell culture pore plate such as a 96 pore plate according to 100 mu L/Kong Di; then placing CO at 37 DEG C ₂ Culturing in an incubator;

(4) collecting the supernatant after the cloned fused cells grow to 1/3 of the full pores, detecting the culture supernatant of the cells in each pore by flow cytometry, wherein the detected cells in the positive pores are hybridoma cell strains 2B2D7, and as shown in figure 2, the detection shows that the CD3 epsilon positive cell populations account for about 31.2 percent of the total number of the lymphocyte populations, which indicates that the monoclonal antibodies secreted by the hybridoma cell strains 2B2D7 can be identified and combined with the T lymphocyte populations of the nile tilapia; and freezing and storing the hybridoma cell strain 2B2D7 for later use.

Example 2:

the embodiment provides a monoclonal antibody of tilapia mossambica T lymphocyte surface membrane protein CD3 epsilon secreted by hybridoma cell strain 2B2D7 obtained in example 1, and the preparation process of the monoclonal antibody comprises the following steps:

preparing ascites: taking 10-week BALB/c mice, and injecting 500 mu L of sterile paraffin oil into the abdominal cavity of each mouse; 10 days later, the hybridoma cell line 2B2D7 with good growth state is taken, the culture medium is washed off by PBS, 300 mu L of sterile PBS is used for resuspending cells, and 2 multiplied by 10 is injected into the abdominal cavity of each mouse ⁵ (ii) individual cells; observing the immunized mouse every day, taking off the cervical vertebra to kill the immunized mouse when the abdomen of the mouse is raised and the mouse is inconvenient to move, and collecting ascites; centrifuging ascites at 2000rpm for 5min, collecting middle yellowish ascites, packaging, and storing at-80 deg.C.

Antibody purification: taking 200 mu L protein G Agarose in a 15mL centrifuge tube, washing for three times by PBS, adding 500 mu L subpackaged and preserved ascites, diluting to be 8mL by PBS, and incubating overnight at 4 ℃; after PBS washing beads for 6 times, 500 μ L of 0.1M glycine-HCl (pH 2.8) was eluted to obtain the monoclonal antibody against tilapia T lymphocyte surface membrane protein CD3 ε, which was stored at-80 ℃ after adding 1/10 volume of 1M Tris-HCl (pH 8.5) to neutralize the pH.

Example 3:

this example provides the use of the monoclonal antibody of example 2 in an adaptive immune response study in teleost.

Example 4:

this example provides the use of the monoclonal antibody described in example 2 for the specific recognition of the CD3 epsilon protein of teleost.

Example 5:

this example provides the use of the monoclonal antibody of example 2 for activating T lymphocytes in teleost fish.

Example 6:

this example provides the use of the monoclonal antibody of example 2 in the preparation of a fish disease control agent/medicament, including a fish disease control vaccine.

The indirect immunofluorescence identification of the monoclonal antibody described in example 2, comprising the steps of:

taking the spleen of healthy Nile tilapia, separating to obtain white blood cells, and resuspending the white blood cells by using 5mL of PBS; taking the resuspended white blood cells with proper density, making into cell drop tablets by a cell smear machine, and fixing for 5min by methanol; adding 100. Mu.L of 1% BSA, blocking at 37 ℃ for 1h; PBST washing twice, PBS washing once, each time for 5min; adding 100 μ L of hybridoma cell supernatant in the positive well of example 1 into the well of the well plate, incubating the control well with SP2 cell culture supernatant at 37 ℃ for 1h; PBST washing twice, PBS washing once, each time for 5min; add 100 u L Alexa Fluor 488 (1 800) fluorescent secondary antibody, 37 degrees C were incubated for 1h; PBST washing twice, PBS washing once, each time for 5min; a drop of Hoechst 33342 dye-sealed tablets was added and examined under a fluorescent microscope.

The result shows that about 1/2 of the cells show green positive reaction under a fluorescence microscope as shown in figure 3, which indicates that the hybridoma cells can secrete the monoclonal antibody which can be specifically combined with the CD3 epsilon protein on the nile tilapia lymphocyte.

Semi-quantitative identification of the monoclonal antibodies described in example 2, comprising the steps of:

taking the spleen of healthy Nile tilapia, separating to obtain white blood cells, and resuspending the white blood cells by using 5mL of L15 culture medium; adding 100 μ L leukocyte suspension into 96V-shaped pore plate, and centrifuging at 2500rpm for 3min; removing supernatant, adding hybridoma cell supernatant in the positive hole in example 1 as primary antibody, culturing supernatant with SP2 cell in control hole, and incubating at room temperature for 1h; centrifuging at 2500rpm for 3min, discarding the supernatant, resuspending the cells in 200. Mu.L of FACS Buffer (L15, 2% FBS), centrifuging again, and washing the resulting pellet once again; add 50 μ L of Goat Anti-Mouse IgG H & L (Alexa Fluor 647) (1); centrifuging at 2500rpm for 3min, discarding the supernatant, resuspending the cells in 200. Mu.L of FACS Buffer (L15, 2% FBS), centrifuging again, and washing the resulting pellet once again; sorting positive cell groups and negative cell groups, centrifuging at 2500rpm for 5min to respectively obtain positive cells and negative cells, respectively extracting total RNA and correspondingly reverse-transcribing to obtain a cDNA template; taking cDNA templates of quantitative positive cells and negative cells to respectively carry out PCR reaction, carrying out agarose gel electrophoresis on PCR products, and adjusting the beta-actin consistency of the positive cells and the negative cells.

As shown by the results of electrophoresis in FIG. 4, the positive population (i.e., CD 3. Epsilon.) ⁺ ) The expression quantity of CD3 epsilon and TCR beta genes in the monoclonal antibody is very high, the specific genes IgM and IgD of the B cells are not expressed, the negative group (namely CD3 epsilon-) does not express the CD3 epsilon gene but has very high expression of the specific gene of the B cells, which shows that the monoclonal antibody can specifically identify the CD3 epsilon protein of the teleost (such as Nile tilapia), accurately position the CD3 epsilon protein to a T lymphocyte group, and accurately sort out the CD3 epsilon positive cell group of the teleost (such as Nile tilapia).

An assay for the change in cell population of T lymphocytes following Streptococcus agalactiae infection comprising the steps of:

injecting healthy nile tilapia into abdominal cavity with the dosage of 7 multiplied by 10 ⁵ CFU/mL streptococcus agalactiae is used as an infected group, and Nile tilapia with consistent health condition is injected with PBS with the same dose to be used as a control group; separating the white blood cells of the spleens of the infected group and the control group respectively after 8 days of infection; resuspending the leukocytes in the spleens of the infected group and the control group in 2mL of FACS Buffer (PBS, 2% FBS), respectively, to obtain leukocyte suspensions of the infected group and the control group; adding 100 μ L of leukocyte suspension of infection group and control group into the hole of the pore plate, and centrifuging at 2500rpm for 3min; discarding the supernatant, adding 100 μ L of the supernatant of the fused cells collected in example 1 as a primary antibody to each well, and incubating at room temperature for 1h; centrifuging at 2500rpm for 3min, discarding the supernatant, resuspending the cells in 200. Mu.L FACS Buffer (L15, 2% FBS), centrifuging again, and washing the resulting cell pellet once again; 50 μ of Lanti-Mouse IgG Goat Anti-Mouse IgG H was added&L (Alexa Fluor 647) (1); centrifuging at 2500rpm for 3min, discarding the supernatant, resuspending the cells in 200. Mu.L of FACS Buffer (L15, 2% FBS), centrifuging again, and washing the resulting pellet once again; cells were resuspended at 200. Mu.L FACS Buffer/well and flow assayed.

As shown in FIG. 5, CD3 ε was determined 8 days after Streptococcus agalactiae infection by flow analysis ⁺ The proportion of T cells in total lymphocytes increased from 34.4% before infection to 83.7% after infection, indicating a sharp increase in the number of T lymphocytes after infection, indicating that during infection,CD3 epsilon recognized by the monoclonal antibody of example 2 ⁺ T lymphocytes are involved in adaptive immune responses and play an important role in the antibacterial immune process.

The distribution detection of T lymphocytes in various tissues of Nile tilapia comprises the following steps:

taking a healthy Nile tilapia, and taking leukocytes of peripheral blood, spleen, thymus and intestine respectively.

For peripheral blood, 2mL of an anticoagulant (15 mM sodium citrate, 450mM NaCl,0.1M glucose, 10mM EDTA, pH 7.0) was added to the drawn peripheral blood, centrifuged at 2000rpm for 5min, the supernatant was discarded, and the resulting precipitate was resuspended in 3mL of L15 medium to obtain leukocytes;

for spleen tissue, spleen leukocytes were isolated according to the method in example 1;

for intestinal tissue, first, they were well ground, cell fractions were collected by sieving with 200 mesh sieve, the unground tissue pieces were treated with 5mL of PBS (0.37 mg/mL EDTA,0.14mg, mL DTT) on ice for 30min, the PBS was washed and then continuously digested with 10mL of D-PBS (0.2 mg/mL Collagenase,5 FBS) with shaking at room temperature for 2h, cell fractions were collected, all the cell fractions were pooled, and leukocytes were separated by centrifugation on a percoll density gradient;

directly grinding thymus tissue and sieving with 200 mesh sieve silk to obtain cell suspension;

resuspending the leukocytes of each tissue in 1mL FACS buffer (PBS, 2% FBS), adding 100. Mu.L of each tissue leukocyte suspension into a 96V-type well plate, centrifuging at 2500rpm for 3min, and discarding the supernatant; adding the fusion cell supernatant collected in example 1 into corresponding holes as a primary antibody, culturing the supernatant with SP2 in a control group, and incubating at room temperature for 1h; centrifuging at 2500rpm for 3min, discarding the supernatant, resuspending the cells in 200. Mu.L of FACS Buffer (L15, 2% FBS), centrifuging again, and washing the resulting pellet once again; add 50 μ L of Goat Anti-Mouse IgG H & L (Alexa Fluor 647) (1) fluorescent secondary antibody/well and incubate on ice for 30min protected from light; centrifuging at 2500rpm for 3min, discarding the supernatant, resuspending the cells in 200. Mu.L of FACS Buffer (L15, 2% FBS), centrifuging again, and washing the resulting pellet once again; cells were resuspended at 200. Mu.L FACS Buffer/well and flow assayed.

As shown in fig. 6CD3 epsilon in spleen leukocytes, peripheral blood leukocytes, intestinal leukocytes, thymocytes ⁺ The ratios of T lymphocytes are 31.3%, 25.4%, 16.3% and 59.9%, respectively, which indicates that the CD3 epsilon positive cells recognized by the monoclonal antibody of example 2 are widely distributed in various tissues of nile tilapia and the distribution has tissue variability.

The monoclonal antibody in vitro T lymphocyte activation assay described in example 2, which specifically comprises the following steps:

separating leukocytes from spleen of healthy Nile tilapia, uniformly dividing the leukocyte precipitate into 4 parts by 2mL of D-PBS (D-PBS) heavy suspension cell precipitate, placing 500 mu L of each part into a 1.5mL centrifuge tube, and standing at 28 ℃ for 30min;4 tubes are divided into resistance, 5min, 15min and 45min respectively, resistance is not stimulated, and 1 mug/mL of the purified monoclonal antibody in the embodiment 2 is added into the other three tubes and is stimulated for 5min, 15min and 45min respectively; after the stimulation is finished, 500 mu L of precooled D-PBS is immediately added into each tube and is uniformly mixed to terminate the reaction, and the mixture is placed on ice for 1min; centrifuging at 10000rpm for 1min, discarding supernatant, adding 40 μ L NP-40 lysate (1 ‰ protease inhibitor, 1 ‰ PMSF,1% phosphorylase inhibitor) into each tube, resuspending cells, and performing ice lysis for 30min; centrifuging at 12000rpm at 4 deg.C for 10min, collecting supernatant, adding 10 μ L of 5 xSDS loading buffer, mixing, and boiling in boiling water bath for 5min to obtain each group of samples;

carrying out sodium dodecyl sulfate-polyacrylamide gel electrophoresis on each group of samples, and adding 10 mu L of sodium dodecyl sulfate-polyacrylamide gel into each hole; firstly, keeping constant current of 40mA, increasing the current to 80mA when a sample runs to a boundary line between concentrated glue and separation glue, and running to a proper position by referring to a prestained marker position to stop;

under the constant voltage of 100V for 120min, transferring the sample to an NC membrane, and placing a membrane rotating device on ice;

sealing the NC membrane in 10mL of PBST containing 4% skimmed milk powder at room temperature for 1h;

after PBST is cleaned, cutting off the membrane according to the size of target protein, respectively putting the membrane into primary antibody solution, and incubating the membrane overnight at 4 ℃;

PBST is washed for 3 times, 10min each time;

10mL PBST containing 4% skim milk powder was added to a 1/30000 coat-anti rabbitIgG H & L conjugated with Alexa Fluor 790 (Abcam) and incubated at room temperature for 1H;

PBST is washed for 3 times, 10min each time;

NC membranes were scanned using the Odyssey CLX imaging system.

As shown in FIG. 7, the monoclonal antibody described in example 2 can activate T lymphocytes in vitro, and the total protein level of S6 of mTOR pathway, NF- κ B p of NF- κ B pathway and Erk1/2 of MAPK pathway is unchanged but phosphorylation level is significantly up-regulated after stimulation, indicating that the monoclonal antibody described in example 2 can effectively activate T lymphocytes of Nile tilapia in vitro.

In conclusion, the complete nile tilapia CD3 epsilon gene fragment is inserted into a mouse homologous cell line NIH/3T3 by a retrovirus method for the first time, so that the cell line can express nile tilapia CD3 epsilon protein on the cell surface, the active nile tilapia CD3 epsilon protein is reduced to the maximum extent by the protein, and a screening system combining flow cytometry, indirect immunofluorescence and semi-quantification is established, so that the monoclonal antibody against nile tilapia CD3 epsilon is successfully prepared, the specificity of the monoclonal antibody is fully ensured, and an important tool is provided for the follow-up research of the function and mechanism of lymphocytes in the adaptive immune response of the teleosts.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.

Sequence listing

Sequence listing

<110> university of east China

<120> preparation method and application of monoclonal antibody against tilapia T lymphocyte surface membrane protein CD3 epsilon

<160>3

<170> PatentIn version 3.5

<210> 1

<211>32

<212> DNA

<213> Artificial sequence

<400> 1

CCGAAGATCTGCCACCATGCTCAGCATGGGTGTC 32

<210> 2

<211> 27

<212> DNA

<213> Artificial sequence

<400> 2

CGGAATTCCTATCCCATCCTGTTGACC 27

<210> 3

<211>

<212> DNA

<213> Artificial sequence

<400> 3

ATGCTCAGCATGGGTGTCCAGGCCGTGCTCGTCGTCGTCCTCCTCGGCGTTGCTACCACGAAGGCTGAGGAGCCTGAAGACAAAGTGAAAATCTGGAGGACCAAAGTGACACTGACCTGTCCAGAAAAGGGGAATTGGTTTAAGCATAGTGAACGCCTCTTGAATAACAGTGATGTGGTGTATGCATTCACATATACCAGTAAAGGCACATACAGATGTGAATATGGCTCTGAGCAAAAATCTAAATATTATTTCCATGTTGAAGGAAATGTGTGTGAGGACTGCTTTGAGCTCGAAGGAAGCACATTGTTTATGGTCATCGTCGGGGACTTACTCCTGACAATAATTATGATGGTCATAGTCTACAGGTGCACTAACAAGAAAAGCTCAGCTGGACCTCCTCAACCTTCCAAAGCACCTCCTCGCTCTGGAGGCCGGGGTCCACCTGTCCCGTCTCCTGACTATGAGGCACTGAACCCTCAAACTCGGGCCCAGGACACTTACTCCATGGTCAACAGGATGGGATAG 528

Claims (4)

1. A hybridoma cell strain 2B2D7 secreting monoclonal antibodies against tilapia T lymphocyte surface membrane protein CD3 epsilon is characterized in that the hybridoma cell strain 2B2D7 is preserved in China Center for Type Culture Collection (CCTCC) in 20 months at 8 and 2020, and the preservation number is CCTCC NO: C2020134.

2. the monoclonal antibody of tilapia T lymphocyte surface membrane protein CD3 epsilon secreted by the hybridoma cell strain 2B2D7 as claimed in claim 1.

3. A method of producing the monoclonal antibody of claim 2, comprising the steps of:

preparing ascites: taking a mouse, and injecting sterile paraffin oil into the abdominal cavity;

taking the hybridoma cell strain 2B2D7 as defined in claim 1 for resuspension, and then carrying out intraperitoneal injection on the mouse;

killing the mice, collecting ascites, centrifuging, subpackaging and storing;

and purifying ascites to obtain the monoclonal antibody for resisting tilapia T lymphocyte surface membrane protein CD3 epsilon.

4. Use of the monoclonal antibody of claim 2 for the preparation of a fish disease control agent/medicament.

Images