CN112481414A - Kit and method for detecting genotypes of norovirus GI and GII - Google Patents

Abstract

The invention provides a kit for detecting genotypes of norovirus GI and GII, which comprises the following components: the solution A is enzyme solution Mix which comprises Taq-WT enzyme solution, UDG enzyme and RNA inhibitor; and the solution B, namely the 2X One Step Buffer, comprises norovirus GI and GII genotype specific primers, a specific detection probe, 10X Taq Buffer and d (U) NTP. By using the optimized PCR amplification buffer, the Taq enzyme has reverse transcriptase activity and DNA polymerase activity, the Real-time fluorescent quantitative PCR detection of the norovirus nucleic acid is completed by the same enzyme, the sensitivity and the specificity of the Real-time fluorescent quantitative PCR detection are equivalent to those of a traditional Real-time RT-PCR method, but the detection time is shortened by one third, the Real-time fluorescent quantitative PCR detection method is suitable for instant rapid diagnosis, and the raw material cost and the time cost are reduced.

Description

Kit and method for detecting genotypes of norovirus GI and GII

Technical Field

The invention relates to the field of pathogen nucleic acid detection, in particular to a kit and a detection method for detecting genotypes of norovirus GI and GII.

Background

Norovirus is a virus of the genus Norovirus (NV) in the Human Calicivirus family (Human Calicivirus, HuCV). Norovirus infectious diarrhea is prevalent worldwide, infections can occur all year round, the infected subjects are mainly adults and school-age children, and the incidence is high in cold seasons. In the united states, 60% to 90% of all outbreaks of nonbacterial diarrhea are caused by norovirus each year. Similar results are seen in developed countries such as the Netherlands, British, Japan, Australia, etc. In the children with diarrhea under 5 years old in China, the detection rate of the norovirus is about 15%, and serum antibody level investigation shows that the norovirus infection in Chinese people is also very common. Detection of norovirus should therefore be appreciated.

Norovirus is divided into 6 gene groups (GI-GVI), GI and GII are two major groups of genes responsible for acute gastroenteritis in humans, and GIV can also infect humans, but is rarely detected. GIII, GV and GVI infect cattle, mice and dogs, respectively. Norovirus infection is primarily through the fecal oral route, and humans and animals are able to secrete large numbers of norovirus particles after infection. Because norovirus has strong in vitro viability and infectivity, a small dose of norovirus can infect (<100 virus particles), and people are generally susceptible to the norovirus. The clinical symptoms of human bodies infected by norovirus are mainly vomit and diarrhea, and are difficult to distinguish from gastroenteritis symptoms caused by other pathogens.

At present, the detection method which is clinically common is as follows: 1. nucleic acid detection and genotyping: the existing fluorescent quantitative PCR needs to firstly carry out reverse transcription on RNA into cDNA, and then carries out fluorescent quantitative PCR by taking the cDNA as a template, so that reverse transcriptase and Taq DNA polymerase are needed for traditional norovirus gene detection, and along with the rising of the price of raw materials for in vitro diagnosis, the more raw materials are added in a kit, the higher the cost is, and the longer the detection time is; 2. antigen detection: because of the high variation of norovirus antigens, there is a major challenge to develop a broad-response ELISA method.

Taq DNA polymerase is one of the earliest found thermostable DNA polymerases, and is generally classified as the DNA polymerase on which PCR depends. However, Taq DNA polymerase belongs to the same DNA polymerase superfamily as MMLV reverse transcriptase, and studies have shown that Taq DNA polymerase has reverse transcriptase activity.

Disclosure of Invention

The invention aims to provide a kit for detecting the genotypes of the norovirus GI and GII, and aims to reduce the cost of norovirus detection and shorten the detection time.

To achieve the above object, the present invention provides a kit for detecting the genotypes of norovirus GI and GII, comprising:

the solution A is enzyme solution Mix which comprises Taq-WT enzyme solution, UDG enzyme and RNA inhibitor;

and the solution B, namely the 2X One Step Buffer, comprises norovirus GI and GII genotype specific primers, a specific detection probe, 10X Taq Buffer and d (U) NTP.

Optionally, the norovirus GI genotype specific primer and the specific detection probe are respectively:

GI-primer-F：5'-ATGTTGGTGACCAACAAGCTGTATCATGGTCTGCTAATG-3'(SEQ ID NO.1)；

GI-primer-R：5'-GCGAGTGGACCCCAATAGTTTTACCTTGCC-3'(SEQ ID NO.2)；

GI-Probe：

5'-[FAM-dT]TGGAGTGAACATTGGCGTTAGTGATCTGACCACTGTCCGTGGACCA[BHQ1-dT]-3'(SEQ ID NO.3)；

the norovirus GII genotype specific primers and the specific detection probes are respectively as follows:

GII-primer-F：5'-GTGACGCCAACCCATCTGATGGGTCCGCAGCCAACCT-3'(SEQ ID NO.4)；

GII-primer-R：5'-GCACTTCAAAACCACCTGCATAACCGTTGT-3'(SEQ ID NO.5)；

GII-Probe：

5'-[ROX-dT]GGTCAACAATGAGGTTATGGCTCTGGAGCCCGTTGTTGGTGCCGCCA[BHQ2-dT]-3'(SEQ ID NO.6)。

optionally, the 10 × Taq Buffer comprises:

200mM Tris-HCl, 20mM (NH4)2SO4, 300mM KCl, 40mM MgSO4, 1% Triton X-100, pH 8.0.

The invention also provides a method for detecting the genotypes of the norovirus GI and GII by using the kit, which comprises the following steps:

(1) extracting RNA of a sample to be detected;

(2) preparing a reaction system: the reaction system is 30 mu l, when in preparation, 15 mu l B liquid, 3.5 mu l nucleotide-free wall and 1.5 mu l A liquid are sequentially added into the reaction tube, and the mixture is shaken, evenly mixed and centrifuged for standby;

(3) adding 10 mul of RNA sample into the reaction tube, placing the mixture on a mixer, fully mixing the mixture, and centrifuging the mixture;

(4) the reaction process is as follows: the reaction tube is placed in a real-time fluorescence quantitative PCR instrument, incubation is carried out for 15min at a constant temperature of 50 ℃, fluorescence signals are collected for 1 time in 1 cycle of 15s at 95 ℃ and 30s at 55 ℃, the total time is 40 cycles, and the total reaction process is 60 min.

The invention has the beneficial effects that:

the kit for detecting the genotypes of the norovirus GI and GII in the technical scheme of the invention ensures that the Taq enzyme has reverse transcriptase activity and DNA polymerase activity by using the optimized PCR amplification buffer, the Real-time fluorescent quantitative PCR detection of the norovirus nucleic acid is completed by the same enzyme, the sensitivity and the specificity of the kit are equivalent to those of the traditional Real-time RT-PCR method, but the detection time is shortened by one third, the kit is suitable for instant rapid diagnosis, and the raw material cost and the time cost are reduced.

Drawings

To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings that are required to be used in the embodiments will be briefly described below, and it should be understood that the following drawings only illustrate some embodiments of the present invention, and therefore should not be considered as limiting the scope of the present invention.

FIG. 1A is a graph showing the effect of 10XTaq buffer at different pHs on GI genotype detection;

FIG. 1B shows different pH values and Mg²⁺A result chart of the influence of 10X Taq buffer on GI genotype detection;

FIG. 1C shows different NH groups₄ ²⁺A result chart of the influence of 10X Taq buffer on GI genotype detection;

FIG. 1D is a graph showing the effect of 10XTaq buffer with different K + concentrations on GI genotype detection;

FIG. 2 is a graph showing the results of the test of the sensitivity of the kit of the embodiment of the present invention to detection of the genotypes GI and GII of norovirus;

FIG. 3 is a diagram showing the test results of the specificity of the kit of the present invention for detecting the genotypes of the norovirus GI and GII.

Detailed Description

The terms as used herein:

the terms "comprises," "comprising," "includes," "including," "has," "having," "contains," "containing," or any other variation thereof, as used herein, are intended to cover a non-exclusive inclusion. For example, a composition, process, method, article, or apparatus that comprises a list of elements is not necessarily limited to only those elements but may include other elements not expressly listed or inherent to such composition, process, method, article, or apparatus.

The conjunction "consisting of … …" excludes any unspecified elements, steps or components. If used in a claim, the phrase is intended to claim as closed, meaning that it does not contain materials other than those described, except for the conventional impurities associated therewith. When the phrase "consisting of … …" appears in a clause of the subject matter of the claims rather than immediately after the subject matter, it defines only the elements described in the clause; other elements are not excluded from the claims as a whole.

When an amount, concentration, or other value or parameter is expressed as a range, preferred range, or as a range of upper preferable values and lower preferable values, this is to be understood as specifically disclosing all ranges formed from any pair of any upper range limit or preferred value and any lower range limit or preferred value, regardless of whether ranges are separately disclosed. For example, when the range "1 ~ 5" is disclosed, the ranges described should be construed to include the ranges "1 ~ 4", "1 ~ 3", "1 ~ 2 and 4 ~ 5", "1 ~ 3 and 5", and the like. When a range of values is described herein, unless otherwise stated, the range is intended to include the endpoints thereof and all integers and fractions within the range.

The invention provides a kit for detecting genotypes of norovirus GI and GII, which comprises the following components:

the solution A is enzyme solution Mix which comprises Taq-WT enzyme solution, UDG enzyme and RNA inhibitor;

and the solution B, namely the 2X One Step Buffer, comprises norovirus GI and GII genotype specific primers, a specific detection probe, 10X Taq Buffer and d (U) NTP. .

Optionally, the norovirus GI genotype specific primer and the specific detection probe are respectively:

GI-primer-F：5'-ATGTTGGTGACCAACAAGCTGTATCATGGTCTGCTAATG-3'(SEQ ID NO.1)；

GI-primer-R：5'-GCGAGTGGACCCCAATAGTTTTACCTTGCC-3'(SEQ ID NO.2)；

GI-Probe：

5'-[FAM-dT]TGGAGTGAACATTGGCGTTAGTGATCTGACCACTGTCCGTGGACCA[BHQ1-dT]-3'(SEQ ID NO.3)；

the norovirus GII genotype specific primers and the specific detection probes are respectively as follows:

GII-primer-F：5'-GTGACGCCAACCCATCTGATGGGTCCGCAGCCAACCT-3'(SEQ ID NO.4)；

GII-primer-R：5'-GCACTTCAAAACCACCTGCATAACCGTTGT-3'(SEQ ID NO.5)；

GII-Probe：

5'-[ROX-dT]GGTCAACAATGAGGTTATGGCTCTGGAGCCCGTTGTTGGTGCCGCCA[BHQ2-dT]-3'(SEQ ID NO.6)。

optionally, the 10 × Taq Buffer comprises:

200mM Tris-HCl, 20mM (NH4)₂SO4, 300mM KCl, 40mM MgSO4, 1% Triton X-100, pH 8.0.

The invention also provides a method for detecting the genotypes of the norovirus GI and GII by using the kit, which comprises the following steps:

(1) extracting RNA of a sample to be detected;

(2) preparing a reaction system: the reaction system is 30 mu l, when in preparation, 15 mu l B liquid, 3.5 mu l nucleotide-free water and 1.5 mu l A liquid are sequentially added into the reaction tube, and the mixture is uniformly mixed and centrifuged for standby;

(3) adding 10 mul of RNA sample into the reaction tube, placing the mixture on a mixer, fully mixing the mixture, and centrifuging the mixture;

(4) the reaction process is as follows: the reaction tube is placed in a real-time fluorescence quantitative PCR instrument, incubation is carried out for 15min at a constant temperature of 50 ℃, fluorescence signals are collected for 1 time in 1 cycle of 15s at 95 ℃ and 30s at 55 ℃, the total time is 40 cycles, and the total reaction process is 60 min.

Embodiments of the present invention will be described in detail below with reference to specific examples, but those skilled in the art will appreciate that the following examples are only illustrative of the present invention and should not be construed as limiting the scope of the present invention. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

Example 1 design and preparation of norovirus GI and GII genotype primers, probes

Respectively downloading nucleic acid sequences of the norovirus GI and GII genotypes from Genebank, analyzing the sequences of the norovirus GI and GII genomes, wherein a stable conserved region is used as a target sequence for detection, and designing and synthesizing specific detection primers and probes aiming at the target sequence:

wherein, the sequences of the primer and the probe used for GI genotype detection are respectively as follows:

GI-primer-F：5'-ATGTTGGTGACCAACAAGCTGTATCATGGTCTGCTAATG-3'(SEQ ID NO.1)

GI-primer-R：5'-GCGAGTGGACCCCAATAGTTTTACCTTGCC-3'(SEQ ID NO.2)

GI-Probe：

5'-[FAM-dT]TGGAGTGAACATTGGCGTTAGTGATCTGACCACTGTCCGTGGACCA[BHQ1-dT]-3'(SEQ ID NO.3)

the sequences of the primers and probes used for GII genotype detection were:

GII-primer-F：5'-GTGACGCCAACCCATCTGATGGGTCCGCAGCCAACCT-3'(SEQ ID NO.4)

GII-primer-R：5'-GCACTTCAAAACCACCTGCATAACCGTTGT-3'(SEQ ID NO.5)

GII-Probe：

5'-[ROX-dT]GGTCAACAATGAGGTTATGGCTCTGGAGCCCGTTGTTGGTGCCGCCA[BHQ2-dT]-3'(SEQ ID NO.6)

the primer and the probe sequence are synthesized by Shanghai biological engineering Co., Ltd.

Example 22X One Step Buffer formulation optimization

The 2X One Step Buffer is configured by 10X Taq Buffer, GI/GII specific probes are respectively detected in the process of optimizing the 10X Taq Buffer, and the PH and Mg of the 10X Taq Buffer are respectively optimized by utilizing a single-factor variable method²⁺Concentration, NH₄ ²⁺Concentration and K⁺The influence of the concentration on the detection result, and the formula of the 10X Taq buffer optimization process is shown in Table 1.

In this example, the GI genotype is taken as an example to perform a single test to detect the influence of 10X Taq Buffer on the GI genotype, the preparation of the single test reaction system is shown in table 2, and the preparation reaction system: the reaction system is 30 mul, when in preparation, 15ul of the solution B, 3.5ul of the nucleotide-free water and 1.5ul of the solution A are sequentially added into a reaction tube, and the mixture is shaken, evenly mixed and centrifuged for standby; adding 10 mul of RNA sample into the reaction tube, placing the mixture on a mixer, fully mixing the mixture, and centrifuging the mixture; the reaction process is as follows: placing the reaction tube directly in Roche

96 real-time fluorescenceIn a light quantitative PCR instrument, incubation is carried out at a constant temperature of 50 ℃ for 15min, fluorescence signals are collected for 1 time in 1 cycle of 15s at 95 ℃ and 30s at 55 ℃ for 40 cycles, the whole reaction process is carried out for 60min, and result interpretation is carried out by observing a fluorescence curve.

The amplification curve GI is similar to the GII result, and the GI detection results influenced by different single-factor variables are shown in FIGS. 1A to 1D, which are not repeated. Firstly, the influence of 10XTaq Buffer 1 with different pH values on the detection result of the GI genotype is researched, the result is shown in FIG. 1A, PC in FIG. 1 is a positive control, and as can be seen from FIG. 1A, the 10XTaq Buffer with pH of 8.0 has the best detection effect on the GI genotype. Then 10XTaq Buffer2 at pH8.0 or pH7.5 was selected to probe for different Mg²⁺The effect of concentration on the results of GI genotype measurements is shown in FIG. 1B, where in FIG. 1B it is seen that the pH is 8.0 and Mg is present²⁺The GI genotype detection was best at a concentration of 40 mM. Then explore different NH₄ ²⁺The effect of concentration on GI genotype measurements is shown in FIG. 1C, and from FIG. 1C, 20mM NH₄ ²⁺At concentration, the GI genotype test was most effective. Finally, explore different K⁺The effect of concentration on GI genotype measurements is shown in FIG. 1D, and K is derived from FIG. 1D⁺The GI genotype detection was best at a concentration of 300 mM. Therefore, the final optimized combination, namely Buffer A-3 in 10X Taq Buffer 4 is selected, and 2X One Step Buffer is prepared as shown in Table 3.

TABLE 110X Taq buffer optimization Process formulation

TABLE.2 reaction systems preparation Table (taking GI genotype as an example)

Components	Volume (uL)
		Solution A
Taq DNA Polymerase	0.9
		UDG enzymes	0.3
RNA inhibitor	0.3
		Liquid B (Single test)
10X Taq buffer	3
		GI-primer-F	0.6
GI-primer-R	0.6
		GI-Probe	0.3
d(U)NTP	0.3
		NF water	13.7
RNA template	10
		Total	30

TABLE 32X One Step Buffer (B liquid)

Test example 1 evaluation of detection sensitivity of kit

Extracting norovirus RNA by using QIAamp RNA Mini Kit of Qiagen company, taking extracted sample RNA nucleic acid, and sequentially diluting to 10 times of RNA nucleic acid in a 10-fold gradient dilution mode⁵、10⁴、10³、10²、10¹And 1copies/mL sample for later use, and detecting the extracted norovirus RNA by using the kit for detecting the norovirus GI and GII genotypes provided by the embodiment of the invention.

The test result is shown in figure 2, and as can be seen from figure 2, the kit for detecting the genotypes of the norovirus GI and GII provided by the invention has the lowest detection limit of 10copies/mL for norovirus and good sensitivity.

Test example 2 evaluation of detection specificity of kit

In order to evaluate the detection specificity of the kit for detecting norovirus GI and GII genotypes provided by the embodiment of the invention, a group of common intestinal common pathogens and other pathogens with infection parts same with or similar to norovirus infection symptoms are screened from clinical samples, and the group of common intestinal common pathogens and other pathogens comprises: rotavirus, Sapovirus, enteroadenovirus, astrovirus, salmonella and Shigella. The pathogens are respectively extracted by nucleic acid by using QIAamp RNA/DNA Mini Kit of Qiagen company, and are detected by using the Kit for detecting the genotype of the norovirus GI and the GII provided by the embodiment of the invention.

The test results are shown in fig. 3, and the evaluation results show that the kit for detecting the genotypes of the norovirus GI and GII provided by the embodiment of the invention has negative results in detecting common intestinal pathogens, detects other pathogens with the same or similar infection symptoms as the norovirus infection parts, has negative results, and only has positive quality control results of the norovirus GI and GII genotypes. The primers and the probes adopted by the norovirus GI and GII genotype detection kit provided by the embodiment of the invention have strong characteristics, and do not have cross reaction with other pathogens.

The test results show that the norovirus GI and GII genotype detection kit provided by the embodiment of the invention has good sensitivity and specificity, and the kit does not need a step of independently carrying out RNA reverse transcription to cDNA, and only needs one Taq enzyme to realize the reverse transcription and amplification steps of real-time fluorescence quantitative PCR, so that the kit cost is saved, and the detection time is shortened.

Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.

Furthermore, those skilled in the art will appreciate that while some embodiments herein include some features included in other embodiments, rather than other features, combinations of features of different embodiments are meant to be within the scope of the invention and form different embodiments. For example, in the claims above, any of the claimed embodiments may be used in any combination. The information disclosed in this background section is only for enhancement of understanding of the general background of the invention and should not be taken as an acknowledgement or any form of suggestion that this information forms the prior art already known to a person skilled in the art.

Sequence listing

<110> Shenzhen carbon Domain technology Limited

<120> kit and detection method for detecting genotypes of norovirus GI and GII

<130> 2020-12-03

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgttggtga ccaacaagct gtatcatggt ctgctaatg 39

<210> 2

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gcgagtggac cccaatagtt ttaccttgcc 30

<210> 3

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tggagtgaac attggcgtta gtgatctgac cactgtccgt ggacca 46

<210> 4

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gtgacgccaa cccatctgat gggtccgcag ccaacct 37

<210> 5

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gcacttcaaa accacctgca taaccgttgt 30

<210> 6

<211> 47

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ggtcaacaat gaggttatgg ctctggagcc cgttgttggt gccgcca 47

Claims (4)

1. A kit for detecting the genotypes of norovirus GI and GII, comprising:

the solution A is enzyme solution Mix which comprises Taq enzyme, UDG enzyme and RNAINHIBITOR;

and the solution B, namely the 2X One Step Buffer, comprises norovirus GI and GII genotype specific primers and a specific detection probe, and 10XTaq Buffer and d (U) NTP.

2. The kit of claim 1, wherein the norovirus GI and GII genotypes are detected by the norovirus GI genotype specific primers and the specific detection probes, respectively:

GI-primer-F：5'-ATGTTGGTGACCAACAAGCTGTATCATGGTCTGCTAATG-3'(SEQ ID NO.1)；

GI-primer-R：5'-GCGAGTGGACCCCAATAGTTTTACCTTGCC-3'(SEQ ID NO.2)；

GI-Probe：

5'-[FAM-dT]TGGAGTGAACATTGGCGTTAGTGATCTGACCACTGTCCGTGGACCA[BHQ1-dT]-3'(SEQ ID NO.3)；

the norovirus GII genotype specific primers and the specific detection probes are respectively as follows:

GII-primer-F：5'-GTGACGCCAACCCATCTGATGGGTCCGCAGCCAACCT-3'(SEQ ID NO.4)；

GII-primer-R：5'-GCACTTCAAAACCACCTGCATAACCGTTGT-3'(SEQ ID NO.5)；

GII-Probe：

5'-[ROX-dT]GGTCAACAATGAGGTTATGGCTCTGGAGCCCGTTGTTGGTGCCGCCA[BHQ2-dT]-3'(SEQ ID NO.6)。

3. the kit of claim 1, wherein the 10XTaq Buffer comprises:

200mM Tris-HCl, 20mM (NH4)₂SO4, 300mM KCl, 40mM MgSO4, 1% Triton X-100, pH 8.0.

4. A method for detecting the genotypes of norovirus GI and GII using the kit of any one of claims 1 to 3, comprising the steps of:

(1) extracting RNA of a sample to be detected;

(2) preparing a reaction system: the reaction system is 30 mul, when in preparation, 15 mul of B liquid, 3.5 mul of nucleotide-free wall and 1.5 mul of lA liquid are added into a reaction tube in turn, and the mixture is shaken, evenly mixed and centrifuged for standby;

(3) adding 10 mul of RNA sample into the reaction tube, placing the mixture on a mixer, fully mixing the mixture, and centrifuging the mixture;

(4) the reaction process is as follows: the reaction tube is placed in a real-time fluorescence quantitative PCR instrument, incubation is carried out for 15min at a constant temperature of 50 ℃, fluorescence signals are collected for 1 time in 1 cycle of 15s at 95 ℃ and 30s at 55 ℃, the total time is 40 cycles, and the total reaction process is 60 min.

Images