CN112501093B

CN112501093B - Riemerella anatipestifer phoR gene partial fragment deletion attenuated strain and application thereof

Info

Publication number: CN112501093B
Application number: CN202010846779.4A
Authority: CN
Inventors: 李自力; 王颖; 张阳; 李建; 周祖涛; 胡思顺
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2020-08-21
Filing date: 2020-08-21
Publication date: 2021-12-31
Anticipated expiration: 2040-08-21
Also published as: CN112501093A

Abstract

The invention belongs to the technical field of animal bacteria genetic engineering, and particularly relates to a virulent strain with partial fragment deletion of a leeb riemerella anatipestifer phoR gene and application thereof. The strain is preserved in China center for type culture Collection with the preservation number of CCTCC NO: M2020432. The strain lacks in a RA-YM phoP/phoR two-component signal systemphoR687bp of the gene causes the virulence of the strain to be obviously reduced, but good immunogenicity is still kept. Obtained by the inventionphoRThe gene deletion strain is used as a candidate strain of the attenuated vaccine, compared with the traditional inactivated vaccine, the production process is simple, the production cost is lower, and good immune protection can be provided by immunizing and inoculating the ducklings.

Description

Riemerella anatipestifer phoR gene partial fragment deletion attenuated strain and application thereof

Technical Field

The invention belongs to the technical field of animal bacteria genetic engineering, and particularly relates to a virulent strain with partial fragment deletion of a leeb riemerella anatipestifer phoR gene and application thereof.

Background

Infectious serositis of duck (also known as riemerella anatipestifer disease) is an acute, contact, septic infectious disease that infects domestic ducks, geese, turkeys, and a variety of poultry and wild birds. Clinical diagnosis is characterized by sleepiness, secretion in the eyes and nasal cavity, green excretion, ataxia and convulsion, and chronic cases may present symptoms of torticollis. The pathological changes are characterized by cellulosic pericarditis, perihepatitis, air sacculitis and meningitis (Guoyuncut 1986). As early as 1932, cases of duck infectious serositis were reported in the long island region of new york, usa, and subsequently spread in countries and regions such as australia, the united kingdom, soviet union, and the like. The disease is firstly reported in 1982 in China, and the Riemerella anatipestifer infection is reported in Shandong, Sichuan, Hubei, Guangdong and other duck breeding provinces at present. The disease has high morbidity and mortality, the fatality rate of the sick poultry is high, the sick poultry grows slowly, the quality is reduced, the feed return rate is low, the breeding cost is increased, and the like, so that the disease causes great economic loss for the duck breeding industry, and is one of the most serious bacterial infectious diseases harming the duck breeding industry at present.

Riemerella Anatipestifer (RA), a causative agent of infectious serositis in ducks, was once called Pasteurella Anatipestifer (PA), 1993, Segers et al, based on the analysis of DNA-ribosomal RNA hybridization of Riemerella anatipestifer, the composition of proteins and fatty acids and phenotypic characteristics, suggested to establish a Riemerella alone for acceptance. The bacterium is gram negative bacilli, has no spore, no movement, and capsule, and the thallus in the disease material is subjected to dyeing by Reye to form two-stage thick dyeing. The first separation can be carried out by streaking heart, liver, brain, blood, etc. on TS A (tryptone soy agar) or chocolate agar plate, and inoculating on a plate containing 5% -10% CO₂The culture is performed in the environment of (1), and the growth is better when 5% newborn calf serum is added into the culture medium. The surface of the generated colony is smooth, slightly raised and round, and if the colony is cultured continuously, the diameter is slightly larger and about 2 mm. Riemerella anatipestifer can not grow on a common agar culture medium and can not grow on a Macconkey culture medium, and hemolysis is not formed on a blood agar culture medium.

Riemerella anatipestifer does not usually ferment carbohydrate, but a few strains can ferment fructose, maltose, glucose and the like to produce acid and not produce gas. The bacterium can not decompose tryptophan in peptone, so that indole cannot be produced in biochemical tests, and meanwhile, sulfur-containing amino acid cannot be decomposed to produce hydrogen sulfide, but indole tests of few strains are positive. Nitrate is not reduced, starch is not hydrolyzed, catalase, phosphatase, phosphamidoenzyme and esterase C8 are all positive, and citrate is not used. In general, Riemerella anatipestifer is sensitive to various antibiotics such as penicillin, streptomycin, spectinomycin and erythromycin, and is resistant to kanamycin and gentamicin.

Both agglutination assays and agar diffusion assays are used for serotyping of RA. There were 21 serotypes that were internationally identified in 1995, and new serotypes have emerged. The serotype of Riemerella anatipestifer is many and complex, and the serotype is different in different countries and regions and is dynamically changed. Sandhu et al reported that the serotypes of the strains present in the United states are 1-3, 5-8, 11-17, but the major serotypes are

types

1, 2, 5. Bisgaard reports the presence of serotypes in denmark of types 1-3, 7, 10, 12 and 13, but with

types

1 and 3 as the major serotypes. Timms and Marshall report serotypes in the uk of 1-10, but with

types

1 and 2 as the major serotypes. Loh et al reported the presence of serotypes in Singapore of

types

1, 2, 6, 10, 11, and 14-19, but the major serotypes were types 1, 10, and 15. Pathanasophon et al reported that the major serotype in Thailand was serotype 1. The first isolated listeria anatipestifer in china was a serotype 1 strain, but other serotypes were subsequently and increasingly reported. The 222 Riemerella anatipestifer strains separated in Beijing, Guangdong, Shanghai and other areas of China are serologically identified by Gaofu and the like to be serous type 1. 286 Riemerella anatipestifer strains in Beijing and Henan are subjected to serotype classification, and at least 6 serotypes are found. Zhang Da propan, etc. have carried on the statistical analysis to the serotype of Riemerella anatipestifer strain that our country is epidemic, the result shows that there are 10 serotypes of 1, 2, 6, 7, 10, 11, 13, 14, 15, 17, and mainly take 4 serotypes of 1, 2, 6, 10. Chengchun and the like report that in China, besides 21 existing serotype of Riemerella anatipestifer, four new serotypes 22-25 are found. Because the serotypes of the Riemerella anatipestifer are numerous, and no cross protection or weak cross protection exists among the serotypes, the prevention and the treatment of the Riemerella anatipestifer are very difficult. Therefore, the development of the monovalent or multivalent attenuated live vaccine aiming at the epidemic dominant serotype of the Riemerella anatipestifer provides an important means for preventing and controlling the Riemerella anatipestifer.

Although scholars at home and abroad have started to research on the attenuated live vaccine of the Riemerella anatipestifer, no commercialized attenuated live vaccine of the Riemerella anatipestifer is available so far. Earlier researches find that the Cas9 gene is a virulence related gene of Riemerella anatipestifer, and after the Cas9 gene is knocked out from the Riemerella anatipestifer RA-YM strain, the virulence of a deletion strain is reduced by about 317 times compared with that of a parent strain, but the immunogenicity of the deletion strain is better, and the deletion strain can be used as a candidate strain of a weak-virulent live vaccine. Compared with parent strains, the Cas9 gene deletion strain has reduced pathogenicity on ducklings, but still has higher pathogenicity, so that a gene deletion strain with lower toxicity and better immunogenicity is expected to be obtained.

Aiming at the problems, the applicant discovers that a RAYM _ RS09735/RS09740 two-component signal system exists in a Riemerella anatipestifer dream strain (RA-YM) by performing bioinformatics analysis on the genome of the Riemerella anatipestifer, and further determines that the two-component system is a PhoP/PhoR two-component signal system through transcriptomics analysis, and the two-component system is a pair of new two-component systems which are firstly reported in gram-negative bacteria. The applicant found half of death (LD) of the PhoP/PhoR double-gene deletion strain to ducklings in previous researches₅₀) Greater than 10¹¹And judging the strain to be a nontoxic strain (Wangital 2017), and further performing immune challenge protection experiment results show that the PhoP/PhoR double-gene deletion strain has poor immunogenicity. Therefore, the strain deleted in the system is not suitable for serving as a Riemerella anatipestifer attenuated vaccine strain.

Disclosure of Invention

The main purpose of the invention is to provide a liriobacter anatipestifer phoR gene partial fragment deletion attenuated strain, compared with a parent strain, the strain has obviously reduced toxicity, obviously reduced pathogenicity to ducklings, but retained immunogenicity, the strain is delivered to the China center for type culture collection (CCCCCCTCC) at 8/18/2020, and is classified and named: riemerella anatipestifer (Riemerella anatipestifer) YM delta phoR, accession number: CCTCC NO: M2020432, address: wuhan university in Wuhan, China.

The invention also aims to provide the application of the Riemerella anatipestifer gene deletion mutant strain in the preparation of the Riemerella anatipestifer attenuated vaccine, and the attenuated vaccine prepared by the strain can provide good immune protection for the ducklings after immunization. In order to achieve the purpose, the invention adopts the following technical measures:

a Riemerella anatipestifer serum 1 Hubei cloud dream isolate (RA-YM) is used as an initial strain, partial gene fragment deletion is carried out on phoR genes in a PhoP/Pho R double-component signal system, and a phoR gene partial fragment deletion strain is constructed by utilizing a joint transfer method. Meanwhile, partial phoR gene segment deletion mutant strains capable of being stably inherited are screened out through continuous passage. The strain is delivered to China Center for Type Culture Collection (CCTCC) for collection at 8/18/2020, and is classified and named as follows: riemerella anatipestifer (Riemerella anatipestifer) YM delta phoR, accession number: CCTCC NO: M2020432, address: wuhan university in Wuhan, China.

The gene deletion strain and the parent strain have basically the same physiological and biochemical characteristics, do not use saccharides such as glucose, arabinose, sucrose and the like, and grow well in tryptone soybean broth culture medium added with 3 to 5 percent newborn bovine serum.

The application of the Riemerella anatipestifer delta phoR in preparing the Riemerella anatipestifer attenuated vaccine comprises the step of preparing the Riemerella anatipestifer attenuated vaccine by using the strain as a unique effective component or other effective components.

Compared with the prior art, the invention has the following outstanding advantages:

1. the invention discovers for the first time that a hypotoxic strain capable of being stably passaged is obtained by deleting part of the PhoR gene in a PhoP/PhoR two-component signal system in the Riemerella anatipestifer, the toxicity of the strain is greatly reduced, but the immunogenicity of the strain is kept, and a basis is provided for discussing the pathogenic mechanism of the Riemerella anatipestifer and developing a gene engineering live vaccine.

2. The virulence of the phoR gene deletion mutant strain of the Riemerella anatipestifer obtained by the invention is obviously reduced, and compared with a parent strain, the virulence of the phoR gene deletion strain is reduced by about 1.0 multiplied by 10⁵Double, but still retain good immunogenicity, by injecting PhoR gene deletion mutants (1.0X 10)⁸CFU) is used for counteracting toxic substances after ducklings are immunized, and the immune protection rate of phoR gene deletion strains on the ducklings reaches 80 percent.

3. Compared with the traditional inactivated vaccine, the phoR gene deleted strain has the advantages of simple production process and lower production cost, and can provide good immune protection by immunizing the ducklings.

4. The parent strain used by the invention is separated and identified from a certain duck farm in Yunmeng in Hubei, the serotype of the parent strain is serotype 1, and the serotype 1 is the most popular serotype in China at present, so the phoR gene deleted strain constructed by the strain has wide application prospect for further developing the attenuated live vaccine of the Riemerella anatipestifer.

Drawings

Fig. 1 is a general technical roadmap of the present invention.

FIG. 2 is a schematic diagram showing the PCR identification of the Riemerella anatipestifer phoR gene deletion strain of the present invention.

Lane 1 PCR amplification of the RA-YM phoR gene; lane 2 PCR amplification of the RA-YM Spec gene; lane 3 PCR amplification of the RA-YM phoP gene; lane 4.PCR amplification of Δ phorphorphor gene; lane 5PCR amplified the Δ phorspc gene; lane 6.PCR amplification of Δ phoRphoP gene; dl 5000DNA marker.

FIG. 3 is a schematic diagram showing the growth characteristics of a Riemerella anatipestifer phoR gene-deleted strain.

FIG. 4 is a schematic diagram showing the measurement results of 24h blood and tissue bacterial load of a Riemerella anatipestifer phoR gene deletion strain.

FIG. 5 is a schematic diagram showing the measurement results of the bacterial load of 48h blood and tissue of the Riemerella anatipestifer phoR gene deletion strain.

FIG. 6 is a schematic diagram of the observation result of the 24h pathological section of the duckling infected with the riemerella anatipestifer phoR gene deletion strain.

FIG. 7 is a schematic diagram of the observation result of the 48h pathological section of the duckling infected with the riemerella anatipestifer phoR gene deletion strain.

Detailed Description

The present invention will be described in detail with reference to specific embodiments. The technical scheme of the invention is the conventional technology in the field if not specifically stated, and the reagents or materials are all from commercial sources if not specifically stated.

Example 1:

(1) obtaining a riemerella anatipestifer gene deletion mutant strain YM delta phoR:

based on the RA-YM genomic sequence provided in NCBI, three pairs of primers were designed using premier 5.0 to amplify the left and right arms and spectacular resistance genes, respectively, which can be used in the Overlap PCR. Kpn I restriction enzyme cutting site is added at the 5 '-end of the upstream primer of the left arm, and Sac I restriction enzyme cutting site is introduced at the 5' -end of the downstream primer of the right arm. The primer sequences are as follows:

PhoR L-F：5’ctGGTACCgccttggtttcttactctttcatccatcatagag 3’

PhoR L-R：5’AACGTGAGTTTTCGTTCCACTGatagatataataggaataaatttgttacgcac 3’

PhoR Spec F：5’gtgcgtaacaaatttattcctattatatctatCAGTGGAACGAAAACTCACGTT 3’

PhoR Spec R：5’ttaaatcattggaagttttacaataaaggtacCAGTAGTTTTAAAAGTAAGCACCTG 3’

PhoR R-F：5’CAGGTGCTTACTTTTAAAACTACTGTTgtacctttattgtaaaacttccaatgatttaa 3’

PhoR R-R：5’aGAGCTCactttatctatcatctgtagaactctatttgc 3’

respectively amplifying and purifying a left arm, a Spec and a right arm by taking a Riemerella anatipestifer RA-YM strain genome as a template, and connecting the three fragments by virtue of an Ov erlap PCR (polymerase chain reaction), wherein the reaction system is as follows: KOD enzyme 1. mu.L, 10 XKOD Buffer 5. mu.L, 10m mol/L dNTPs 5. mu.L, MgSO ₄3 μ L, PhoR L-F primer 1.5 μ L, PhoR R-R primer 1.5 μ L, left arm 1 μ L, Spec 2 μ L, right arm 1 μ L, ddH₂O29. mu.L. The PCR amplification conditions were: pre-denaturation at 94 ℃ for 2 min; 10sec at 98 ℃, 30sec at 60 ℃ and 1.5min at 68 ℃ for 30 cycles; extending for 10min at 68 ℃; storing at 12 deg.C. The amplified band was analyzed by 1% agarose gel electrophoresis, and the amplified product was recovered and purified as the desired fragment. The purified PCR products were ligated with the cloning vector p MD18-T vector (available from Takara engineering Co., Ltd.) to obtain pT-phoR-LSR plasmid as the target fragment. Suicide plasmid pRE-112 (purchased from Biovector NTCC Inc.) and the constructed pT-LSR plasmid containing the desired fragment were double digested with KpnI and Sac I, respectively. The target fragments were recovered, ligated overnight in a water bath at 16 ℃ and the ligation products were transformed into E.coli X7213 (purchased from Biovector NTCC Inc.) and positive clones were grown up.

E.coli X7213 strain containing plasmid to be transformed is used as donor strain, Riemerella anatipestifer serogroup 1 Yunmeng strain (RA-YM) is used as recipient strain, and a conjugation transfer method is adopted to construct deletion strain. The specific method comprises the following steps: the donor and recipient bacteria were separately cultured on suitable agar platesAnd (4) inoculating the recipient strain into a TSB culture medium, and performing shaking culture at 37 ℃ and 200r/min for 12-16 h. The donor bacteria were inoculated in LB liquid medium containing an appropriate antibiotic and cultured overnight at 37 ℃ with shaking at 200 r/min. The donor bacteria and the recipient bacteria are respectively recovered and cultured for 5-6h until the OD600 reaches about 0.8. Centrifuging at 5000r/min for 3min, and respectively collecting donor bacteria and recipient bacteria. Using 1mL of 10mmol/L MgSO₄Resuspend and repeat three washes. 1mL of 10mmol/L MgSO each was added₄And (4) resuspending. Mixing 100 μ L of each, sticking a sterile nitrocellulose membrane on DAP-containing TSA plate, dropping the mixed bacteria on the filter membrane, and adding CO at 37 deg.C₂The culture was carried out overnight. Washing the supernatant on the filter, washing twice with fresh TSB medium, and spreading on TSA plate containing spectinomycin at 37 deg.C CO₂The culture was carried out overnight. A single colony is picked and inoculated into a TSB culture medium containing spectinomycin, and the bacterial clone growth condition is observed.

Selecting bacteria growing on a plate containing spectinomycin to clone as a candidate mutant strain, and taking a strain which grows out of the bacterial colony and continuously passes 5 generations of strains capable of normally growing on a TSA plate containing spectinomycin as a positive strain to carry out PCR identification, wherein 5 strains are selected in the invention. The primers phoR Spec F and phoR Spec R were used to amplify Spec resistance gene fragments in the mutant to determine the presence or absence of transduction. PhoP and phoR genes to be deleted were amplified with the primers PhoP F/R (PhoP F: ATGAGCAACAGGATATTATTAGTAGAA GATGACCAAAG, phoP R: ATTTTTAACTAGAAGCCTAAACCCTTCCCCGTGTACATT), PhoR F/R (PhoR F: AGGAATATTATAGCTCTATTGAAGAAGAATTCGC, phoR R: CATT TCGTTCCTCTCTAACTTTGACATATTG). The phoR fragment amplification result in the phoR gene deletion strain is negative, and the phoP and Spec gene amplification result is positive; in the RA-YM strain, phoP and phoR gene fragments were amplified positively, and Spec amplification was negative, indicating that the RA-YMphoR gene-deleted strain was successfully constructed (FIG. 2). The nucleotide sequence fragment of the phoR gene deleted by the strain is shown in SEQ ID NO. 1.

Continuously subculturing in tryptone soybean broth/agar culture medium added with 100 mu g/mL spectinomycin and 3-5% newborn calf serum, detecting, finally screening out a gene deletion strain which can normally grow in continuous subculturing for more than 10 generations and has no back mutation by detection, and showing that the deletion strain has good genetic stability.

(2) Growth Curve determination of RA-YMphoR Gene-deleted Strain

Transferring the overnight cultured RA-YMphoR gene deletion mutant strain and parent strain RA-YMR into 10 mL of TSB culture at a ratio of 1:1000, shaking-culturing at 37 deg.C and 200r/min, taking out 100 μ L of bacterial solution every 1h, and measuring OD with spectrophotometer₆₀₀. The results showed that the growth rate of the phoR gene-deleted strain was not significantly different from that of the wild strain by statistical analysis (FIG. 3).

The strain is delivered to China center for type culture Collection in 18 months of 08 in 2020, and is classified and named as follows: riemerella anatipestifer (Riemerella anatipestifer) YM delta phoR, accession number: CCTCC NO: M2020432, address: wuhan university in Wuhan, China. In the present example, the gene-deleted strain is also referred to as Δ phoR, RA-YMphoR gene-deleted strain or RA-YM Δ phoR.

Example 2:

LD of RA-YMphoR gene-deleted Strain₅₀Measurement of

Respectively preparing a freshly cultured Riemerella anatipestifer phoR gene partial fragment deletion strain and an RA-YM parent strain, centrifuging at 5000r/min for 3min, resuspending with PBS, centrifuging again, and repeating for 3 times; determination of bacterial OD₆₀₀The value is obtained. Respectively diluting the bacterial liquid to 5.0 × 10⁹、5.0×10⁸、5.0×10⁷、5.0×10⁶、5.0×10⁵CFU/mL 5 concentration gradient. Dividing 12-day-old cherry valley meat ducks into 11 groups, each group comprises 10, 5 groups of deletion strains and parent strains, injecting 0.2mL of bacteria liquid into each fin, injecting PBS with the same amount into a control group 1, observing clinical manifestations of ducklings after bacteria injection, recording death conditions, and calculating LD₅₀. The calculation formula is as follows:

modified formula of kou's law: LgLD₅₀＝Xk-i[ΣP-(3-Pm-Pn)/4]

In the above formula, Xk is the logarithm of the highest dose, i is the logarithm of the ratio of adjacent doses, Σ P is the combination of mortality for each group, Pm is the highest mortality in the group, and Pn is the lowest mortality in the group.

The results are shown in Table 1, and the parent strain RA-YMLD in this test₅₀Is 3.98 x 10⁴CFU, RA-YMphoR gene-deleted Strain (. DELTA.phoR) LD₅₀Is 4.22 multiplied by 10⁹And (4) CFU. The virulence of the phoR gene-deleted strain was reduced by about 1.0X 10 compared to the parent strain⁵And (4) doubling.

TABLE 1 Riemerella anatipestifer phoR gene deletion mutant and RA-YM strain inoculated duckling death situation

Determination of bacterial load of infected duckling tissue and blood

The 12-day-old cherry valley meat ducks were divided into three groups of 6 ducks. Respectively preparing a freshly cultured Riemerella anatipestifer phoR gene deletion strain and a parent strain, centrifuging at 5000r/min for 3min, resuspending with PBS, centrifuging again, and repeating for 3 times; the bacterial OD600 values were determined. Respectively, the concentration of the extract was 0.2 mL/body (5.0X 10)⁵CFU) bacterial solution is inoculated to 12-day-old ducklings by a webbed fin injection method, and equivalent sterilized PBS is injected to a control group by the same method. Observing the clinical manifestations of the ducklings after bacteria injection, selecting 3 ducklings from parent strain groups and phoR gene deletion strain groups respectively after 24h and 48h of virus inoculation, extracting blood by using 1mL sterile syringes respectively by adopting a heart blood sampling method, and transferring the blood into an anticoagulation tube containing heparin sodium. The collected blood was diluted 10 fold with sterile PBS, respectively^-1、10^-2、10^-3、10^-4Spread on TSA plates containing 5% calf serum, in CO₂The colony count was recorded after 48h incubation in an incubator. Meanwhile, heart, liver, brain and spleen of the duckling are respectively taken, visceral weight is recorded, and the duckling is ground and homogenized in 5mL PBS in an ultra-clean bench. The grinding fluid is diluted by sterilized PBS in multiple proportionRelease to 10^-1、10^-2、10^-3、10^-4Spread on TSA plates containing 5% calf serum, in CO₂The colony count is recorded after 24h-48h of incubation in an incubator. As a result, as shown in FIG. 4 and FIG. 5, the bacterial load of RA-YM phoR gene-deficient strains in liver, brain, spleen, heart and blood was significantly reduced at 24h and 48h after infection (P)<0.05). 24h after infection, the bacterial load of the wild strain and the deleted strain in the liver of the duckling is 1.1 multiplied by 10 respectively⁵CFU/g and 1.4X 10⁴The bacterial load of the wild strain and the deleted strain in the brain of the duckling is 1.3 multiplied by 10 respectively⁵CFU/g and 1.6X 10⁴The bacterial load of the wild strain and the deleted strain in the spleen of the duckling is 3.1 multiplied by 10 respectively⁴CFU/g and 1.1X 10⁴The bacterial load of the wild strain and the deleted strain in the heart of the duckling is 3.0 multiplied by 10 respectively⁴CFU/g and 1.2X 10⁴The bacterial load of the wild strain and the deleted strain in the blood of the duckling is 1.4 multiplied by 10 respectively⁴CFU/mL and 3.7X 10³CFU/mL; the bacterial load of the wild strain and the deletion strain in the liver of the duckling is 1.6 multiplied by 10 respectively 48 hours after infection⁶CFU/g and 1.2X 10⁵CFU/g; the bacterial load of the wild strain and the deleted strain in the brain of the duckling is 2.4 multiplied by 10 respectively⁶CFU/g and 1.0X 10⁵CFU/g; the bacterial load of the wild strain and the deleted strain in the spleen of the duckling is 1.2 multiplied by 10 respectively⁵CFU/g and 6.5X 10⁴CFU/g; the bacterial load of the wild strain and the deleted strain in the heart of the duckling is respectively 4.6 multiplied by 10⁵CFU/g and 4.2X 10⁵CFU/g; the bacterial load of the wild strain and the deleted strain in the blood of the duckling is respectively 2.0 multiplied by 10⁶CFU/mL and 1.0X 10⁵CFU/mL。

Infected duckling pathological section preparation

The duckling infected with the riemerella anatipestifer phoR gene deletion strain and the parent strain is subjected to autopsy, pathological changes of the duckling are observed, changes of brain, heart, liver and spleen are mainly observed, and symptoms such as hemorrhage, necrosis, surface cellulose coverage and the like exist. The site with obvious lesion was fixed in 10% formalin, embedded in paraffin, and then cut into tissue sections 4 μm wide, and HE stained sections were prepared and observed under an optical microscope. As shown in FIGS. 6 and 7, no obvious histological changes were observed in the liver, heart, spleen and brain tissue sections of the ducks in the blank group and the delta phoR group; RA-YM infected duck myocardial tissue structure abnormality, partial myocardial fiber arrangement disorder, myocardial interstitial and visible infiltration of a large amount of inflammatory cells, and necrosis and degeneration of individual myocardial cells; abnormal liver tissue structure, extensive steatosis of liver cells, inflammatory cell infiltration in the region of the sink and little necrotic degeneration of cells; spleen tissue structure abnormality, partial lymphocyte necrosis and degeneration, nucleus fragmentation and contraction; the brain tissue structure is abnormal, the nucleus of part of neurons is deeply contracted and stained, the phenomenon of neurotrophism occurs, surrounding phagocytosis of peripheral glial cells can be seen, the results show that delta p hoR infects ducklings for 24h and 48h, and the invasiveness of the deletion strain to tissues and organs of the ducklings is obviously reduced.

Example 3:

transcriptome sequencing analysis of RA-YMphoR gene deletion mutant

Culturing RA-YM delta phoR strain and wild strain RA-YM in TSA culture medium, selecting single colony, culturing in TSB culture medium at 37 deg.C overnight, transferring into TSB culture medium at a ratio of 1:100, culturing at 37 deg.C 200r/min under shaking, and culturing until OD is reached₆₀₀When the concentration reached 0.8, the cells were collected, RNA was extracted, and then samples of the RNA of RA-YM. DELTA. phoR and RA-YM strain were sent to Ntech, Wuhan Bei, Inc. for transcriptome sequencing.

Differential expression of genes between the RA-YM. DELTA. phoR strain and the parent strain RA-YM was analyzed by transcriptome sequencing. The results showed that the phoR gene deletion mutant strain had 243 genes whose expression difference was 2-fold or more than 2-fold as compared with the parent strain RA-YM, among which 97 genes whose expression was up-regulated and 146 genes whose expression was down-regulated.

Example 4:

challenge protective test of RA-YM phoR gene deletion strain by webbed foot injection for immunization of ducklings

Selecting 15 Riemerella anatipestifer antigens and antibody-negative 12-day-old cherry valley ducks, randomly dividing into 3 groups of 5 ducks, and adopting a webbed foot injection mode for immunization. Group 1 and group 2 were the immune group injected with the webbed foot of RA-YM. DELTA. phoR strain (1.0X 10)⁸CFU/mouse), group 3 was a sterile phosphate buffered saline (PBS, pH 7.2) control group. Group 1 and group 3 after 7d immunizationThe foot web injection is 1.0 x 10⁵CFU parent strain Riemerella anatipestifer RA-YM strain. The second group was injected with an equal volume of pbs as a control group to determine the safety of the gene-deleted strain by webbed immunization. Continuously observing for 7d after the toxic material is attacked, observing clinical symptoms and finally calculating the toxic material attacking protection rate. The results show that: after the immunization by the webbed foot injection, the immune protection rate of the phoR gene deletion strain on the ducklings reaches 80 percent.

TABLE 2 Riemerella anatipestifer phoR gene deleted strain protection rate against challenge (survival number/total number) after immunization of ducklings with flipper

Sequence listing

<110> university of agriculture in Huazhong

<120> Riemerella anatipestifer phoR gene partial fragment deletion attenuated strain and application thereof

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 687

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgagcaaca ggatattatt agtagaagat gaccaaagtt tcggagcggt gcttaaagat 60

tacctaagca taaataactt tgaagttacc cttgctacag acggcgagga aggtcttaaa 120

gaatatacaa ataacgattt tgatatttgt atatttgatg ttatgatgcc aaaaaaagac 180

ggcttcacat tagcagaaga tgttaagaaa ttagggaaaa atattccaat tatcttccta 240

acagcacgaa atttaagaga ggatatcttg aaaggttatc agttaggtgc agacgattat 300

ataacaaaac cttttgatac cgaactgtta ctttataaaa ttaaggcgat tttatccaga 360

agtacttctt tggaagaaga agagcaagag caatttagca ttagcaatat agagtttgac 420

tctatgttga ggcagcttaa agtacacgat aaagaatata aactttctcc aaaagagaac 480

gagcttttga agttgttttg tctccacaga aacgacttta tgcctagaga tttagcactt 540

cgtaaaatat ggaaaaaaga aaactatttt accgctagaa gtatggatgt atatatcgct 600

aaattaagaa aattgcttaa agatgatgat ggtctagaaa tcatcaatgt acacggggaa 660

gggtttaggc ttctagttaa aaattaa 687

<210> 2

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ctggtaccgc cttggtttct tactctttca tccatcatag ag 42

<210> 3

<211> 54

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aacgtgagtt ttcgttccac tgatagatat aataggaata aatttgttac gcac 54

<210> 4

<211> 54

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gtgcgtaaca aatttattcc tattatatct atcagtggaa cgaaaactca cgtt 54

<210> 5

<211> 57

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ttaaatcatt ggaagtttta caataaaggt accagtagtt ttaaaagtaa gcacctg 57

<210> 6

<211> 59

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

caggtgctta cttttaaaac tactgttgta cctttattgt aaaacttcca atgatttaa 59

<210> 7

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

agagctcact ttatctatca tctgtagaac tctatttgc 39

<210> 8

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

atgagcaaca ggatattatt agtagaagat gaccaaag 38

<210> 9

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

atttttaact agaagcctaa acccttcccc gtgtacatt 39

<210> 10

<211> 34

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

aggaatatta tagctctatt gaagaagaat tcgc 34

<210> 11

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

catttcgttc ctctctaact ttgacatatt g 31

Claims

1. Riemerella anatipestifer (Riemerella anatipestifer)Riemerella anatipestifer) The phoR gene partial segment is deleted with attenuated strain, and the preservation number of the deleted attenuated strain is CCTCC NO: M2020432.

2. The low virulent strain of claim 1, wherein the low virulent strain is obtained by deleting a sequence shown in SEQ ID NO.1 from Riemerella anatipestifer RA-YM.

3. The use of the attenuated strain of claim 1 in the preparation of a riemerella anatipestifer attenuated vaccine.

4. The use according to claim 3, wherein said vaccine is a live attenuated vaccine.