CN112481238A - Mutant of xylanase XynA and application thereof - Google Patents

Abstract

The invention provides a mutant of xylanase XynA and application thereof. Compared with XynA, the optimum temperatures of mutants XynAS and XynAR are respectively increased by 10 ℃ and 15 ℃ to 70 ℃ and 75 ℃, the XynAR is kept at 80 ℃ for 30min, the residual enzyme activity still reaches more than 90 percent, and the xylan hydrolysis efficiency of both XynAS and XynAR is improved, wherein the XynAS hydrolysis time is shortened, the yields of xylobiose and xylotriose are obviously improved, the XynAS hydrolysis time is shortened, and the yield of xylotetraose is obviously improved; xynan hydrolyzes beech wood and oat xylan, the ratio of hydrolysate is changed, and the birch xylan hydrolyzing efficiency is improved. Therefore, the mutant of the invention has good application value and prospect in the production of xylooligosaccharide by utilizing agricultural wastes.

Description

Mutant of xylanase XynA and application thereof

Technical Field

The invention belongs to the field of enzyme engineering, and particularly relates to mutation of xylanase and application of the xylanase in production of xylooligosaccharide by using agricultural wastes.

Background

Agricultural wastes are a general term for wastes discharged in agricultural production, agricultural product processing, livestock and poultry breeding and rural residents. China is a big agricultural country, along with the production and processing of agricultural products, a large amount of agricultural wastes are generated every year, the agricultural wastes are good renewable resources, but are not effectively developed and utilized, and the outstanding problems of large agricultural waste discharge amount, serious environmental pollution and the like in the agricultural development of China are caused. The concept of 'bringing forward the joy of villages with green development' requires full development and utilization of agricultural wastes, realizes the recycling of the agricultural wastes through technical progress, can relieve resource and environmental crisis, and realizes the unification of environmental benefits and economic benefits, so that the comprehensive utilization of the agricultural wastes becomes one of the hot topics of competitive research of scientists in recent decades (sun pize, yellow reflection, comprehensive utilization research and review of the agricultural wastes and exhibition [ J ] agricultural prospect, 2020,16(01): 106-. Agricultural waste contains abundant cellulose and hemicellulose, wherein the hemicellulose accounts for 20-30%, and the main component of the hemicellulose of gramineae and hardwood trees is xylan, which is crosslinked with cellulose and lignin by covalent or non-covalent. Xylan, such as corncobs and wheat bran, is not efficiently utilized for various reasons. For example, during the pulping process of paper making, industrial waste rich in xylan is directly discharged into water, so that water body eutrophication is caused, and the ecological environment is seriously damaged. The method has the advantages that the high-added-value xylooligosaccharide is produced by fully utilizing and developing xylan in a large amount of low-value agricultural wastes, the utilization value of the agricultural wastes can be improved, and the problems of environment, ecology, energy and the like can be solved to a certain extent (Van lucsen. Cladosporium camphorata heat-resistant xylanase, purification, properties and application research [ D ]. China university of agriculture, 2014).

Due to the complexity of the xylan structure, its complete degradation requires a variety of hydrolases, including β -1, 4-endoxylanase, α -L-arabinofuranosylhydrolase, α -D-glucuronosylase, acetylxylan esterase, β -D-xylosidase, etc., which together make up the xylan hydrolase system (coka. glycoside hydrolase with the structural basis of ester hydrolase stability and substrate selectivity regulation [ D ]. jilin university, 2015). Wherein beta-1, 4-endoxylanase (EC 3.2.1.8) acts on the xylan backbone randomly in an endo-mode to produce xylooligosaccharides and small amounts of xylose (Collins T, Gerday C, Feller G. xylanases, xylanase families and exophilic xylanases [ J ]. FEMS Microbiol Rev,2005,29(1): 3-23). Although the complete degradation of xylan requires the synergistic effect of a plurality of enzymes, the beta-1, 4-endoxylanase plays the most important and important roles in the degradation process of xylan, and is the most key enzyme for preparing xylo-oligosaccharide by utilizing agricultural waste enzyme method, so that the xylanase is the most researched and most valuable enzyme in the enzymes related to xylan degradation.

At present, xylanase is mainly applied to industrial production of paper making, food, feed and the like, and in order to be better suitable for complex and various production environments, characteristics of xylanase are widely researched, such as heat resistance, acid/alkali resistance, substrate specificity and the like, but related research on specific hydrolysate, namely xylooligosaccharide (mainly xylobiose and xylotriose) generated by enzyme catalysis of a substrate is less, and a hydrolysis specificity mechanism is unclear, while research on a hydrolysis specificity mechanism of the GH11 xylanase is crucial in the research on the hydrolysis specificity mechanism of the xylooligosaccharide by utilizing agricultural wastes with low added values to produce high added values. Research shows that the N end has certain influence on hydrolysis specificity of GH11 xylanase. For example, to investigate the structure-function relationship of the N-terminal region of GH11 xylanase, 17N-terminal amino acids of GH11 xylanase from Neocallimastix patriciarum (Np-Xyn) were grafted onto the N-terminal of atypical short GH11 xylanase from Bacillus thermophilus (Thermobacillus xylaniticus) (Tx-Xyn) to obtain hybrid enzyme NTfus with wheat arabinoxylan as substrate, the catalytic efficiency was 17% higher than the parent enzyme, with milled wheat straw as substrate, NTfus released more oligosaccharide product, indicating that the hybrid enzyme NTfus has a wider range of substrate selectivity, suggesting that the N-terminal extension has a modification to the substrate binding site (Song L, Dumon C, Siguier B, et al.impact of an N-terminal extension on the viability and activity of the 11 xylanase GH from Thermobacillus xylanatilis [ J ]. Journal of Biotechnology,2014,174(1): 64-72); li et al (Li Q, Sun B, Xiong K, et al. Improporting specific hydrolysis mutation in Talaromyces thermophilus F1208 Xylanase by amino acid engineering of N-terminal extension and site-directed mutagenesis in C-terminal [ J ]. International Journal of Biological Macromolecules,2017,96: 451. minus 458) the strategy of replacing the first 16 amino acids of T-Xyn with the first 8 amino acids of the N-terminal sequence of 2C1F and replacing the 1 st Lys with Ala to obtain the mutant enzyme T-XynF, which has xylotriose as a substrate and a xylosyl production amount 20.71% higher than xylose, which indicates that a stronger conversion rate increases the concentration of glycoside molecules and thus enhances the glycosidic activity (Galholo R.147. oligo R.154. for production of polysaccharide J.154. for polysaccharide D.12. for polysaccharide production of polysaccharide D.I. 2. for polysaccharide D.C 1; li et al (Qin L, Sun B, Jia H, et al. engineering a xylylase from Streptomyces rochei, L10904 by mutation to immunological catalysis [ J ]. International Journal of Biological Macromolecules,2017,101: 366; 372) report that xylanase (Srxyn) from Streptomyces rochei L10904 has improved catalytic properties by using site-directed mutagenesis to effect N-terminal region displacement, and that the three mutants SrxynF, SrxynM and SrxynFM have higher substrate affinity and catalytic efficiency than Srxyn and improved hydrolytic properties, most notably enhanced ability to produce xylobiose (X2) and xylotriose (X3) when xylan is used as a substrate.

Disclosure of Invention

The present inventors further studied the mutation at the N-terminus of Streptomyces rochei L2001 GH11 recombinant xylanase XynA, and found that some of the mutants, in which the mutation was made at the N-terminal sequence, exhibited excellent effects, thus completing the present invention.

The invention provides a mutant of xylanase XynA, which is characterized in that the mutant is expressed in a sequence corresponding to SEQ ID NO: 2, the 33 rd position of the xylanase XynA is mutated, or the 11 th to 16 th positions of the xylanase XynA are mutated.

Preferably, the 33 th site is mutated into S33P, or the 11 th site to the 16 th site are simultaneously mutated as follows: T11Y, D12H, N13D, F15Y and Y16F. More specifically, the mutant has the amino acid sequence shown as SEQ ID NO: 5, or SEQ ID NO: 7.

The invention further provides a gene encoding said mutant, more preferably, it has the sequence as shown in SEQ ID NO: 4, or SEQ ID NO: 6.

The invention further provides an expression vector, a recombinant cell line or a recombinant bacterium containing the gene. Preferably, it is an inducible expression vector; the recombinant bacterium is streptomyces, and more preferably streptomyces rochei.

The invention further provides the application of the mutant in hydrolyzing xylan. In some embodiments, the hydrolysis substrate is one or a combination of birch xylan, beech xylan, or oat xylan. Preferably, the temperature is controlled at 50-75 ℃ when the hydrolysis is carried out.

In other embodiments, the hydrolysis substrate is an agricultural or industrial waste containing xylan.

The invention designs 4 mutation strategies at N-terminal positions (N-terminal sequence replacement, R2 area replacement, T30E and S33P), obtains mutant enzymes by utilizing an overlap extension PCR technology, and hydrolysis beech xylan pre-test shows that N-terminal mutant enzymes XynAN, XynAR and XynAS hydrolysis products are obviously changed. Compared with XynA, the optimum temperatures of XynAS and XynAR are respectively increased by 10 ℃ and 15 ℃ to 70 ℃ and 75 ℃, the residual enzyme activity of XynAR is still more than 90% after the XynAR is subjected to heat preservation for 30min at 80 ℃, the half-life period of XynAS is increased by 2.5 times at 60 ℃ to 210.0min, the temperature stability of the XynAS and the XynAR is remarkably improved, and the XynA has application value.

Drawings

FIG. 1 three-dimensional structural modeling and evaluation of Streptomyces rameus L2001 xylanase XynA.

Note: yellow is the catalytically active site (87, 177). Wherein A is a three-dimensional structure simulating XynA, B is a pull chart, and C is an amino acid scoring chart.

FIG. 2 Streptomyces rameus L2001 xylanase XynA and a xylohexaose molecule are docked. Wherein, A is to carry out molecular docking on the processed XynA and the xylohexaose by using CDOCKER, and B is to carry out sub-site division and analysis on amino acid with interaction force with the xylohexaose after docking, and the sub-sites are respectively-3 to + 3.

FIG. 3 agarose electrophoresis picture of 1% of XynAR. Wherein, lane 1-8: the lower fragment of XynAR; lanes 9-12: an upper segment of XynAR; lanes 13-16: XynAR (576 bp).

Figure 4 XynA and 3 mutant hydrolysis products of zelkova.

FIG. 5 SDS-PAGE electrophoresis of XynA and 3 mutants. Wherein, lane 1: XynA (molecular weight about 20.8kDa), lane 2: purified XynA, lane 3: XynAR (molecular weight about 21.0kDa), lane 4: purified XynAR, lane 5: XynAS (molecular weight about 20.8kDa), lane 6: purified XynAS, lane 7: XynAN (molecular weight about 21.0kDa), lane 8: and purifying XynAN.

FIG. 6 determination of the optimum pH (A) and pH stability (B) of XynA and mutant enzymes. Wherein A is the result of measuring the optimum pH of the enzyme, and B is the result of measuring the pH stability of the enzyme.

FIG. 7 XynA (C) and determination of the optimum temperature of the mutant enzyme.

FIG. 8 determination of temperature stability of XynA (C) and mutant enzymes (A, B).

FIG. 9 XynAN (A), XynAR (B), XynAS (C) and XynA (D) half-life determinations.

FIG. 10 product assay and TLC chart for XynA hydrolysis of different substrates. Wherein, A and B are respectively XynA hydrolyzed birch xylan product determination and TLC chart, C and D are hydrolyzed beech xylan product determination and TLC chart, and E and F are hydrolyzed oat xylan product determination and TLC chart.

FIG. 11 product determination and TLC chart of XynAR hydrolysis of different substrates. Wherein, A and B are respectively a product determination and TLC chart of hydrolyzed birch xylan, C and D are respectively a product determination and TLC chart of hydrolyzed beech xylan, and E and F are respectively a product determination and TLC chart of hydrolyzed oat xylan.

FIG. 12 product determination and TLC patterns of XynAS hydrolysis of different substrates. Wherein, A and B are respectively a product determination and TLC chart of hydrolyzed birch xylan, C and D are respectively a product determination and TLC chart of hydrolyzed beech xylan, and E and F are respectively a product determination and TLC chart of hydrolyzed oat xylan.

FIG. 13 product determination and TLC chart of XynAN hydrolysis of different substrates. A and B are respectively the product assay and TLC pattern of hydrolyzed birch xylan, C and D are the product assay and TLC pattern of hydrolyzed beech xylan, and E and F are the product assay and TLC pattern of hydrolyzed oat xylan.

Detailed Description

The invention is further illustrated by the following specific embodiments or examples in order to provide a better understanding of the invention.

1. Experimental Material

(1) Strains, genes, plasmids and competent cells

Rochei L2001 is deposited by the high-precision innovation center for food nutrition and human health in beijing; the recombinant xylanase XynA (a target gene with a signal peptide sequence cut off) derived from Streptomyces rochei L2001G 11 is preserved in the high-precision innovation center of Beijing food nutrition and human health; the cloning vector pMD18-T is from TaKaRa; plasmid pET-28a (+) was purchased from Novagen; competent cells E.coli DH-5. alpha. and E.coli BL21(DE3) were purchased from Tiangen Biochemical technology, Inc.

(2) Enzymes and chemical reagents

Restriction enzymes NcoI and XhoI,

High-Fidelity DNA super-Fidelity, T4DNA ligase and LA Taq polymerase were purchased from NEB, USA; taq polymerase was purchased from Takara; antibiotics Ampicillin Na (Amp) and Kanamycin sulfate (Kan) were purchased from Biotopped; the Plasmid Miniprep Kit was purchased from Biomiga corporation; the Gel Extraction Kit was purchased from Omega; beechwood xylan (Beechwood xylan) was purchased from Megazyme corporation; birchwood xylan (Birchwood xylan) and oat xylan (Oat-spelt xylan) were purchased from Sigma; xylose (Xylose, X1) was purchased from Biotopped; xylobiose (Xylobiose, X2), Xylotriose (Xylotriose, X3), Xylotetraose (Xylotetraose, X4) and Xylopentaose (Xylopentaose, X5) were all available from Megazyme corporation; other conventional reagents are imported or domestic analytical reagents.

(3) Instrument for measuring the position of a moving object

TU-1901 double-beam ultraviolet-visible spectrophotometer, Beijing general analysis general instruments, Inc.; waters e2695Alliance HPLC-2414 detector, Waters corporation; EPS301 agarose gel electrophoresis apparatus, GE corporation, usa; YXQ-LS-50SII vertical pressure steam sterilizer, Shanghai Boxun industries, Inc. medical facilities; HR60-IIA2 biosafety cabinet, Qingdao Haier Special appliances, Inc.; constant temperature incubator, shanghai STIK corporation; T100-Thermal cycler PCR instrument, Bio-Rad, USA; XO-650 ultrasonic cell disruptor, Nanjing pioneer Europe Instrument manufacturing Co., Ltd; microfuge 20R desk microcentrifuge, Beckman, germany; ImageQuant 300 gel imager, GE, USA.

2. Construction strategy of xylanase XynA N-terminal mutant

(1) Xylanase XynA three-dimensional model construction and N-terminal xylanase mutant strategy

The xylanase XynA three-dimensional structure was simulated using Discovery Studio 2018 software with XlnB2(ID:5ej3) and thermophilic GH11 xylanase (ID:3zse) as templates and the model was evaluated by pull-chart and amino acid scoring. The three-dimensional structure of XynA (A in figure 1) is simulated, and the model is reliably established by analyzing a pull chart (B in figure 1) and an amino acid score (C in figure 1), so that the model can be used for subsequent research.

As shown in fig. 2, (a) treated XynA and xylohexaose are subjected to molecular docking by CDOCKER, and (B) subsite division and analysis of amino acids having interaction force with xylohexaose are performed after docking, and the subsites are-3 to +3 subsites respectively. It has been reported in the literature that the substrate binding sites of xylanases can be divided into a series of subsites, labeled-n and + n. The negative number represents a substrate recognition site at the non-reducing end of the sugar chain, and the positive number represents a product release site at the reducing end of the sugar chain^[3]. It is preliminarily thought that when xylanase is combined with a substrate, a binding site needs to form a binding force with the xylan substrate to maintain the catalytic transition form of the xylanase and the substrate, and then the combined xylan is placed on the catalytic site to generate different hydrolysis products under a double-displacement catalytic reaction mechanism.

(2) N-terminal xylanase mutant strategy

(a) XynAN: releasing more oligosaccharide products based on the mutant enzyme NTfus with a wider range of substrate selectivity and T-XynF^[9]Shows that the stronger substrate conversion rate increases the glucosideThe concentration of the molecule thus enhances the investigation of transglycosidic activity. XynA and 2CIF are subjected to sequence comparison, AFTVGNGQ is used for replacing ATVVTT, an overlap extension PCR method is adopted for carrying out target gene amplification, and primers with enzyme cutting sites are designed as follows:

S11NF1(NcoI)5’-3’:

CATGCCATGGCCTTCACCGTTGGTAACGGTCAGAACCAGACCGGCACCGACAAC

1S11R1(XhoI)5’-3’:

CCGCTCGAGCGACGACACCGTGATATTGGAGTTG

(b) XynAR: by comparing sequences of the heat-resistant xylanase TfxA and XynA, five amino acids in a key Region (Region 2) are replaced, the heat resistance of XynA is improved, the influence of the XynA on the hydrolysis characteristic of the xylanase is researched, and the TDNGFY is changed into YHDGYF, namely T11Y, D12H, N13D, F15Y and Y16F form a mutant XynAR. Adopting the overlap extension PCR technology to amplify the target gene, and designing the primer with the enzyme cutting site as follows:

XynARF 5’-3’:GACCGGCTACCACGACGGCTACTTCTA

XynARR 5’-3’:AGAACGAGTAGAAGTAGCCGTCGTGGTAGC

(c) XynAT and XynAS: obtaining two enzymes at R by comparing heat-resistant xylanase TfxA and XynA sequences₄The difference of the related genes of the regions, namely the difference between the 30 th site and the 33 th site, is that the two sites are mutated T30E and S33P to obtain two mutants XynAT and XynAS. The target gene amplification is carried out by adopting an overlap extension PCR method, and a primer with an enzyme cutting site is designed as follows:

S11TF1 5’-3’:GCACGGTCTCGATGGAGCTGG

S11TR1 5’-3’:CCACCGGAGCCCAGCTCCATC

S11SF1 5’-3’:GATGACCCTGGGCCCCGGTG

S11SR1 5’-3’:GCTCTAGTTGCCACCGGGGCC。

(note: XynAT has no obvious effect in hydrolysis preliminary experiment, so subsequent property research is not carried out on the XynAT).

(3) Xylanase XynA and acquisition of mutant genes

Based on the results of the bioinformatics analysis, the above mutation strategies were drawn up and primers were designed. Extracting plasmid containing XynA target fragment in E.coli DH-5 alpha, using the plasmid as a template in PCR reaction, and mutating by adopting overlap extension PCR technology. Wherein the full-length primer with the enzyme cutting site is as follows:

1S11F2:CATGCCATGGCCACGGTCGTCACCACGAAC

1S11R1:CCGCTCGAGCGACGACACCGTGATATTGGAGTTG。

PCR conditions for full-length amplification: pre-denaturation at 94 deg.C for 5min, denaturation at 94 deg.C for 30s, annealing at 65 deg.C for 30s, extension at 72 deg.C for 30s, circulation for 35 times, and extension at 72 deg.C for 10 min.

TABLE 1 PCR reaction System (50. mu.L)

Primers designed for each mutant enzyme at the N-terminal are subjected to PCR amplification by using an overlap extension PCR technology to obtain each DNA fragment, taking XynAR as an example, as shown in FIG. 3.

(2) Expression vector pET-28a, target gene XynA and each mutant double enzyme digestion and connection

Carrying out double enzyme digestion on target genes with enzyme digestion sites NcoI and XhoI and an expression vector pET-28a, wherein the reaction system of the double enzyme digestion is shown in table 2, and the reaction condition is that the temperature is kept at 37 ℃ for 3-4 h. And (3) carrying out 1% (m/v) agarose gel electrophoresis detection on the enzyme digestion product, and purifying by using a gel recovery kit to obtain the target gene with the sticky end and a linearized expression vector pET-28 a.

TABLE 2 double digestion system of target gene and expression vector pET-28a

The DNA fragment and the expression vector pET-28a obtained in the way are respectively subjected to double enzyme digestion and gel recovery by adopting restriction enzymes NcoI and XhoI, and the target gene and pET-28a are connected by using T4DNA ligase after recovery to obtain recombinant plasmids pET-28a-XynA, pET-28a-XynAR, pET-28a-XynAN, pET-28a-XynAS and pET-28a-XynAT with the target gene.

3. Transformation and verification of recombinant plasmid pET-28a-Xyn

After the expression vector is used for transforming competent cells E.coli DE3, randomly picking the clonon an LB resistance screening plate in a screening plate for colony PCR verification, picking part of colonies in a prepared PCR system under the aseptic condition, sucking and uniformly mixing the colonies to serve as an amplification template. And selecting a target gene full-length primer as an upstream primer and a downstream primer for PCR amplification. The PCR reaction conditions are as follows: pre-denaturation at 94 deg.C for 5min, denaturation at 94 deg.C for 30s, annealing at 62 deg.C for 30s, extension at 72 deg.C for 30s, circulation for 35 times, and extension at 72 deg.C for 10 min. The colony PCR product is detected by 1% (m/v) agarose gel electrophoresis and sent to a sequencing company for sequencing. And (5) the sequencing result is consistent with the target gene sequence, and the glycerol tube is stored on the sample with correct sequencing.

4. Induction expression of recombinase XynA and N-terminal mutant enzyme

(1) Activating the seed liquid: inoculating bacterial liquid stored in glycerin tube with correct sequencing result to solution containing 40 mu g/mL Kan⁺The activated medium was cultured in 5mL of LB liquid medium at 37 ℃ and 200r/min for 12 hours to prepare a seed solution.

(2) And (3) amplification culture: transferring the activated bacterial liquid to a strain containing 40 mu g/mL Kan according to the inoculation amount of 1 percent⁺In 100mL of LB liquid medium, the medium was cultured at 37 ℃ at 2000r/min to OD₆₀₀The value is 0.6-0.8.

(3) Inducing enzyme production: under the aseptic condition, IPTG is added into the expanded culture bacterial liquid until the final concentration is 0.5mmol/L, and the recombinant xylanase is induced and expressed for 14-16h by shaking culture at 20 ℃ and 200 r/min.

(4) Obtaining a crude enzyme solution: centrifuging the cultured bacterial liquid at 10000rpm and 4 ℃ for 5min to collect thalli, discarding supernatant and collecting thalli precipitate. Resuspending the thallus with 10mL of 0.05mol/L sodium citrate buffer solution with pH of 6.0, breaking the wall by ultrasonic for 15min, and centrifuging at 10000rpm and 4 ℃ for 5min to obtain the supernatant, namely the crude enzyme solution.

5. Recombinase XynA and N-terminal mutase hydrolysis preliminary experiment

To characterize the hydrolysis of xylanase, a solution containing 500 μ L of reaction mixture, 10mg/mL of beech xylan substrate and 5U/mL of xylanase crude enzyme in 50mM citrate buffer pH 6.0, was incubated at 30 ℃ for 8h, then boiled for 10min and cooled in an ice-water bath and centrifuged.

The samples were centrifuged and filtered through a 0.22 μm membrane filter and analyzed by Waters series HPLC using KS-802 column equipped with Waters 2695 differential detector (RI). The chromatographic conditions are as follows: the column temperature is 65 ℃, the mobile phase is high-purity water, the flow rate is 0.6mL/min, the sample introduction time is 20min, and the sample introduction amount is 10 mu L. X1, X2, X3, X4, X5 were used as standards. The results are shown in figure 4, compared with the orthoenzyme, when the beech xylan is hydrolyzed for 4h, the yield of the xylobiose in the XynAR hydrolysate is increased by 85 percent, and the yield of the xylotriose is increased by 80 percent; the yield of xylobiose in XynAS hydrolysate is increased by 32%, the yield of xylotriose is increased by 33%, and the yield of xylotetraose is increased by 53%; the yield of xylobiose in XynAN hydrolysate is increased by 56%, and the yield of xylotriose is increased by 20%. According to the result of hydrolyzing zelkoxysan, the N-terminal mutant enzymes XynAN, XynAR and XynAS hydrolysis products are obviously changed, and the three mutant enzymes are used for subsequent research.

6. Purification of recombinase XynA and N-terminal mutant enzyme

Using Ni column (Ni sepharose HP column, 1X 10cm) and

and the protein purification system is used for purifying the recombinant xylanase. (1) Column balancing: the column was flushed with equilibration Buffer (Binding Buffer) until the baseline was stable. (2) Loading: the sample of the water system membrane with 0.22 mu m is firstly injected into a collection tube to temporarily store the sample, and the sample is automatically loaded when the column is balanced. (3) Removing impurities and eluting: washing the chromatographic column with balanced buffer solution to eliminate non-specific combined protein, gradient eluting the recombinant protein with eluting buffer solution containing different imidazole concentrations while detecting A280 value, collecting the liquid in the eluting peak and storing at 4 deg.c. And (3) determining the protein concentration of the non-mutated and mutated recombinant xylanase before and after purification by using a BCA protein concentration kit, and performing SDS-PAGE polyacrylamide gel electrophoresis verification on a proper amount of enzyme solution, wherein the concentration of the separation gel is 12.5% (w/v), and the concentration of the concentrated gel is 4.5% (w/v).

The results are shown in table 3, which shows that the specific enzyme activities of XynAR and XynAS are improved and the specific enzyme activity of XynAN is reduced compared with the original enzyme. 10 mu g of recombinant xylanase pure enzyme solution is taken and subjected to SDS-PAGE electrophoresis detection, as shown in figure 5, each enzyme is successfully expressed, the protein band is single, and the electrophoretically pure enzyme solution is successfully obtained and can be used for the research of enzymology properties.

TABLE 3 specific enzyme Activity of Proenzyme and mutant enzyme pure enzyme solutions

7. Enzyme activity assay

The enzyme activity of the recombinant xylanase is determined by referring to a DNS method. The xylanase enzyme activity determination reaction system comprises 0.9mL of 1% (w/v) beech xylan substrate prepared by corresponding buffer solution, preserving heat for 5min, adding 0.1mL of enzyme solution diluted properly, and reacting for 10min at 55 ℃. The reaction was stopped by adding 1mL of DNS solution, boiling in a water bath for 15min, cooling and centrifuging, adding 1mL of 40% (w/v) potassium sodium tartrate tetrahydrate solution, measuring absorbance at 540nm, and calculating the amount of reducing sugar (in terms of xylose) using a xylose calibration curve. 1 xylanase activity unit (U) is defined as: the amount of enzyme required to hydrolyze xylan to 1. mu. mol xylose per minute under the experimental conditions described above.

8. Determination of optimum reaction pH and pH stability

(1) Determining the effect of pH on enzyme activity, selecting a buffer at pH 3.0-9.0(50 mM): the pH value of citrate buffer solution is 3.0-6.5, the pH value of barbital sodium buffer solution is 7.0-9.0, and the enzyme activity is measured at the temperature of 37 ℃. The highest xylanase activity is defined as 100%, the relative enzyme activity at different pH values is calculated, and the curve of the relative enzyme activity along with the change of the pH value is drawn.

The results of the measurement of the optimum pH of the enzyme are shown in A in FIG. 6, the optimum reaction pH of the proenzyme XynA is 6.0, the optimum pH of the mutant enzyme XynAR is 6.0 consistent with that of the proenzyme, the optimum pH of XynAN is reduced to 4.5 and is more acidic, and the optimum pH of XynAS is slightly reduced to 5.0.

(2) And (3) measuring the pH stability of the enzyme, namely, putting the enzyme into the buffer solutions with different measured pH values, keeping the temperature for 30min at 37 ℃, and measuring the residual enzyme activity under the conditions of 37 ℃ and the optimal pH value after ice-water bath for 30 min. And (3) defining the enzyme activity measured by the enzyme without heat preservation treatment as 100%, calculating the residual enzyme activity, and drawing a curve of the residual enzyme activity along with the change of the pH value.

The measured result is shown as B in figure 6, when the pH value is 3.0-5.0, the residual enzyme activities of mutant enzymes XynAR and XynAS can reach more than 60%, the stability of XynAN is in a rising trend along with the rising of the pH value, when the pH value is 4.0, the residual enzyme activity can reach more than 80%, but the residual enzyme activity of the original enzyme at the pH value of 3.0-4.5 is not more than 20%. Under the condition of pH 5.0-9.0, the change trend of the residual enzyme activity of the recombinant xylanase is basically consistent, and the residual enzyme activity can be kept above 80%. Compared with proenzyme, the N-terminal mutase has wide pH stability range, mainly reflects that the pH tolerance is enhanced under an acidic condition, and is more acid-resistant, which shows that the N-terminal sequence mutation has larger influence on the pH of the enzyme and is easier to change the pH stability of the enzyme.

9. Determination of optimum reaction temperature and temperature stability

(1) Determination of optimum reaction temperature

Measuring the influence of temperature on enzyme activity, selecting 20-90 deg.C, and measuring at optimum pH with a temperature gradient of every 5 deg.C. The highest xylanase activity is defined as 100%, the relative enzyme activity at different temperatures is calculated, and a curve of the relative enzyme activity with the temperature is drawn.

The optimum temperature measurement result is shown in figure 7, the optimum reaction temperature of the recombinant proenzyme XynA is 60 ℃, the optimum temperature is 15 ℃ higher than that of the proenzyme and the N-terminal mutant enzyme XynAR, and the optimum temperature is 75 ℃; the optimum temperature of XynAS is increased by 10 ℃ and is 70 ℃; the optimum temperature of XynAN is reduced by 20 ℃ and is 40 ℃.

(2) Measurement of temperature stability

Measuring the temperature stability of enzyme, respectively placing the enzyme at 20-80 deg.C and keeping the temperature for 30min (at optimum pH), then ice-water bathing for 30min, and measuring the residual enzyme activity at optimum temperature and optimum pH. The enzyme activity measured by the enzyme without heat preservation treatment is defined as 100%, and a curve of the change of the residual enzyme activity along with the incubation temperature is drawn.

As can be seen from FIG. 8, the temperature is kept at 65 ℃ for 30min, the residual enzyme activity of the original enzyme XynA is less than 20%, the residual enzyme activity of XynAS can still reach more than 60%, the residual enzyme activity of XynAR still is about 100%, and after the temperature is kept at 80 ℃ for 30min, the residual enzyme activity still keeps more than 60%, and the heat resistance of XynAS and XynAR is obviously improved; and the XynAN is kept at 45 ℃ for 30min, the residual enzyme activity of the XynAN is rapidly reduced to less than 60%, the residual enzyme activity is less than 5% at 60 ℃, and the heat resistance is obviously reduced.

Therefore, the temperature of the 3 mutant enzymes at the N end is greatly changed, wherein the temperature stability of XynAR and XynAS is obviously improved, and the temperature stability of XynAN is obviously reduced.

10. Half life

In order to eliminate the influence of protein concentration on the heat stability of the recombinant xylanase, the protein concentration of the pure enzyme solution is diluted to 0.5mg/mL, and the pure enzyme solutions of recombinant enzymes XynAN, XynAS and XynA are respectively taken and are quickly cooled after being subjected to heat preservation for different time at 60 ℃; the pure XynAR enzyme solution is quickly cooled after being kept at 80 ℃ for different time. The preliminary experiment result shows that the thermal stability of XynAN is poor, so the heat preservation time is selected as follows: 0. 10s, 20s, 30s, 40s, 50s, 60 s. The XynA has strong thermal stability and the heat preservation time is as follows: 0.15 min, 30min, 60min, 90min, 120min and 180 min. XynAS heat preservation time: 0. 30min, 60min, 90min, 120min, 180min and 360 min. XynAR heat preservation time: 0. 30min, 60min, 90min, 120min, 180min, 240min, 300min and 360 min. Drawing the time variation curve y ═ A × e of enzyme activity^-kt(A is the initial enzyme activity, t is the time, k is the decay constant), i.e.the half-life t_1/2Ln 2/k. According to the formula, the half-lives of the recombinant xylanase before and after mutation at 60 ℃ or 80 ℃ are calculated respectively.

The results are shown in fig. 9, the half-life periods of XynA, XynAN and XynAS at 60 ℃ are 84.5min, 21.9s and 210.0min respectively, and the residual enzyme activity of XynAR is still over 90% after the XynAR is kept at 60 ℃ for 12h, so that the XynAR is kept at 80 ℃ for different times, and the calculated half-life period is 154.0 min.

As can be seen from Table 4, compared with XynA, the half-life period of XynAN is reduced by 231.5 times, the thermal stability of the enzyme is significantly reduced, the result is consistent with the measurement result of early temperature stability, the N terminal is the initial terminal of enzymolysis folding, and the N terminal sequence 'AFTVGNGQ' replaces 'ATVVTT', which is not beneficial to the stability of the enzyme. XynThe half-life period of AR and XynAS is obviously increased, and is consistent with the result obtained by the temperature stability experiment, R₂Five and 33 sites of the region are also located at the N-terminus, but the thermostability of the enzyme is improved by mutation of this region.

TABLE 4 XynA and determination of half-life of mutant enzymes

11. Substrate specificity

And (3) determining the substrate specificity of the enzyme, namely taking 1% of beech xylan, birch xylanase and oat xylan as substrates respectively, and determining the enzyme activity by adopting the DNS method when the recombinant xylanase is at the optimal reaction pH value and the optimal reaction temperature.

As can be seen from Table 5, the substrate specificity of the N-terminal mutant was unchanged, consistent with the proenzyme, showing the greatest activity on beech xylan, the second lowest on birch xylan and the lowest on oat xylan. When the zelkova xylan is used as a substrate, the specific enzyme activities of XynAS and XynAR are 1983.0U/mg and 2589.5U/mg respectively, which are respectively improved by 46 percent and 91 percent compared with the original enzyme, and the specific enzyme activity of XynAN is 327.0U/mg, which is reduced by 76 percent compared with the original enzyme. When the birchwood xylan is used as a substrate, compared with the proenzyme, the XynAS and XynAR specific enzyme activities are respectively improved by 22 percent and 108 percent, and the XynAN specific enzyme activity is reduced by 84 percent. When the oat xylan is used as a substrate, compared with the original enzyme, the specific activity of only XynAR is improved by 80%, the specific activity of other mutant enzymes is reduced, and the specific activity of XynAN is only 25.8U/mg.

TABLE 5 determination of XynA and mutant enzyme substrate specificity

12. Enzymatic kinetics

Preparing substrate solutions of the zelkova xylan with six different concentrations, selecting the optimal reaction pH value and the optimal reaction temperature of the recombinant xylanase, determining the enzyme activity of the recombinant xylanase, and calculating the recombinant xylan through Graphpad Prism 5 softwareKinetic parameter K of the enzymatic reaction of an enzyme_m、V_maxAnd k_cat。

The results of the enzymatic kinetic constant determination are shown in table 6, and compared with the proenzyme, the affinity of XynAN and XynAN to the substrate is increased, the catalytic efficiency of XynAN is improved, and the catalytic efficiency of XynAN is reduced; the affinity of XynAR to the substrate is reduced, but the catalytic efficiency of XynAR is improved. The change of the catalytic efficiency is probably related to the mutation site and the amino acid distance of the active center, so that the specific enzyme activities of XynAS and XynAR are improved, and the specific enzyme activities of XynAN are reduced. It can be seen that the N-terminal R is required for the binding of xylanase substrates₂Five amino acids of the region, and the sequence extending from the N-terminus, S33P, facilitate binding of xylanase substrates. S33P, R₂The mutation of the region is beneficial to improving the catalytic capability of the enzyme.

TABLE 6 determination of XynA and mutant enzyme enzymatic kinetic parameters

13. Study of hydrolysis characteristics

Respectively taking xylan (beechwood xylan, birch xylan, oat xylan) and xylooligosaccharide (X2-X5) as substrates to carry out hydrolysis reaction, wherein the residual enzyme activity of each enzyme at 30 ℃ can reach more than 90%, so that 30 ℃ is selected as hydrolysis temperature.

Xylan: to characterize the hydrolysis of xylanase, a reaction mixture containing 500. mu.L of 10mg/mL xylan substrate and 5U/mL xylanase in 50mM citrate buffer pH 6.0 was incubated at 30 ℃ at 150rpm for 0, 15min, 30min, 1h, 2h, 4h, 8h, then boiled for 10min and cooled in an ice-water bath and centrifuged.

And (3) xylo-oligosaccharide: comprises 150. mu.L of a reaction system containing 0.1 mg/mL^-1Substrate, 5U/mL xylanase, incubated at 30 ℃ 150rpm for 0, 15min, 30min, 1h, 2h, 4h, 8h, then boiled for 10min and cooled in an ice water bath and centrifuged.

HPLC: referring to the previous examples, all experiments were performed in triplicate.

Thin Layer Chromatography (TLC) analysis: the sample was spotted on a silica gel plate (Merck) and developed twice in butanol-acetic acid-water (2:1:1, v/v/v) solvent, and then the plate was sprayed with a solution of a mixture of methanol and sulfuric acid (95:5, v/v) for a few seconds and then heated at 105 ℃ for a few seconds. X1, X2, X3, X4 and X5 were used as standards.

(1) XynA hydrolyzed xylan

As can be seen from fig. 10, XynA hydrolyzes birch xylan and zelkova xylan to mainly produce xylobiose, xylotriose and xylotetraose, and the ratios of hydrolysis for 8 hours were 47.8%, 45.3%, 6.9%, and 46.4%, 44.9%, and 8.7%, respectively. Along with the prolonging of the hydrolysis time, xylobiose has a tendency of increasing, xylotetraose has a tendency of decreasing, xylotriose has a tendency of increasing and then decreasing, and finally, the xylotriose is kept stable to generate a small amount of xylose. The total amount of xylooligosaccharide (X2+ X3+ X4+ X5) produced by XynA hydrolysis of birch xylan and beech xylan increases with time, and reaches 2.10mg/mL and 2.72mg/mL respectively when hydrolysis is carried out for 8 h. The XynA hydrolyzes birch xylan and zelkova products with the same rules, probably because the structures are similar.

Unlike hydrolysis of birch xylan and zelkova xylan, XynA hydrolyzes oat xylan, mainly producing xylobiose, xylotriose, xylotetraose and xylopentaose, which account for 32.0%, 30.2%, 9.4%, 28.3% when hydrolyzed for 8h, respectively. As the hydrolysis time was prolonged, xylobiose showed an increasing tendency, xylotetraose did not change much, xylotriose showed a tendency to increase first and then decrease, xylopentaose showed an increasing tendency, produced a small amount of xylose and showed an increasing tendency. The total amount of xylooligosaccharide (X2+ X3+ X4+ X5) increases with time, and the hydrolysis time is 8h to reach 3.81 mg/mL. It follows that XynA hydrolyses oat xylan differently from the main products of birch and zelkoxy xylan hydrolysis, due to the difference in xylan structure and DP.

(2) Xynar hydrolyzed xylan

As can be seen from fig. 11, XynAR hydrolyzes birch xylan and zelkova xylan to mainly generate X2, X3, and X4, and the ratios of the hydrolysis products are 45.9%, 48.7%, 5.4%, and 46.4%, 48.1%, and 5.5%, respectively, when the hydrolysis is performed for 8 hours, the product composition ratio changes as compared with the original enzyme, the ratio of X3 increases, the ratio of X4 decreases, and the hydrolysis products and the hydrolysis rules of XynAR hydrolyzes two kinds of xylan are similar. XynAR hydrolyzed birch xylan for 8h, X2(1.44mg/mL) increased 48% compared with proenzyme (0.97mg/mL), and X3(1.53mg/mL) increased 66% compared with proenzyme (0.92 mg/mL); XynAR hydrolyzed zelkova to 8h, X2(1.69mg/mL) increased 49% over the proenzyme (1.22 mg/mL); x3(1.75mg/mL) was increased by 60% over the proenzyme (1.18 mg/mL). The products all contain small amount of X1 and X5, and the generation time of X1 is advanced compared with that of proenzyme. XynAR hydrolyzed birch and beech xylan 2h reached the highest total amount of xylooligosaccharide (X2+ X3+ X4+ X5) of 3.35mg/mL and 3.70mg/mL, respectively, which was increased by 60% and 36% over the original enzyme (2.10mg/mL and 2.72mg/mL), respectively. Compared with the proenzyme, the XynAR hydrolysis efficiency is obviously improved.

XynAR hydrolyzes oat xylan, mainly generates X2, X3, X4 and X5, hydrolyzes for 8 hours, the ratio is respectively 38.9%, 32.3%, 0% and 28.9%, compared with the prior enzyme, the proportion of the product composition is changed, and the ratio of X4 is reduced; the main products and ratios differ significantly compared to their hydrolyzed birch and beech xylans, probably because oat xylans differ in structure from beech and birch xylans. Hydrolysis for 8h, and the content of X1(0.41mg/mL) is increased by 64% compared with the original enzyme (0.25 mg/mL); the increase of X2(2.41mg/mL) is 98% compared with proenzyme (1.22 mg/mL); the increase of X3(2.00mg/mL) is 74% compared with the proenzyme (1.15 mg/mL); x5(1.79mg/mL) was increased by 66% over the proenzyme (1.08 mg/mL). The total amount of xylooligosaccharide (X2+ X3+ X4+ X5) increases with time, reaches 6.21mg/mL after 8h of hydrolysis, and is 63% higher than that of the original enzyme (3.81 mg/mL). Compared with the original enzyme hydrolysis for 8h (3.81mg/mL), the total amount of xylooligosaccharide (X2+ X3+ X4+ X5) is increased by 41 percent by 15min (5.39mg/mL) of XynAR hydrolysis, and the XynAR has higher hydrolysis yield on xylan containing larger arabinose residues. Li and the like^[20]Disulfide bonds are introduced into 27 and 39 sites of the N end of the acidic xylanase Pjxyn (pH 4.0) to obtain a mutant enzyme Pjxyn S (27) S (39), the optimal temperature of the mutant enzyme is increased by 2 ℃, the product of the Pjxyn S (27) S (39) is increased in xylose (87.62%) and increased in xylobiose (56.65%) by taking the zelkoxyn as a substrate, and the hydrolysis characteristic is improved.

In conclusion, compared with the original enzyme, the XynAR hydrolysis efficiency is obviously improved, the time is shortened, the yield is improved, the capability of producing xylobiose and xylotriose is obviously enhanced, and the five sites in the R region are key non-functional regions influencing the hydrolysis of xylan into xylobiose and xylotriose.

(3) XynAS hydrolyzed xylan

As can be seen from fig. 12, XynAS hydrolyzes birch xylan and zelkova xylan to mainly produce X2, X3, and X4, and when the hydrolysis is performed for 8 hours, the ratios of the X2, X3, and X4 are 44.8%, 45.9%, 9.3%, and 42.3%, 47.8%, and 9.9%, compared with the original enzyme, the composition ratio of the product changes, mainly reflected in that the ratio of X2 decreases, the ratio of X4 increases, and the products both contain a small amount of X1 and X5, and the hydrolysis products of both xylans by XynAS have similar rules. XynAS hydrolyzes birch xylan for 8h, X1(0.047mg/mL) is reduced by 21.7% compared with proenzyme (0.060mg/mL), X2(0.87mg/mL) is reduced by 10% compared with the proenzyme (0.97mg/mL), X4(0.18mg/mL) is increased by 28.6% compared with the proenzyme (0.14mg/mL), X5(0.12mg/mL) is increased by 71.4% compared with the proenzyme (0.07mg/mL), hydrolysis is carried out for 2h, the total amount of xylooligosaccharide (X2+ X3+ X4+ X5) reaches 2.42mg/mL at most, and the hydrolysis efficiency is improved by 19.8% compared with the proenzyme (2.02 mg/mL).

The XynAS hydrolyzes beech xylan for 8h, X1(0.03mg/mL) is reduced by 50% compared with the proenzyme (0.06mg/mL), X4(0.27mg/mL) is increased by 17% compared with the proenzyme (0.23mg/mL), X5(0.06mg/mL) is reduced by 33% compared with the proenzyme (0.09mg/mL), the hydrolysis time is 2h, X3 reaches the maximum of 1.36mg/mL, the increase is 16% compared with the proenzyme (1.17mg/mL), XynAS hydrolyzes for 30min, and the total amount (2.51mg/mL) of xylooligosaccharide (X2+ X3+ X4+ X5) is equivalent to 2h (2.48mg/mL) of the proenzyme hydrolysis, so that the XynAS hydrolysis efficiency is improved.

The XynAS hydrolyzes oat xylan, mainly produces X2, X3, X4 and X5, the percentage of the oat xylan is 33.2%, 30.8%, 9.6% and 26.5% when the oat xylan is hydrolyzed for 8 hours, and compared with the birch xylan and the beech xylan, the oat xylan hydrolyzes the main products and the percentage are obviously different. Hydrolysis was carried out for 8h, X3(1.51mg/mL) was increased by 31% as compared with the proenzyme (1.15mg/mL), X4(0.47mg/mL) was increased by 31% as compared with the proenzyme (0.36mg/mL), X5(1.30mg/mL) was increased by 20% as compared with the proenzyme (1.08mg/mL), and the total amount (4.91mg/mL) of xylooligosaccharide (X2+ X3+ X4+ X5) was increased by 29% as compared with the proenzyme (3.81 mg/mL). Compared with the xylo-oligosaccharide (X2+ X3+ X4+ X5) hydrolyzed by the orthoenzyme for 8 hours (3.81mg/mL), the XynAS hydrolysis time of 1 hour (4.20mg/mL) is higher, and the hydrolysis efficiency is improved.

In conclusion, compared with the proenzyme, the XynAS hydrolysis efficiency is improved, not only is the time shortened, but also the yield is improved, and the capability of generating the xylotetraose is enhanced, which indicates that the 33 sites may be key non-functional areas influencing the hydrolysis of xylan to generate the xylotetraose.

(4) Xynan hydrolyzed xylan

As can be seen from fig. 13, XynAN hydrolyzes birch and beech xylan to produce mainly X2, X3, and X4, the products all produce small amounts of X1 and X5, and the ratios of the products are 51.0%, 40.9%, 8.2%, and 50.8%, 43.3%, and 6.0% when the hydrolysis is carried out for 8 hours, compared with the proenzyme, the product composition ratio is changed, and mainly the ratios of X2 and X4 (birch xylan) are increased, and the ratio of X3 is decreased. When birch xylan is hydrolyzed for 8 hours, X1(0.073mg/mL) is increased by 21.7 percent compared with proenzyme (0.060mg/mL), X2 is increased by 1.06mg/mL, X3 is increased by 0.85mg/mL, X4(0.17mg/mL) is increased by 21.4 percent compared with the proenzyme (0.14mg/mL), and the total amount of xylooligosaccharide (X2+ X3+ X4+ X5) is increased by 2.16 mg/mL. XynAN hydrolyzes for 15min, the yield (1.71mg/mL) of xylooligosaccharide (X2+ X3+ X4+ X5) is higher than that of the primary enzyme hydrolyzation for 1h (1.57mg/mL), and the XynAN hydrolyzation efficiency is improved.

XynAN hydrolyzes beech xylan for 8h, X2 reaches 1.28mg/mL, X3 reaches 1.09mg/mL, X4(0.15mg/mL) is reduced by 35% compared with proenzyme (0.23mg/mL), X5(0.065mg/mL) is reduced by 25% compared with proenzyme (0.087mg/mL), and the total amount of xylooligosaccharide (X2+ X3+ X4+ X5) reaches 2.58 mg/mL. The hydrolysis of XynAN is the same for two xylan hydrolysates, but the hydrolysis rules are different. Since XynAN is sensitive to subtle differences between the two xylans, differences may result between the hydrolysis products of the two substrates.

XynAN hydrolyzes oat xylan, mainly produces X2, X3, X4 and X5, the percentage of the oat xylan is 38.9%, 24.9%, 6.1% and 30.0% when the oat xylan is hydrolyzed for 8 hours, compared with the birch and beech xylan hydrolyzates, the main products and the proportion are obviously different, compared with the primary enzyme, the hydrolysate is different in proportion, the X2 and X5 are increased in proportion, and the X3 and X4 are reduced in proportion. After hydrolysis is carried out for 8 hours, X2(1.53mg/mL) is increased by 25 percent compared with the original enzyme (1.22mg/mL), X4(0.24mg/mL) is reduced by 33 percent compared with the original enzyme (0.36mg/mL), X3(0.98mg/mL) is reduced by 15 percent compared with the original enzyme (1.15mg/mL), X5 reaches 1.18mg/mL, and the total amount of xylooligosaccharide (X2+ X3+ X4+ X5) reaches 3.93 mg/mL.

From the above, it can be seen that XynAN hydrolyzes zelkova and oat xylan, and the hydrolysis efficiency is not improved although the ratio of the hydrolysis products is changed. The substitution of the N-terminal sequence does not necessarily result in a positive effect, but changes the properties of the enzyme more easily.

Sequence listing

<110> Beijing university of Industrial and commercial

<120> xylanase XynA mutant and application thereof

<160> 17

<170> Patent-In 3.3

<210> 1

<211> 96

<212> DNA

<213> Streptomyces rameus strain L2001

<220>

<223>

<400> 1

atgaatccgc tcgaccatgc gacgagccgc agggccgcct gcgcgctgct gctcggcacc 60

gcggccggac tggccctgcc cggcaccgcc cgtgcc 96

<210> 2

<211> 576

<212> DNA

<213> Streptomyces rameus strain L2001

<220>

<223>

<400>2

gccacggtcg tcaccacgaa ccagaccggc accgacaacg gcttctacta ctcgttctgg 60

accgacgcgc agggcacggt ctcgatgacc ctgggctccg gtggcaacta cagcaccagc 120

tggcgcaaca ccggcaactt cgtggccggc aagggctgga gcaccggcgc ccgcaggaac 180

gtgacctact ccggcagctt caacccgtcc ggcaacggct acctgtcgct ctacggctgg 240

acgtcgaacc cgctcgtgga gtactacatc gtcgacaact ggggcaccta ccggcccacg 300

gggacgtaca agggcagtgt caccagtgac ggcggaacgt acgacatcta ccagacgacg 360

cggtacaacg ccccgtccgt cgagggcacc aggaccttca accagtactg gagcgtgcgg 420

cagtcgaagc gcaccggcgg caccatcacc accggcaacc acttcgacgc ctgggcccgc 480

gccgggatgc ccctcggcag cttcgcgtac tacatgatcc tcgcgaccga ggggtaccag 540

agcagcggca actccaatat cacggtgtcg tcgtga 576

<210> 3

<211> 191

<212> PRT

<213> Streptomyces rameus strain L2001

<220>

<223>

<400>3

ATVVTTNQTG TDNGFYYSFW TDAQGTVSMT LGSGGNYSTS WRNTGNFVAG KGWSTGARRN 60

VTYSGSFNPS GNGYLSLYGW TSNPLVEYYI VDNWGTYRPT GTYKGSVTSD GGTYDIYQTT 120

RYNAPSVEGT RTFNQYWSVR QSKRTGGTIT TGNHFDAWAR AGMPLGSFAY YMILATEGYQ 180

SSGNSNITVS S 191

<210>4

<211>576

<212> DNA

<213> Streptomyces rameus strain L2001

<220>

<223>

<400>4

gccacggtcg tcaccacgaa ccagaccggc accgacaacg gcttctacta ctcgttctgg 60

accgacgcgc agggcacggt ctcgatgacc ctgggccccg gtggcaacta cagcaccagc 120

tggcgcaaca ccggcaactt cgtggccggc aagggctgga gcaccggcgc ccgcaggaac 180

gtgacctact ccggcagctt caacccgtcc ggcaacggct acctgtcgct ctacggctgg 240

acgtcgaacc cgctcgtgga gtactacatc gtcgacaact ggggcaccta ccggcccacg 300

gggacgtaca agggcagtgt caccagtgac ggcggaacgt acgacatcta ccagacgacg 360

cggtacaacg ccccgtccgt cgagggcacc aggaccttca accagtactg gagcgtgcgg 420

cagtcgaagc gcaccggcgg caccatcacc accggcaacc acttcgacgc ctgggcccgc 480

gccgggatgc ccctcggcag cttcgcgtac tacatgatcc tcgcgaccga ggggtaccag 540

agcagcggca actccaatat cacggtgtcg tcgtga 576

<210>5

<211> 191

<212> PRT

<213> Streptomyces rameus strain L2001

<220>

<223>

<400>5

ATVVTTNQTG TDNGFYYSFW TDAQGTVSMT LGPGGNYSTS WRNTGNFVAG KGWSTGARRN 60

VTYSGSFNPS GNGYLSLYGW TSNPLVEYYI VDNWGTYRPT GTYKGSVTSD GGTYDIYQTT 120

RYNAPSVEGT RTFNQYWSVR QSKRTGGTIT TGNHFDAWAR AGMPLGSFAY YMILATEGYQ 180

SSGNSNITVS S 191

<210>6

<211>576

<212> DNA

<213> Streptomyces rameus strain L2001

<220>

<223>

<400>6

gccacggtcg tcaccacgaa ccagaccggc taccacgacg gctacttcta ctcgttctgg 60

accgacgcgc agggcacggt ctcgatgacc ctgggctccg gtggcaacta cagcaccagc 120

tggcgcaaca ccggcaactt cgtggccggc aagggctgga gcaccggcgc ccgcaggaac 180

gtgacctact ccggcagctt caacccgtcc ggcaacggct acctgtcgct ctacggctgg 240

acgtcgaacc cgctcgtgga gtactacatc gtcgacaact ggggcaccta ccggcccacg 300

gggacgtaca agggcagtgt caccagtgac ggcggaacgt acgacatcta ccagacgacg 360

cggtacaacg ccccgtccgt cgagggcacc aggaccttca accagtactg gagcgtgcgg 420

cagtcgaagc gcaccggcgg caccatcacc accggcaacc acttcgacgc ctgggcccgc 480

gccgggatgc ccctcggcag cttcgcgtac tacatgatcc tcgcgaccga ggggtaccag 540

agcagcggca actccaatat cacggtgtcg tcgtga 576

<210>7

<211> 191

<212> PRT

<213> Streptomyces rameus strain L2001

<220>

<223>

<400>7

ATVVTTNQTG YHDGYFYSFW TDAQGTVSMT LGSGGNYSTS WRNTGNFVAG KGWSTGARRN 60

VTYSGSFNPS GNGYLSLYGW TSNPLVEYYI VDNWGTYRPT GTYKGSVTSD GGTYDIYQTT 120

RYNAPSVEGT RTFNQYWSVR QSKRTGGTIT TGNHFDAWAR AGMPLGSFAY YMILATEGYQ 180

SSGNSNITVS S 191

<210>8

<211>54

<212>DNA

<213> Artificial sequence

<220>

<223>

<400>8

catgccatgg ccttcaccgt tggtaacggt cagaaccaga ccggcaccga caac 54

<210>9

<211>34

<212>DNA

<213> Artificial sequence

<220>

<223>

<400>9

ccgctcgagc gacgacaccg tgatattgga gttg 34

<210>10

<211> 27

<212>DNA

<213> Artificial sequence

<220>

<223>

<400>10

gaccggctac cacgacggct acttcta 27

<210>11

<211>30

<212>DNA

<213> Artificial sequence

<220>

<223>

<400>11

agaacgagta gaagtagccg tcgtggtagc 30

<210>12

<211>21

<212>DNA

<213> Artificial sequence

<220>

<223>

<400>12

gcacggtctc gatggagctg g 21

<210>13

<211> 21

<212>DNA

<213> Artificial sequence

<220>

<223>

<400>13

ccaccggagc ccagctccat c 21

<210>14

<211> 20

<212>DNA

<213> Artificial sequence

<220>

<223>

<400>14

gatgaccctg ggccccggtg 20

<210>15

<211> 21

<212>DNA

<213> Artificial sequence

<220>

<223>

<400>15

gctctagttg ccaccggggc c 21

<210>16

<211> 30

<212>DNA

<213> Artificial sequence

<220>

<223>

<400>16

catgccatgg ccacggtcgt caccacgaac 30

<210>17

<211> 34

<212>DNA

<213> Artificial sequence

<220>

<223>

<400>17

ccgctcgagc gacgacaccg tgatattgga gttg 34

Claims (9)

1. A mutant xylanase XynA characterized by a sequence corresponding to the sequence set forth in SEQ ID NO: 2, the 33 rd position of the xylanase XynA is mutated, or the 11 th to 16 th positions of the xylanase XynA are mutated.

2. The mutant according to claim 1, wherein the mutation at position 33 is S33P or the following mutations occur simultaneously at positions 11 to 16: T11Y, D12H, N13D, F15Y, Y16F.

3. The mutant of claim 1, having the amino acid sequence as set forth in SEQ ID NO: 5, or SEQ ID NO: 7.

4. A gene encoding the mutant of any one of claims 1 to 3, more preferably having the amino acid sequence as set forth in SEQ ID NO: 4, or SEQ ID NO: 6.

5. An expression vector, or a recombinant cell line, or a recombinant bacterium comprising the gene of claim 4; preferably, the expression vector is an inducible expression vector; the recombinant bacterium is streptomyces, and more preferably streptomyces rochei.

6. Use of a mutant according to any one of claims 1 to 3 for the hydrolysis of xylan.

7. Use according to claim 6, wherein the hydrolysis substrate is one or a combination of birch xylan, beech xylan or oat xylan.

8. Use according to claim 6, wherein the hydrolysis substrate is an agricultural or industrial waste containing xylan.

9. Use according to any one of claims 6 to 8, wherein the hydrolysis is carried out at a temperature of 50-75 ℃.

Images