CN112457371B - Bone formation promoting polypeptide and application thereof - Google Patents

Bone formation promoting polypeptide and application thereof Download PDF

Info

Publication number
CN112457371B
CN112457371B CN202011366096.5A CN202011366096A CN112457371B CN 112457371 B CN112457371 B CN 112457371B CN 202011366096 A CN202011366096 A CN 202011366096A CN 112457371 B CN112457371 B CN 112457371B
Authority
CN
China
Prior art keywords
polypeptide
bone
osteoporosis
modification
acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202011366096.5A
Other languages
Chinese (zh)
Other versions
CN112457371A (en
Inventor
魏化伟
张伦
杨承刚
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beijing Zeqin Biomedical Co ltd
Original Assignee
Beijing Zeqin Biomedical Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing Zeqin Biomedical Co ltd filed Critical Beijing Zeqin Biomedical Co ltd
Priority to CN202011366096.5A priority Critical patent/CN112457371B/en
Publication of CN112457371A publication Critical patent/CN112457371A/en
Application granted granted Critical
Publication of CN112457371B publication Critical patent/CN112457371B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/06—Linear peptides containing only normal peptide links having 5 to 11 amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A61K47/643—Albumins, e.g. HSA, BSA, ovalbumin or a Keyhole Limpet Hemocyanin [KHL]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • A61P19/10—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease for osteoporosis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0654—Osteocytes, Osteoblasts, Odontocytes; Bones, Teeth
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0662—Stem cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0662—Stem cells
    • C12N5/0663—Bone marrow mesenchymal stem cells (BM-MSC)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/999—Small molecules not provided for elsewhere

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Rheumatology (AREA)
  • Biotechnology (AREA)
  • Medicinal Chemistry (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biochemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Developmental Biology & Embryology (AREA)
  • Microbiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • Epidemiology (AREA)
  • Biophysics (AREA)
  • Hematology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention discloses a bone formation promoting polypeptide and application thereof, wherein the polypeptide can enhance the differentiation, maturation or calcification of osteoblasts or cells capable of differentiating into osteoblasts. In addition, the present invention discloses a pharmaceutical composition for treating or preventing bone diseases, comprising a bone formation-promoting polypeptide as an effective ingredient. The bone formation promoting polypeptide has stable chemical property, easy low-cost large-scale synthesis, high biocompatibility and no toxicity, and can be widely used for preventing and treating bone diseases.

Description

Bone formation promoting polypeptide and application thereof
Technical Field
The invention belongs to the field of biological medicine, and relates to a bone formation polypeptide and application thereof.
Background
Bone is a moving organ that constantly undergoes bone remodeling and maintains serum calcium concentration by repeated formation and resorption/destruction in bone morphogenesis. In general, bone formation by osteoblasts and bone resorption by osteoclasts are usually in equilibrium. Bone mass can be maintained at a constant level by the mechanism of interaction between these cells. When the equilibrium state is disrupted by menopause, aging, inflammation, etc., metabolic bone disease is caused by the disruption caused by osteoporosis or rheumatoid arthritis. The occurrence of this metabolic bone disease is a serious problem in the current aging society. Therefore, elucidation of the pathological mechanism of this disease at the molecular level and development of effective therapeutic agents are urgent tasks.
Examples of bone diseases, including metabolic bone diseases, include osteoporosis, osteopenia, osteogenesis imperfecta, osteonecrosis, low bone mass, paget's disease, bone metastasis, sterile prosthesis loosening, periodontitis, metastatic bone disease, rheumatoid arthritis, lupus arthritis, periodontal disease, alveolar bone loss, post-osteotomy, childhood idiopathic bone loss, spinal curvature, height loss, and prosthesis surgery, among others.
Hitherto, bone resorption inhibitors that inhibit the bone resorption process, rather than enhancing bone formation, have been used as therapeutic agents for bone metabolic diseases that exhibit bone loss (e.g., osteoporosis). Examples of drugs that inhibit bone resorption and are used or suggested for use in the treatment of osteoporosis include estrogens, Selective Estrogen Receptor Modulators (SERMs), ipriflavones, vitamin K2, calcium agents, calcitriol, calcitonin and bisphosphonates such as alendronate. However, the treatment method using the above drugs is not always satisfactory in terms of efficacy and results. Therefore, further development of safe and effective novel therapeutic agents has been desired.
Teriparatide is used as the only bone formation promoting medicine, and clinical data show that teriparatide can significantly increase bone density of multiple bones in the whole body of postmenopausal women, and can also increase bone density of waist and neck of femur in men, so that teriparatide is recommended to be used in various guidelines. Teriparatide is FDA approved for the treatment of persistent, systemic severe osteoporosis. Teriparatide is suitable for the treatment of osteoporosis in postmenopausal women at high risk of fracture. Can obviously reduce the fracture risk of vertebrae and non-vertebrae of postmenopausal women, but the effect of reducing the fracture risk of hip bones is not proved.
Teriparatide belongs to the molecular fragment of the parathyroid hormone PTH (1-34). Patients may receive only one treatment for life up to 24 months. Nausea, leg cramps, dizziness, and increased probability of osteosarcoma are common side effects. The treatment cost is more than 6000 yuan per month, the effect is achieved in at least 3 months, and great economic pressure is brought to patients. Therefore, the development of a new bone formation promoting drug is urgently needed, and the monopoly of teriparatide is broken.
Disclosure of Invention
In order to solve the problems in the prior art, the invention aims to provide a polypeptide for promoting bone formation and a derivative thereof.
According to one aspect of the present invention, the present invention provides a polypeptide, wherein the polypeptide sequence consists of two amino acids, serine and glutamic acid or aspartic acid, the polypeptide comprises 2-50 amino acids, and the number ratio of serine to glutamic acid or aspartic acid is (0.25-2): 1;
further, the polypeptide has the following general formula: (XSSXS) n, wherein X is glutamic acid or aspartic acid, S is serine, and n is a natural number;
further, in a specific embodiment of the present invention, n is 1 to 8.
Preferably, n is 1, 2,3, 4;
more preferably, n is 1.
According to another aspect of the present invention, there is provided a polypeptide derivative comprising a modified product of the aforementioned polypeptide, a variant of the aforementioned polypeptide obtained by addition and/or substitution of one or more amino acids, and a conjugate of the aforementioned polypeptide with another substance.
The term "modification" in the present invention refers to any change made to a peptide, such as a change in the length of the peptide, a change in the amino acid sequence, a change in the chemical structure, a co-translational modification or a post-translational modification of the peptide. In some cases, the peptides of the invention comprise one or more modified amino acid residues. The type of modification is well known in the art.
Modifications that may be used in the present invention include methylation, myristoylation, PEG modification, fluorine modification, biotin modification, fluorescent label modification, cyclization, carboxylation, fatty acid modification, acetylation modification, phosphorylation modification, glycosylation modification, amidation modification, or other known polypeptide modifications.
In particular embodiments of the invention, the modification comprises methylation, myristoylation, PEG modification, fluorine modification, biotin modification, fluorescent label modification, cyclization.
The modification of the above amino acids serves to greatly improve the stability of the peptide of the present invention. The term "stability" as used in the present invention means not only "in vivo" stability but also storage stability (e.g., storage stability at ordinary temperature). The protective group plays a role in protecting the peptide of the present invention from the attack of a protein cleaving enzyme in vivo.
The amino acid addition and/or substitution of the invention includes the amino acid addition and/or substitution at any position of the amino terminal, carboxyl terminal or inside of the polypeptide sequence.
Further, the added and/or substituted amino acids include natural amino acids or unnatural amino acids.
Still further, the variant is obtained by adding 1 to 3 unrelated amino acids to the amino terminus or the carboxy terminus of the aforementioned polypeptide.
Unrelated amino acids useful in the present invention include glycine, tryptophan, tyrosine, cysteine, methionine, glutamine and threonine.
In a particular embodiment of the invention, the variant is obtained by adding 1 to 3 glycines to the amino-terminus or carboxy-terminus of an ESSES or DSSS polypeptide.
Still further, the variant is obtained by adding 1 to 2 unrelated amino acids simultaneously to the amino terminus and the carboxy terminus of the aforementioned polypeptide.
Unrelated amino acids useful in the present invention include glycine, tryptophan, tyrosine, cysteine, methionine, glutamine and threonine.
In a particular embodiment of the invention, the variant is obtained by the simultaneous addition of 1 to 2 glycines at the amino-and carboxy-termini of an ESSES or DSSS polypeptide.
Still further, the variant is obtained by replacing 1 amino acid at the carboxy terminus of the aforementioned polypeptide; preferably, said variant is obtained by replacing the natural amino acid at the carboxy-terminal end of the polypeptide with an unnatural amino acid, such as a D-form amino acid; more preferably, said variant is obtained by replacing the natural amino acid at the carboxy-terminal end of the polypeptide with a non-natural D-amino acid of serine.
In a particular embodiment of the invention, the variant is obtained by replacing the natural amino acid at the carboxy-terminus of the ESSES or DSDSSS polypeptide with a non-natural D-amino acid for serine.
Other substances that may be conjugated to the aforementioned polypeptides of the invention include, but are not limited to, carrier proteins, exogenous polypeptides, drugs.
Further, the carrier protein includes serum albumin, hemocyanin, and chicken ovalbumin.
Further, the exogenous polypeptide comprises an Fc region, a signal peptide and a polypeptide label.
The Fc regions were selected from the following group: IgA Fc region, IgD Fc region, IgG Fc region, IgE Fc region, IgM Fc region.
The polypeptide marker is selected from the group consisting of: flag tag, strep tag, polyhistidine tag, VSV-G tag, influenza hemagglutinin tag, c-Myc tag.
Further, the medicine comprises bisphosphonate medicines and iridoid compounds.
The bisphosphonate medicines comprise alendronate, ibandronate and zoledronic acid.
The iridoid compounds include geniposide, genipin-gentiobioside, geniposide, and geniposidic acid.
According to a further aspect of the invention there is provided a pharmaceutically acceptable salt or ester of a polypeptide or polypeptide derivative as hereinbefore described.
Further, the pharmaceutically acceptable salts include acetate and hydrochloride.
According to a further aspect of the invention, there is provided a method of producing a polypeptide as hereinbefore described.
Polypeptides useful in the present techniques can be prepared using any suitable means known in the art. Such polypeptides include isolated naturally occurring polypeptides, recombinantly produced polypeptides, synthetically produced polypeptides, or polypeptides produced by a combination of these methods. Means and methods for preparing such polypeptides are well known in the art.
According to a further aspect of the invention, there is provided a pharmaceutical composition comprising an effective amount of a polypeptide or polypeptide derivative as hereinbefore described; preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.
The pharmaceutically acceptable carrier contained in the pharmaceutical composition of the present invention is a carrier generally used as a preparation, and includes diluents, fillers, excipients, binders, wetting agents, disintegrants, effervescent agents, surfactants, absorption enhancers, lubricants, adsorption carriers, sustained release microspheres, implants, in situ microspheres, liposomes, microemulsions, in situ hydrogels, nanoparticles, protease inhibitors, bioadhesives.
The sustained-release microspheres can be prepared from the following sustained-release auxiliary materials: racemic polylactic acid (D, L-PLA), racemic polylactic acid/glycolic acid copolymer (D, L-PLGA), monomethyl polyethylene glycol/polylactic acid (MPEG-PLA), monomethyl polyethylene glycol/polylactic acid copolymer (MPEG-PLGA), polyethylene glycol/polylactic acid (PLA-PEG-PLA), polyethylene glycol/polylactic acid copolymer (PLGA-PEG-PLGA), carboxyl-terminated polylactic acid (PLA-COOH), carboxyl-terminated polylactic acid/glycolic acid copolymer (PLGA-COOH), polifeprosan, difatty acid-sebacic acid copolymer (PFAD-SA), poly (erucic acid dimer-sebacic acid) [ P (EAD-SA) ], poly (fumaric acid-sebacic acid) [ P (FA-SA) ], ethylene vinyl acetate copolymer (EVAc), polylactic acid (PLA), poly (lactic acid), Polyglycolic acid and glycolic acid copolymer (PLGA), xylitol, oligosaccharide, chondroitin, chitin, hyaluronic acid, collagen, gelatin, protein glue or their combination.
In a specific embodiment of the present invention, the sustained release microspheres are PLGA sustained release microspheres.
The pharmaceutical composition of the present invention can be administered orally or parenterally, and in the case of parenteral administration, it can be administered by intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, topical administration, transdermal administration, or the like.
The appropriate dose of the pharmaceutical composition of the present invention varies depending on factors such as the formulation method, the administration mode, the age, body weight, sex, disease state, diet, administration time, administration route, excretion rate, and reaction sensitivity of the patient, and the dose effective for the treatment or prevention desired by a skilled physician can be easily determined and prescribed.
The pharmaceutical composition of the present invention can be prepared in a unit volume form or in a multi-volume container by formulating with a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily performed by one of ordinary skill in the art to which the present invention pertains. In this case, the formulation may be in the form of a solution, a suspension, or an emulsion in an oily or aqueous medium, or in the form of a paste, a powder, a granule, a tablet, a capsule, or a gel (e.g., hydrogel), and may further contain a dispersant or a stabilizer.
In addition, the pharmaceutical composition of the present invention also includes a combination of the polypeptide of the present invention or its derivative and other bone formation-promoting agents, and the polypeptide of the present invention or its derivative and other agents may be separately formulated or combined in the same formulation for combined administration, depending on the nature of the polypeptide to be administered and the formulation compatibility of the polypeptide of the present invention or its derivative. The combination may be administered sequentially, including on the same day or staggered on different days. One skilled in the art will appreciate that a suitable dosing regimen will be appropriate for effective administration of the polypeptide of the invention or derivative thereof with other drugs or therapeutic ingredients. Examples of the bone formation-promoting agent include teriparatide, raloxifene.
According to a further aspect of the invention there is provided a nucleic acid molecule encoding a polypeptide or polypeptide derivative as hereinbefore described.
According to a further aspect of the invention there is provided a vector comprising a nucleic acid molecule as hereinbefore described.
A vector refers to a molecule that can carry an inserted polynucleotide into a host cell. Examples of carriers are liposomes, micelles of biocompatible polymers, including natural polymers and synthetic polymers; a lipoprotein; a polypeptide; a polysaccharide; a lipopolysaccharide; enveloping the artificial virus; metal particles; as well as bacteria, viruses, such as baculoviruses, adenoviruses and retroviruses, bacteriophages, cosmids, plasmids, fungal vectors and other recombinant vectors commonly used in the art for the expression of various eukaryotic and prokaryotic hosts, possibly for gene therapy, and for the expression of simple proteins.
According to a further aspect of the invention there is provided a host cell comprising a nucleic acid molecule as hereinbefore described, or a vector as hereinbefore described.
According to a further aspect of the present invention, there is provided a method of promoting differentiation, proliferation, maturation or calcification of osteoblasts or cells capable of differentiating into osteoblasts, said method comprising administering a polypeptide or polypeptide derivative as hereinbefore described, or a pharmaceutical composition as hereinbefore described.
Further, the method includes non-diagnostic purposes and diagnostic purposes.
As an example of a non-therapeutic purpose, the methods of the invention may be used to promote differentiation, proliferation, maturation or calcification of osteoblasts or cells capable of differentiating into osteoblasts in vitro. The method can be used for researching molecular mechanisms of differentiation, proliferation, maturation and calcification. In addition, the method can be used for preparing mature osteoblasts.
Further, the cells capable of differentiating into osteoblasts include osteoblast precursor cells, mesenchymal stem cells, stromal cells, myoblasts.
According to a further aspect of the present invention, there is provided a method for preventing or treating bone diseases, which comprises administering the aforementioned polypeptide or polypeptide derivative, or the aforementioned pharmaceutical composition, to a subject in need thereof.
According to a further aspect of the invention, there is provided a method of enhancing bone formation in a subject in need thereof, the method comprising administering to a subject in need thereof a polypeptide or polypeptide derivative as hereinbefore described, or a pharmaceutical composition as hereinbefore described.
According to a further aspect of the invention, there is provided a method of inducing bone deposition in a subject in need thereof, the method comprising administering to a subject in need thereof a polypeptide or polypeptide derivative as hereinbefore described, or a pharmaceutical composition as hereinbefore described.
According to a further aspect of the invention, there is provided a method of inducing bone maturation in a subject in need thereof, the method comprising administering to a subject in need thereof a polypeptide or polypeptide derivative as hereinbefore described, or a pharmaceutical composition as hereinbefore described.
Further, the subject of the present invention includes mammals, and further, the subject of the present invention is a human.
According to a further aspect of the invention there is provided a method of expanding stem cells in vitro, the method comprising contacting a polypeptide or polypeptide derivative as hereinbefore described, or a pharmaceutical composition as hereinbefore described, with stem cells from a subject.
According to a further aspect of the invention there is provided the use of a polypeptide as hereinbefore described, including the use of any one of:
1) use in the preparation of a polypeptide derivative as hereinbefore described;
2) use in the preparation of a pharmaceutical composition as hereinbefore described;
3) use in the manufacture of a medicament for promoting bone formation;
4) use in the manufacture of a medicament for promoting osteoblast differentiation, proliferation, maturation or calcification;
5) the application in preparing the medicine for promoting the osteogenic differentiation of stem cells;
6) the use in the manufacture of a medicament for the prevention or treatment of bone disease.
Further, the bone diseases include osteoporosis, rickets, osteomalacia, osteogenesis imperfecta, marble bone disease, fibrodysplasia, postmenopausal osteoporosis, senile osteoporosis in men and women, glucocorticoid-induced osteoporosis, immobilization osteoporosis, weight loss-induced osteoporosis, post-transplant osteoporosis, metastatic osteoporosis, idiopathic osteoporosis, juvenile osteoporosis, paget's disease, chronic hyperparathyroidism, hyperthyroidism, rheumatoid arthritis, Gorham-Stout disease, mcclure-Albright syndrome, osteolytic metastasis or multiple myeloma of various cancers, bone mass loss, systemic skeletal fragility, joint degeneration, non-healing fractures, orthopedic and dental problems due to diabetes, implanted periodontitis, adverse reactions to bone graft/implant/bone substitute materials, osteoporosis, and/or a method of a cell recovery, and/or a cell-induced by a method of preventing a method of, Periodontal disease, bone aging, bone fractures, bone defects, bone transplants, bone grafts, bone cancers, joint replacements, joint repairs, fusions, facet joint repairs, bone degeneration, dental implants and repairs, bone marrow defects, bone disease in patients with acromegaly, bone disease associated with cystic fibrosis, unpowered bone disease, renal osteodystrophy associated with chronic kidney disease, bone disease associated with cystinosis, and bone disease associated with hyperoxaluria.
According to a further aspect of the invention there is provided the use of a polypeptide derivative as hereinbefore described, including the use of any one of:
1) use in the preparation of a pharmaceutical composition as hereinbefore described;
2) use in the manufacture of a medicament for promoting bone formation;
3) use in the manufacture of a medicament for promoting osteoblast differentiation, proliferation, maturation or calcification;
4) the application in preparing the medicine for promoting the osteogenic differentiation of stem cells;
5) use in the manufacture of a medicament for the prevention or treatment of bone disease;
preferably, the bone disease comprises osteoporosis, rickets, osteomalacia, osteogenesis imperfecta, marble bone disease, fibrodysplasia, paget's disease, chronic hyperparathyroidism, hyperthyroidism, rheumatoid arthritis, Gorham-Stout disease, mcclure-Albright syndrome, osteolytic metastasis or multiple myeloma of various cancers, bone mass loss, systemic skeletal fragility, joint degeneration, non-healing fracture, orthopedic and dental problems caused by diabetes, implanted periodontitis, adverse effects on bone graft/implant/bone substitute material, periodontal disease, bone aging, fracture, bone defect, bone graft, bone cancer, joint replacement, joint repair, fusion, facet joint repair, bone degeneration, dental and repair, bone marrow defect, bone disease in acromegaly patients, Cystic fibrosis-associated bone disease, unpowered bone disease, renal osteodystrophy associated with chronic kidney disease, bone disease associated with cystinosis, and bone disease associated with hyperoxaluria; preferably, the osteoporosis comprises postmenopausal osteoporosis, senile osteoporosis in both men and women, glucocorticoid-induced osteoporosis, arrested osteoporosis, weight loss induced osteoporosis, post-transplant osteoporosis, migratory osteoporosis, idiopathic osteoporosis, juvenile osteoporosis.
The term "peptide" as used herein refers to a compound consisting of a single chain of D-or L-amino acids or a mixture of D-and L-amino acids linked by peptide bonds. Typically, peptides are about 2 to 50 amino acids in length. Preferably, the peptides of the invention are from about 2 to about 20 amino acids in length, more preferably 5 to 20 amino acids, most preferably 5 amino acids.
As used herein, the term "amino acid" refers to natural, unnatural and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to a natural amino acid.
As used herein, the term "natural amino acids" refers to those amino acids encoded by the genetic code, as well as those amino acids that are later modified, such as hydroxyproline, γ -carboxyglutamic acid, and O-phosphoserine. Naturally occurring alpha-amino acids include, but are not limited to, alanine (Ala), cysteine (Cys), aspartic acid (Asp), glutamic acid (Glu), phenylalanine (Phe), glycine (Gly), histidine (His), isoleucine (Ile), arginine (Arg), lysine (Lys), leucine (Leu), methionine (Met), asparagine (Asn), proline (Pro), glutamine (gin), serine (Ser), threonine (Thr), valine (Val), tryptophan (Trp), tyrosine (Tyr), and combinations thereof. Stereoisomers of natural amino acids include, but are not limited to, D-alanine (D-Ala), D-cysteine (D-Cys), D-aspartic acid (D-Asp), D-glutamic acid (D-Glu), D-phenylalanine (D-Phe), D-histidine (D-His), dileucine (D-Ile), D-arginine (D-Arg), D-lysine (D-Lys), D-leucine (D-Leu), D-methionine (D-Met), D-asparagine (D-Asn).
As used herein, the term "unnatural amino acid" includes, but is not limited to, amino acid analogs, amino acid mimetics, synthetic amino acids, M' -modified lysines, and methyl amino acids in either the L-or D-configuration that function in a manner similar to a natural amino acid. An unnatural amino acid is not encoded by the genetic code and can, but need not, have the same basic structure as a natural amino acid.
The unnatural amino acid is selected from the group consisting of: 2-aminofatty acid, 3-aminofatty acid, beta-alanine, beta-aminopropionic acid, 2-aminobutyric acid, 4-aminobutyric acid, piperidinecarboxylic acid, 6-aminocaproic acid, 2-aminoheptanoic acid, 2-aminoisobutyric acid, 3-aminoisobutyric acid, 2-aminopimelic acid, 2, 4-diaminobutyric acid, desmosine, 2' -diaminopimelic acid, 2, 3-diaminopropionic acid, N-ethylglycine, N-ethylaspartamide, hydroxylysine, isohydroxylysine, 3-hydroxyproline, 4-hydroxyproline, isodesmosine, iso-isoleucine, N-methylglycine, N-methylisoleucine, 6-N-methyllysine, N-methylvaline, N-methylisoleucine, N-methyllysine, N-methylvaline, N-methylisoleucine, N-methyllysine, N-methylisoleucine, N-methyllysine, and a-methyllysine, Norvaline, norleucine or ornithine.
As used herein, the term "amino acid analog" refers to a compound having the same basic chemical structure as a natural amino acid, i.e., a carbon bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a natural amino acid.
As used herein, the term "amino acid mimetic" refers to a compound that differs in structure from the general chemical structure of an amino acid, but that functions similarly to a natural amino acid. Suitable amino acid mimetics include, but are not limited to, beta-amino acids and gamma-amino acids. In a beta-amino acid, the amino group is bonded to the beta-carbon atom of the carboxyl group such that there are two carbon atoms between the amino group and the carboxyl group. In the γ -amino acid, the amino group is bonded to the γ -carbon atom of the carboxyl group such that there are three carbon atoms between the amino group and the carboxyl group. Suitable R groups for beta-or gamma-amino acids include, but are not limited to, the side chains found in natural amino acids and unnatural amino acids.
The term "D-amino acid" as used herein refers to the dextrorotatory stereoisomer of an amino acid. The letters D and L are commonly used in the art to refer to stereoisomers of amino acids. D-amino acids are those that can be synthesized from the dextrorotatory isomer of glyceraldehyde, i.e., D-glyceraldehyde. Similarly, L-amino acids are those that can be synthesized from the L-isomer of glyceraldehyde, i.e., L-glyceraldehyde.
As used herein, the term "treatment" as used herein refers to any type of treatment that is beneficial to a subject having a disease, including improving the condition of the patient (e.g., in one or more symptoms), delaying the progression of the disease, and the like.
As used herein, the terms "subject" and "patient" generally relate to a human subject and are used interchangeably. The subject may be male or female and may be of any ethnic or ethnic group including, but not limited to, caucasian, african, asian, hispanic, indian, etc. The subject may be of any age, including neonates, infants, toddlers, children, adolescents, adults, and the elderly. In some embodiments, the subject has a bone disorder. Subjects can also include animal subjects, particularly mammalian subjects, such as canines, felines, bovines, caprines, equines, ovines, porcines, rodents (e.g., rats and mice), lagomorphs, primates (including non-human primates), and the like, for the purpose of veterinary or medical drug development.
As used herein, the expression "bone disease" refers to any of those diseases that cause various abnormalities or abnormalities of one or more bones and/or bone cells.
The invention has the advantages and beneficial effects that:
the invention reports two pentapeptides (ESSES or DSDSDSDS) for the first time, the pentapeptide has bone formation promoting activity, can increase bone mass in various models, has a curative effect no less than PTH, is stable in chemical property and is easy to synthesize in a large scale at low cost.
The polypeptide B5P of the invention shows excellent biocompatibility in animal experiments, and acute toxicity and reproductive toxicity are not observed temporarily.
The polypeptide B5P of the invention has wide application range, and can be used for treating osteoporosis. Can also promote fracture repair and bone union of dental implant.
Drawings
Figure 1 shows activity assays for polypeptides of different lengths, wherein a: ESSES; b: a DSDSDSS;
figure 2 shows activity assays following elongation of unrelated amino acids at both ends of the polypeptide, where a: ESSES; b: a DSDSDSS;
figure 3 shows a graph of polypeptide activity detection incorporating an unnatural D-amino acid, where a: ESSES; b: a DSDSDSS;
figure 4 shows a modified polypeptide activity assay diagram wherein a: ESSES; b: a DSDSDSS;
fig. 5 shows activity assays for polypeptide conjugates, wherein a: ESSES; b: a DSDSDSS;
fig. 6 shows activity assays for polypeptide sustained release dosage forms, wherein a: ESSES; b: a DSDSDSS;
FIG. 7 shows a graph of the results of wild type mouse Micro-CT scans, in which A: trabecular bone scan; b: local scanning images of trabeculae; c: cortical bone cross-section scans; d: cortical bone volume fraction; e: femoral bone volume fraction; f: number of trabeculae; g: trabecular bone resolution; h: bone material density;
FIG. 8 shows H & E staining patterns of wild-type mice;
fig. 9 shows a graph of the results of the wild-type mouse double-fluorescence labeling experiment, in which a: a staining pattern; b: a statistical chart;
fig. 10 shows a graph of wild-type mouse Von Kossa staining results, in which a: a staining pattern; b: a statistical chart;
FIG. 11 shows a detection result chart of bone mineralization related index Dmp-1 of a wild-type mouse, wherein A: a staining pattern; b: a statistical chart;
FIG. 12 shows a graph of the results of OVX mouse Micro-CT scans, in which A: OVX + ctrl set trabecular bone scan; b: OVX + B5P sets of trabecular bone scans; c: OVX + PTH group trabecular bone scans; d: femoral bone volume fraction; e: number of trabeculae; f: trabecular bone thickness; g: bone material density;
fig. 13 shows OVX mouse cortical bone results plots, where a: OVX + ctrl group cortical bone scan; b: OVX + B5P group cortical bone scans; c: OVX + PTH group cortical bone scan; d: cortical bone volume fraction;
fig. 14 shows a graph of results of OVX mouse double-fluorescence labeling experiments, wherein, a: OVX + ctrl group staining pattern; b: OVX + ctrl group staining pattern; c: OVX + PTH group staining profile; d: MAR;
fig. 15 shows OVX mouse H & E staining patterns, where a: OVX + ctrl group staining pattern; b: OVX + ctrl group staining pattern; c: OVX + PTH group staining profile;
fig. 16 shows OVX mouse Von Kossa staining pattern, where, a: OVX + ctrl group staining pattern; b: OVX + ctrl group staining pattern; c: OVX + PTH group staining profile;
fig. 17 shows a graph of the results of a two-label fluorescence experiment in fractured mice, in which a: fracture + ctrl; b: frame + B5P;
fig. 18 shows a H & E staining result chart of a fractured mouse, in which a: fracture + ctrl; b: frame + B5P;
FIG. 19 is a graph showing the results of Micro-CT scans in fractured mice, wherein A: fracture + ctrl; b: frame + B5P;
FIG. 20 shows a bone mineralization related index Dmp-1 detection result chart of a fracture mouse, wherein A: fracture + ctrl; b: frame + B5P;
fig. 21 shows a graph of Micro-CT scanning results of a femoral titanium nail implantation model mouse, wherein a: implant + ctrl scan; b: implant + B5P scan; c: bone volume fraction; d: trabecular bone thickness;
fig. 22 shows a graph of the van giesoson staining results of a femoral titanium nail implantation model mouse, in which a: implant + ctrl staining pattern; b: implant + B5P scan; c: bone surface area/titanium nail surface area;
fig. 23 shows a fluorescence double-label experiment result chart of a femoral titanium nail implantation model mouse, wherein a: implant + ctrl staining pattern; b: implant + B5P scan; c: MAR;
fig. 24 shows graphs of the results of Von Kossa staining and bone formation in a femoral titanium nail implantation model mouse, in which a: von Kossa staining pattern for implant + ctrl; b: von Kossa staining pattern of implant + B5P; c: bone formation staining pattern of implant + ctrl; d: bone formation staining pattern of implant + B5P; e: a statistical chart;
fig. 25 shows a graph of the results of Micro-CT scans of an elderly osteoporotic macaque, wherein a: control scans; b: B5P sets of scans; c: BV/TV; d: TB.n; e: th;
fig. 26 shows a graph of the results of a Q-CT scan of an elderly osteoporotic macaque, wherein a: hip bone density; b: second to fourth lumbar vertebral densities;
fig. 27 shows H & E staining profile of age-old osteoporotic macaques, wherein, a: ctrl; b: B5P;
fig. 28 shows a graph of the results of the three-point bending test, in which a: the breaking resistance; b, compressive capacity:
fig. 29 shows a QPCR experiment result chart, wherein, a: runx 2; b: osx, respectively; c: allpl; d: ocn;
FIG. 30 shows mineralisation staining patterns;
fig. 31 shows a signal path result graph, where a: (ii) a western blot; b: ALP staining; c: alizarin red staining;
fig. 32 is a graph showing the results of an erythrocyte agglutination assay used to evaluate the biosafety of polypeptide B5P, wherein a: comparison; b: a polypeptide;
fig. 33 shows a graph of the results of an ELISA experiment for evaluating the biosafety of polypeptide B5P, wherein a: BUN; b: CK; c: ALT; d: ALS;
figure 34 shows an H & E staining profile used to assess the biosafety of polypeptide B5P;
fig. 35 shows the effect of polypeptide B5P on biochemical indicators of sera of aged macaques, wherein a: CK; b: ALT; c: CKM; d: ALS; e: blood glucose; f: cholesterol; g: BUN; h: and (4) HDLC.
Detailed Description
The present invention will be described in further detail with reference to the following detailed description and accompanying drawings. In the following embodiments, numerous details are set forth in order to provide a better understanding of the present invention, and are set forth in order to illustrate, but not to limit the scope of the present invention. However, those skilled in the art will readily recognize that some of the features may be omitted or replaced with other elements, materials, methods in different instances. The experimental methods not specified in the examples are generally commercially available according to the conditions described in the conventional conditions or according to the conditions recommended by the manufacturers, and the materials, reagents and the like used in the examples, unless otherwise specified.
EXAMPLE 1 polypeptide preparation
The synthesis is carried out by a liquid phase synthesis method, and the specific steps are as follows:
1. synthetic feedstock and related reagents/instruments
1) Resin: 2-Chlorotrityl Chloride Resin (Nankai Synthesis science and technology, Tianjin) with a degree of substitution of 1.03 mmol/g;
2) amino acids: Fmoc-Ser-OH (> 99% Chenopono), Fmoc-Glu (OTbu) -OH (> 99% Chenopono);
3) synthesizing a reagent: DMF (korea origin), DCM (korea origin), MEOH (japan origin), DIEA (nov chemical, 99%), HBTU (haohan biotechnology, 99%);
4) deprotection reagents: piperidine (Shanghai chemical reagent, national drug group, 99%);
5) detection reagent: phenol reagent (self-prepared), pyridine reagent (self-prepared), ninhydrin reagent (self-prepared);
6) and (3) a cracking reagent: 95% cutting fluid: TFA (j.t. baker, 99%), TIS (shanghai degarei fine chemical, 98%), EDT (shanghai degarei fine chemical, 98%), anhydrous ether (shanghai experiment, found 99.7%);
7) nitrogen gas: (New Union gas);
8) the instrument comprises the following steps: the semi-automatic polypeptide synthesizer is designed and patented by Shanghai Qiangyao biological science and technology Limited company with twelve channels, the patent number is 201020226529.2, a high performance liquid chromatograph (model: preparative type, analytical type, software: Class-VP.Sevical System, manufacturer: SHIMADZU), a centrifuge (Shanghai Tinggton scientific instruments factory, model: TDL-40B) and a LABCONCO freeze dryer (model: Freezone. plus.6, manufacturer: LABCONCO).
2. The polypeptide synthesis steps are as follows: the synthesis sequence is from the C-terminus to the N-terminus.
1) Swelling resin: 2-Chlorotrityl Chloride Resin was added to the reaction tube, DCM (15ml/g) was added, and shaking was carried out for 30 min.
2) Grafting with the first amino acid: filtering off solvent by sand core, adding Fmoc-Glu (OTbu) -OH amino acid with 3 times of molar mass, adding DMF for dissolving, adding 10 times of molar excess DIEA, and oscillating for 60 min; blocking with methanol.
3) Deprotection: DMF was removed and 20% piperidine DMF solution (15ml/g) was added for 5min and 20% piperidine DMF solution (15ml/g) was added for 15 min.
4) And (3) detection: and (3) pumping out the piperidine solution, taking dozens of particles of resin, washing with ethanol for three times, adding a detection reagent for detection, heating at 105-110 ℃ for 5min, and turning dark blue to be a positive reaction.
5) Washing: DMF (10ml/g) twice, DCM (10ml/g) twice and DMF (10ml/g) twice.
6) Condensation: and (3) dissolving protected amino acid and HBTU in triple excess by using DMF as little as possible, adding the solution into a reaction tube, immediately adding DIEA in ten-fold excess, and reacting for 30 min.
7) And (3) detection: taking dozens of resin, washing with ethanol for three times, adding a detection reagent for detection, heating at 105-110 ℃ for 5min, and taking colorless negative reaction.
8) Washing: DMF (10ml/g) was taken once, DCM (10ml/g) was taken twice, and DMF (10ml/g) was taken twice.
9) Repeating the operations 3) to 6), and connecting the amino acids in the sequence from right to left.
10) And (3) draining, washing resin: DMF (10ml/g) twice, methanol (10ml/g) twice, DMF (10ml/g) twice, DCM (10ml/g) twice, and suction-dried for 10 min.
11) Cleavage of the polypeptide from the resin: preparing cutting fluid (10/g) TFA 95%; 1% of water; 2% of EDT; TIS 2%; cutting time: and (4) 120 min.
12) Drying and washing: the lysate is blown dry as much as possible with nitrogen, washed six times with ether and then evaporated to dryness at normal temperature.
13) Analyzing and purifying: the crude product is purified by high performance liquid chromatography.
14) Freeze-drying: collecting the target polypeptide solution, concentrating in a freeze dryer, and freeze-drying to obtain white powder.
15) The polypeptide is sent to a quality inspection part to be qualified.
Example 2 Activity assays of orthopaedic pentapeptides and derivatives thereof
1. Activity assays for polypeptides of varying lengths
1.1 Synthesis of Polypeptides of varying lengths
Synthesized according to the method of example 1.
1.2 cell experiments
The ALP gene expression level was measured by QPCR after culturing osteoblast line MC-3T3E1 cells and incubating them for 24 hours with different length polypeptides at a final concentration of 1. mu.g/ml.
1.3 results
The results are shown in FIG. 1A, where the combination of five amino acids of ESSES is a better combination for enhancing osteoblast activity, with better activity occurring in tandem with 2-4 ESSES, and with activity beginning to diminish in tandem with 5 and more.
As a result, as shown in FIG. 1B, the combination of five amino acids of DSDSDSS is the best unit for enhancing osteoblast activity, and the activity was better when the combination was connected to 2-4 DSDSDSDSSs in series, and the activity began to decrease when the combination was connected to 5 DSSSDs or more.
2. Polypeptide activity detection after polypeptide two-end amino acid extension
2.1 Synthesis of Polypeptides of varying lengths
Synthesized according to the method of example 1.
2.2 cell experiments
The ALP gene expression level was measured by QPCR after culturing osteoblast line MC-3T3E1 cells and incubating them for 24 hours with different length polypeptides at a final concentration of 1. mu.g/ml.
2.3 results
As shown in FIG. 2A, the single elongation of the ESSES by 1 unrelated amino acid had no effect on the activity, the single elongation by 2 unrelated amino acids had a small effect on the activity, and the elongation by 3 or more unrelated amino acids had a decrease in the activity. Double-sided extension of 1 unrelated amino acid had no effect on its activity, and double-sided extension of more than 2 unrelated amino acids began to decrease in activity. Glycine (G) is a representative of unrelated amino acids.
As shown in FIG. 2B, the activity of DSDSDSDS was not affected by single-sided extension of 1 unrelated amino acid, less affected by single-sided extension of 2 unrelated amino acids, and significantly decreased by extension of 3 or more unrelated amino acids. Double-sided extension of 1 unrelated amino acid each had no effect on its activity, and double-sided extension of more than 2 unrelated amino acids each began to diminish activity. Glycine (G) is a representative of unrelated amino acids.
3. Detection of the Activity of a polypeptide incorporating an unnatural D-amino acid
3.1 Synthesis of Polypeptides incorporating unnatural D-amino acids
Following conventional procedures, the unnatural D amino acid profile is shown in Table 1.
TABLE 1 unnatural D amino acid profile
Figure BDA0002805477620000161
Figure BDA0002805477620000171
3.2 cell experiments
The ALP gene expression level was measured by QPCR after culturing osteoblast line MC-3T3E1 cells and incubating them for 24 hours with different length polypeptides at a final concentration of 1. mu.g/ml.
3.3 results
As a result, as shown in FIG. 3A, the activity was enhanced by the substitution of the S at the C-terminal of ESSES with an unnatural D-form amino acid, while the substitution of amino acids at other positions resulted in a decrease in the activity.
As a result, as shown in FIG. 3B, the activity was enhanced by the S substitution at the C-terminal of DSDSDSSS to an unnatural D-amino acid, while the activity was decreased by amino acid substitutions at other positions.
4. Detection of variant Activity after modification of Polypeptides
4.1 Synthesis of modified variants
Following conventional procedures, polypeptide modifications are shown in table 2.
TABLE 2 Polypeptides with different modifications
Figure BDA0002805477620000172
4.2 cell assay
The ALP gene expression level was measured by QPCR after culturing osteoblast line MC-3T3E1 cells and incubating them for 24 hours with different length polypeptides at a final concentration of 1. mu.g/ml.
4.3 results
As shown in FIG. 4A, ESSES, which were methylated, myristoylated, PEG-modified, fluorine-modified, biotin-modified, FAM-fluorescently labeled, and disulfide-linked, were active.
As shown in FIG. 4B, the methylated, myristolated, PEG-modified, fluorine-modified, biotin-modified, FAM-fluorescently labeled, disulfide-cyclized DSDSDSDS were all active.
5. Activity assays for polypeptide conjugates
5.1 synthetic polypeptide conjugates
Following conventional procedures, polypeptide conjugates are shown in table 3.
TABLE 3 polypeptide conjugates
Numbering Modification mode Modification mode
PC1 Unmodified ESSES Unmodified DSDSDSS
PC2 N-coupled sodium Allen phosphate N-coupled sodium Allen phosphate
PC3 C-coupled sodium Allen phosphate C-coupled sodium Allen phosphate
PC4 N-coupled geniposidic acid N-coupled geniposidic acid
PC5 C-coupled genipin C-coupled genipin
PC6 N-coupled RGD polypeptides N-coupled RGD polypeptides
PC7 C-coupled RGD polypeptides C-coupled RGD polypeptides
5.2 cell experiments
ALP gene expression levels were measured by QPCR after culturing osteoblast line MC-3T3E1 cells and incubating for 24 hours with a final concentration of 2. mu.g/ml of polypeptide conjugate.
5.3 results
The results are shown in FIG. 5A, where ESSES-coupled bisphosphonates have activity as represented by sodium alendronate. The geniposide is taken as a representative and ESSES has activity after being coupled with traditional Chinese medicine monomers. The ESSES represented by RGD has activity after being coupled with oligopeptide.
The results are shown in FIG. 5B, where Allan sodium phosphate is used as a representative of the activity of the DSDSSS-conjugated bisphosphonates. The geniposide is taken as a representative and has activity after DSDSDS is coupled with traditional Chinese medicine monomers. The RGD is taken as a representative, and the DSDSDSDS has activity after being coupled with oligopeptide.
6. Activity detection of polypeptide sustained release dosage forms
6.1 synthetic microsphere sustained Release dosage forms
The method comprises the following steps: stirring and dissolving PLGA, dripping a pore-forming solution, and performing ultrasonic emulsification to form an emulsion; wherein the molar ratio of LA to GA of PLGA is 50: 50; the emulsion is then added dropwise to the stirred external aqueous phase, and a predetermined volume of deionized water is added, with the stirring being continued at a varying rate until the solvent has completely evaporated. And adding the water-soluble surfactant serving as the external water phase into deionized water, centrifuging the solution after the organic solvent is completely volatilized, washing with the deionized water, and removing the supernatant to obtain the PLGA microspheres. And adding NaOH solution containing polypeptide into the PLGA microspheres, uniformly mixing, putting the mixture into a shaking table for continuous reaction, repeatedly centrifuging and washing the reacted PLGA microspheres by using deionized water, and freeze-drying for later use.
6.2 cell assay
The ALP gene expression level was measured by QPCR after culturing osteoblast line MC-3T3E1 cells and incubating them for 1-7 days with microspheres at a final concentration of 2. mu.g/ml.
6.3 results
The results are shown in fig. 6A, where the ESSES sustained release dosage forms presented significant biological activity, represented by PLGA 50:50 microspheres.
The results are shown in fig. 6B, where PLGA 50:50 microspheres are representative, there is significant biological activity in the DSSDS sustained release dosage form.
Example 3 Effect of polypeptide B5P on mouse bone formation
1. Material
Wild type mouse origin: all mice were SPF grade purchased from experimental animal technology limited, viton, beijing (Charles River).
2. Preparing a polypeptide B5P solution: weighing 1.000 g of sodium hydroxide into a beaker, adding a small amount of normal saline to dissolve the sodium hydroxide, pouring the solution into a 1000 ml volumetric flask, washing the beaker by 3 times, pouring the solution into the volumetric flask completely, and finally diluting the solution to a scale mark by using the normal saline. Shaking up to obtain 1000mg/mL polypeptide storage mother liquor. When in use, the medicine is diluted according to the required concentration in equal proportion.
3. Drug treatment
Randomly dividing the mice into two groups, namely a control group and an experimental group, wherein the mice in the control group are injected with physiological saline 3 times a week, and the mice in the experimental group are injected with 20mg/kg of polypeptide B5P 3 times a week; femoral samples were collected one month later.
4. Micro-CT scanning
Subjecting the collected femur sample to Micro-CT scan, and analyzing bone volume fraction (BV/TV); trabecular number of bones (tb.n); trabecular bone separation (tb.sp); bone Material Density (BMD).
4.1 step
(1) After being fixed in 4% paraformaldehyde for 24 hours, the femur sample is transferred to 0.5% paraformaldehyde solution to prevent the formation of crystals in bone tissues from influencing sample scanning.
(2) The method comprises the steps of placing a sample in a Micro-CT special scanning tube with the diameter of 14mm, placing the sample horizontally, enabling a transverse shaft to be perpendicular to a Micro-CT scanning shaft, and placing the scanning tube in a Micro-CT scanning case sample disc.
(3) The parameters related to the scanning procedure are as follows: the scanning voltage is 70kVp, the scanning energy power is 14W, the scanning current is 200 muA, the exposure time is 300ms, the scanning BH 1200mg HA/cc, the scanning precision is 10μm, and the scanning Filter (Filter) is 0.5mm AI Filter. And reconstructing and analyzing later-period image data by using Mimics 13.0 software.
(4) When the femoral data are reconstructed, analyzing and selecting the trabecular bone data from all trabeculae which start 1mm below the femoral growth plate and are arranged in the inner layer of cortical bone; cortical bone data analysis cortical bone 5mm-6mm below the growth plate was selected.
4.2 results
The Micro-CT scanning result is shown in figure 7, and the trabecular bone density, trabecular bone thickness and cortical bone thickness of the mouse are remarkably increased after the polypeptide B5P is applied. The volume fraction (BV/TV) of the femur bone and the number (TB.N) of the trabeculae of the mouse are obviously increased, and the separation degree (TB.Sp) of the trabeculae is reduced, which indicates that the density of the femur bone of the mouse is increased and the trabeculae are distributed more densely; the Bone Material Density (BMD) index increased, indicating that the degree of mineralization of the femur in mice increased. The volume fraction of cortical bone (BV/TV of cortical bone) of the mice is increased, the trabecular bone thickness is obviously increased, and the increase of the cortical bone thickness indicates that the bone mass of the mice is obviously increased after the polypeptide B5P is applied.
5. H & E staining
5.1 step
1) Slicing: paraffin sections of the tissues were made in a conventional manner;
2) baking slices: placing the slices in a 65 ℃ oven for 30 min;
3) dewaxing and hydrating: sequentially dewaxing the tissue slices, namely, 30min of dimethylbenzene I and 30min of dimethylbenzene II. Then carrying out slice hydration treatment, wherein the absolute ethyl alcohol I is 5min, the absolute ethyl alcohol II is 5min, the 90% ethyl alcohol is 5min, the 75% ethyl alcohol is 5min, and the distilled water is 5 min.
4) Dyeing: washing with hematoxylin for 5min, and soaking in PBS for 5min to turn nucleus blue. Eosin staining for 2min, washing with water.
5) And (3) dehydrating and transparency: gradient ethanol is used for tissue dehydration, 80% ethanol, 90% ethanol and 95% ethanol are respectively used for 10s, and then the tissue is dried at room temperature. And (3) drying the mixture in the air at room temperature after 5min of absolute ethanol I and 5min of absolute ethanol II. Immersing in xylene for 5min, and sealing with neutral resin.
6) And (4) observation: and (5) observing and photographing under an upright microscope.
5.2 results
H & E staining of the femoral samples indicated that the trabecular bone under the growth plate was denser following mouse injection with polypeptide B5P (fig. 8).
6. Mouse double-fluorescence labeling experiment
6.1 step
(1) The above femur samples (xylenol orange and calcein were injected intraperitoneally at a dose of 80mg/kg, with an interval of 2 weeks) were subjected to hard tissue sectioning, and the thickness of the sections was about 15 μm.
(2) DAPI staining: hard tissue section dropwise addition 1: 1000 diluted DAPI staining solution, 5 min. The cells were washed 3 times with 5min each time in PBS. The encapsulated tablets were encapsulated using an anti-fluorescence quenching. And (5) observing the red and green double-color fluorescent markers under an inverted fluorescent microscope, and counting the bone deposition rate.
6.2 results
The results are shown in FIG. 9, with the red and green markers separated by 2 weeks, at a distance of new bone deposition. Compared with the control group, the femoral bone deposition amount of the experimental group is obviously increased. The analysis result shows that the bone mineralization deposition rate (MAR) is obviously increased after the mice are injected with the polypeptide B5P.
7. Von Kossa staining
7.1 step
(1) Dyeing with silver nitrate dye liquor: preparing 0.2% silver nitrate solution, dripping on the femoral hard tissue slice, covering the femoral tissue, irradiating with strong light for 15min, and washing the slice with running water for 2-3 s.
(2) And (3) incubation with sodium thiosulfate: 5% sodium thiosulfate solution is prepared and dripped on the slices to cover the femoral tissues for 5s, and the slices are washed by running water for 2-3 s.
(3) Methyl green padding: carrying out lining dyeing on the methyl green dye liquor for 5min, washing for 5s with running water, washing away floating color, and drying in a 65 ℃ oven for 30 min.
(4) Sealing and observing: and (5) adding dimethylbenzene dropwise into the slices, and sealing the slices by using neutral resin after the slices are transparent for 5 min. And observing and photographing under a body type microscope.
7.2 results
The replacement of calcium and silver ions in bone tissue appears black, indicating the density and level of mineralized bone. The Von Kossa staining results are shown in fig. 10, the trabecular bone density under the growth plate of the polypeptide B5P injection group is increased, and quantitative analysis shows that the absorbance of the experimental group is increased, which indicates that the bone mineralization degree is obviously enhanced.
8. Bone mineralization related index Dmp-1 detection
8.1 immunohistochemical staining
(1) Slicing: after femoral tissue decalcification, slicing normal paraffin tissue;
(2) baking slices: putting the slices in a 65 ℃ oven for 30 min;
(3) dewaxing and hydrating: sequentially dewaxing the tissue slices, namely, 30min of dimethylbenzene I and 30min of dimethylbenzene II. Then carrying out slice hydration treatment, wherein the absolute ethyl alcohol I is 5min, the absolute ethyl alcohol II is 5min, the 90% alcohol is 5min, and the 75% alcohol is 5 min. Distilled water for 5 min. Rinsed three times in PBS for 3min each time.
(4) Antigen retrieval: according to the requirements of the antibody, the tissue antigen is repaired correspondingly.
(5) Inactivation of endogenous peroxidase: the sections were added dropwise with a suitable peroxidase blocking solution and incubated at room temperature for 10min (to block the activity of endogenous peroxidase). PBS was added dropwise and washed three times for 5min each time.
(6) Tissue sealing: and (3) dropwise adding a proper amount of normal nonimmune animal serum on the section, and incubating for 10min at room temperature.
(7) Incubating the primary antibody: the serum was removed from the tissue, an appropriate amount of primary antibody was added dropwise to the tissue, and the tissue was incubated at room temperature for 60min or overnight at 4 ℃. PBS was added dropwise for 3min and washed three times.
(8) Incubation of secondary antibody: the sections were added drop wise with appropriate biotin-labeled secondary antibody, incubated at room temperature for 10min, washed three times with PBS, 3min each time.
(9) PBS was removed and 1 drop or 50. mu.l of streptavidin-labeled secondary antibody (reagent D) was added to each section, incubated at room temperature for 10min and washed three times with PBS for 3min each.
(10) DAB color development: dripping DAB color development solution (used as prepared) and observing under microscope for 3-10 min. And after the color development is finished, washing with tap water, and stopping the color development.
(11) Cell nucleus counterstaining: and (4) carrying out counterstaining by using methyl green staining solution and returning blue by using PBS.
(12) And (3) dehydrating and transparency: gradient ethanol is used for tissue dehydration, 80% ethanol, 90% ethanol and 95% ethanol are respectively used for 10s, and then the tissue is dried at room temperature. And (3) drying the dehydrated alcohol I for 5min and the dehydrated alcohol II for 5min at room temperature. After 5min of transparency in xylene. Mounting and observing.
8.2 results
Results as shown in fig. 11, the immunohistochemical color development degree of the B5P group was increased. The semi-quantitative results showed an increase in absorbance of the polypeptide B5P injected group compared to the control group, indicating an increase in the expression level of Dmp-1.
Example 3 Effect of polypeptide B5P on bone Mass in osteoporotic mice
1. Construction of osteoporosis mouse model
(1) 18 female WT mice of 12 weeks old were selected and divided into 3 groups (control group, OVX + polypeptide B5P group, OVX + PTH group).
(2) Mice were anesthetized with 35mg/kg dose sodium pentobarbital.
(3) The lower abdomen of the mouse was prepared for skin preparation, sterilized with iodophor, wiped with 75% alcohol, and a 0.5cm length incision was made 1cm below the rib, 0.5cm left of the midline of the abdomen.
(4) The fascia and the muscle are cut open, and the operation visual field is widened bluntly. White adipose tissues are found in the lower abdomen and pulled out of the body, and the oviduct and the ovary are found along the ascending of the uterus.
(5) After ligation of the oviduct, the ovary and oviduct were cut off, and after bilateral resection, the uterus and fat were placed in the abdomen.
(6) The skin and the muscle are sewed in layers.
(7) Three months after the osteoporosis model mouse self-builds a model, and after the model tends to be stable, polypeptide B5P is injected through tail vein, the total injection is 4 weeks, 3 times per week, and the dosage is 20 mg/kg; PTH was administered subcutaneously at a dose of 0.1. mu.g/kg for 4 weeks, 3 times per week.
2. Micro-CT scanning
The procedure is as in example 1.
As shown in fig. 12, the mice in the polypeptide B5P group and the PTH group showed significantly increased bone mass, bone volume fraction (BV/TV), trabecular number (tb.n), Bone Material Density (BMD), trabecular thickness (tb.th), and other indicators, compared to the control group. Cortical bone reconstruction and data analysis showed significant increases in cortical bone thickness and cortical bone mass scores in mice from group B5P and PTH compared to the control group (fig. 13). The polypeptide B5P can increase the cortical bone mass of the osteoporosis mouse.
3. Fluorescent double-label experiment
The procedure is as in example 1.
The results are shown in fig. 14, in the B5P group and the PTH group, the bone deposition amount was significantly increased compared to the control group mice, and the bone mineralization deposition rate (MAR) was significantly increased, indicating that the bone formation function of the mice was increased after the B5P treatment.
4. H & E staining
The procedure is as in example 1.
As a result, as shown in fig. 15, trabecular bone density was significantly increased in the B5P group compared to the control group. In addition, trabecular bone density was also significantly increased in the PTH group.
5. VonKossa staining
The procedure is as in example 1.
The results are shown in 16, and compared with the control group, the bone mass of the mice is obviously increased under the action of the polypeptide B5P and PTH, and the bone mineralization degree of the mice of the B5P group and the PTH group is obviously increased.
Example 4 Effect of polypeptide B5P on fracture healing
1. Construction of mouse fracture model
According to the literature [ Glycosylation of protein matrix 1is crystalline for reactive chemistry. 13(5) construction of a mouse fracture model by the method described in 575-. After modeling for 1 week, the mice are injected with 20mg/kg of polypeptide B5P 3 times a week, and after two weeks, the mice are obtained to evaluate the callus formation and callus density at the fracture broken ends.
2. Fluorescent double-label experiment
The procedure is as in example 1.
The results are shown in fig. 17, and the amount of cortical bone deposition near the fractured end of the experimental group is significantly increased compared to the control group. The analysis result shows that the bone mineralization deposition rate of the experimental group is obviously increased compared with that of the control group.
3. H & E staining
The procedure is as in example 1.
As a result, as shown in fig. 18, the fracture site was more tightly connected and the callus density was significantly increased in the B5P group compared to the control group.
4. Micro-CT scanning
The procedure is essentially the same as in example 1. The difference lies in that: when the fracture sample data is reconstructed, the callus display parts are 500 micrometers above and below the fractured end of the fracture respectively, and the callus parts outside the cortical bone of the corresponding parts are selected by data analysis.
The results are shown in FIG. 19, and the fracture site healing was accelerated in the B5P group-injected fracture model mice. The callus site reconstruction result shows that the callus density is denser than that of the control group after the polypeptide B5P injection, and the callus density of the B5P group is obviously higher than that of the control group.
5. Bone mineralization related index Dmp-1 immunohistochemical staining
The procedure is as in example 1.
After decalcification is carried out on a mouse fracture sample, the fracture part is evaluated for healing conditions through paraffin section and immunohistochemical staining of related osteogenesis indexes. The result of Dmp-1 immunohistochemical staining is shown in FIG. 20, and the expression of Dmp-1 at the fracture site of the polypeptide B5P group is remarkably increased.
Example 5 Effect of polypeptide B5P on implant osseointegration
1. Construction of mouse femoral titanium nail implantation model
(1) Preparing a titanium nail with the diameter of 1mm and the length of 2mm, and filing sharp parts at the head and the tail ends with sand paper. The titanium nails were soaked in 75% alcohol for 30min to sterilize, and then washed in PBS.
(2) 12 female WT mice of 8 weeks old were selected and divided into 2 groups (control group, titanium nail + B5P group). Mice were anesthetized with 35mg/kg dose sodium pentobarbital.
(3) The right leg of the mouse was preserved, sterilized with iodophor, and wiped with 75% alcohol to make an incision from the lateral side of the patella to the lateral side of the femoral head.
(4) Muscle was bluntly separated along the lateral femoral muscle margins, exposing the mid-femoral segment. The elevator is inserted under the femur to support the mid-femur.
(5) The slow-speed mobile phone is provided with a 1mm drill bit and drills open the cortical bone at the outer side of the middle section of the femur.
(6) The titanium nails are placed, and the muscles and the skin are sutured layer by layer after the titanium nails are properly positioned.
(7) Mice were injected with drug starting at the second postoperative week for a total of 3 weeks, 3 times per week at a dose of 20mg/kg, and sampled at the fourth postoperative week.
2. Micro-CT scanning
The procedure is essentially the same as in example 1. The difference lies in that: when the titanium nail data are reconstructed, the bone mass data around the titanium nail are analyzed and selected from the circular bone tissue with the inner diameter of 1mm and the outer diameter of 1.1mm of the titanium nail. When the titanium nail picture shows, the bone threshold is 535 and 535, and the titanium nail threshold is 535 and 1000.
The results are shown in fig. 21, compared with the control group, the bone mass of the mice in the group B5P is obviously increased, the indexes such as the bone volume fraction (BV/TV), the trabecular bone thickness (TB. Th) and the like are obviously improved, and the increase of the surface bone density and the thickness of the titanium nail after the treatment of the polypeptide B5P is shown.
3. VanGieseon staining
The method comprises the following steps: VanGieseon staining was performed according to the conventional method.
As shown in FIG. 22, the surface area of the bone tissue on the surface of the titanium nail in the group B5P is significantly higher than that of the control group, and the dotted line indicates the position of the bone on the surface of the titanium nail. Analysis of bone surface area/titanium nail surface area showed a significant increase in the amount of bone on the titanium nail surface.
4. Fluorescent double-label experiment
The procedure is as in example 1.
The results are shown in fig. 23, the left side is a titanium nail, the surface of the titanium nail covers bone tissue, calcein is separated from xylenol orange mark by one week, and the bone deposition rate on the surface of the titanium nail is obviously increased after the polypeptide B5P is injected.
5. Von Kossa staining
The procedure is as in example 1.
The results showed that there were more bone-engaging sites on the surface of the titanium nails of the polypeptide B5P group than in the control group, and the results of the absorbance analysis showed that the degree of bone mineralization around the titanium nails was significantly higher than in the control group (FIG. 24).
Example 6 Effect of polypeptide B5P on bone mass in age-related osteoporotic macaques
Old female macaques of about 22 years old are purchased from bio-technology ltd of linkangxienko, south China, Guangxi, and the feasibility of applying the polypeptide B5P to treat old osteoporosis monkeys is discussed according to the evaluation of the bone mass of thighbone and lumbar vertebra of the monkeys after 2 times of intravenous injection of the polypeptide for 12 weeks every week at 20 mg/kg.
1. Micro-CT scanning
The procedure is as in example 1.
The results are shown in fig. 25, where the indicators of bone volume fraction (BV/TV), trabecular number (tb.n), trabecular thickness (tb.th) were all higher in the polypeptide B5P group rhesus macaques compared to the control group-independent polypeptide injection. The above results indicate that the polypeptide B5P group had increased cancellous bone content compared to the control group of unrelated polypeptide injections.
2. Q-CT scan
The method comprises the following steps: Q-CT scanning was performed according to the conventional method
The results are shown in fig. 26, where bone density in the hip of rhesus macaques of the polypeptide B5P group was increased by 5.9% 12 weeks after injection, compared to the non-related polypeptide injection of the control group. Compared with the unrelated polypeptide injection of the control group, the bone density of the second to the fourth lumbar vertebrae of the macaque of the polypeptide B5P group is increased by 6.1 percent after 12 weeks of the injection.
3. H & E staining
The procedure is as in example 1.
The results are shown in fig. 27, in which the cancellous bone content of the fourth lumbar vertebra of the cynomolgus monkeys of the polypeptide B5P group was increased compared to that of the control group by unrelated polypeptide injection.
4. Three-point bending test
The method comprises the following steps: the WD-T1 animal bone three-point bending strength tester of Shanghai enterprise thinking testing instrument limited is used for carrying out the super-testing. The bone specimen is placed on two support points with a certain distance, downward load is applied to the specimen above the middle point of the two support points, and three-point bending occurs when three contact points of the bone specimen form two equal moments.
The results are shown in fig. 28, and the compression resistance and the fracture resistance of the rhesus macaque femurs of the polypeptide B5P group are enhanced compared with those of the control group which is not related to the polypeptide injection.
Example 7 Effect of the polypeptide B5P on osteogenic differentiation of Stem cells
Polypeptide B5P is added into bone marrow mesenchymal stem cells (BMSCs) cultured in vitro for mineralization induction, the expression of osteogenic related genes and mineralization related staining are detected, and the mineralization promoting capability of the polypeptide B5P in vitro is verified.
1. Culture and mineralization induction of bone marrow mesenchymal stem cells (BMSCs)
The method comprises the following steps: after BMSCs cells fused to more than 80%, the original medium was discarded and osteogenic induction medium was added (DMEM with 10% FBS, 5. mu.g/ml insulin, 0.1. mu.M dexamethasone, 0.2mM vitamin C and 10mM beta-glycerophosphate). Changing the liquid 1 time every 2 days, and detecting the expression of mineralization related genes or performing dyeing analysis after differentiating for two weeks.
2. Cell RNA extraction
(1) Cellular RNA: the cells were removed, the cell culture medium was aspirated, and washed 3 times with PBS. 1ml of Trizol reagent was added, gently flicked, and transferred to a 1.5ml RNase-killing EP tube.
(2) 0.2ml of chloroform was added thereto, and after vigorously shaking for 20 seconds, it was allowed to stand on ice for 10 min. Centrifugation was carried out at 12000rpm at 4 ℃ for 20 min.
(3) The supernatant was pipetted into a 1.5ml centrifuge tube. Care should be taken here to avoid touching the underlying protein layer.
(4) An equal volume of pre-cooled isopropanol was added, gently inverted 5 times, allowed to stand on ice for 10min, centrifuged at 12000rpm at 4 ℃ for 20 min.
(5) After carefully discarding the supernatant, 1ml of pre-cooled 75% ethanol (in DEPC water) was added and the RNA pellet was washed. Centrifugation (8000rpm) was carried out at 4 ℃ for 20 min.
(6) The supernatant was carefully discarded and the RNA pellet air-dried for 10 min. Dissolved in 20ul DEPC water.
3. Real-time fluorescent quantitative nucleic acid amplification detection system (qPCR)
(1) RT-qPCR reaction system (20ul) (Table 4):
TABLE 4 qPCR reaction System
Figure BDA0002805477620000291
(2) Note that: each specimen and each gene are provided with 3 pairs of holes, and the samples are loaded after being uniformly mixed.
RT-qPCR program:
10s at 95 ℃, 1 cycle;
95 ℃ for 5s, 60 ℃ for 30s, 38 cycles.
The primer sequences are shown in Table 5.
TABLE 5 RT-qPCR related Gene primer sequences
Figure BDA0002805477620000292
Figure BDA0002805477620000301
(3) Results
0.5 mu g/ml or 1 mu g/ml polypeptide B5P is added into mineralization-induced BMSC respectively, and RNA is extracted after 7 days for RT-qPCR detection. The results are shown in fig. 29, and the expression levels of the anaosteogenic markers Alpl and Ocn and the osteogenic preostegnosis marker Runx2 and Osx genes are obviously increased.
4. Mineralizing and dyeing
4.1 ALP staining
(1) Preparing a dye solution: 0.3. mu.l of solution A (phosphate staining solution), 0.6. mu.l of solution B (coupled diazonium salt), DD H2O 900μl。
(2) After 7 days of mineralization induction of BMSCs, 500. mu.l of 4% paraformaldehyde was added dropwise to each well, and the mixture was fixed in a refrigerator at 4 ℃ for 30 min.
(3) The fixative was discarded and washed 3 times with PBS solution.
(4) The above dye solution was added dropwise and incubated in a hybridization oven at 37 ℃ for 1 hour.
(5) Carefully suck off the dye solution, DD H2And O, washing the floating color.
(6) Photographs were taken on a white light plate.
4.2 alizarin Red staining
(1) After 21 days of mineralization induction of BMSCs, 500. mu.l of 4% paraformaldehyde was added dropwise to each well and fixed in a refrigerator at 4 ℃ for 30 minutes.
(2) The fixative was discarded and washed 3 times with PBS solution.
(3) And dripping 500 mu l of finished alizarin red dye solution for dyeing for 15 min.
(4) Carefully aspirate the dye solution and the DD H2O rinse off the float.
(5) The crystal formation was observed under a mirror and photographed on a white light plate.
4.3 Von kossa staining
(1) After 21 days of mineralization induction of BMSCs, 500. mu.l of 4% paraformaldehyde was added dropwise to each well and fixed in a refrigerator at 4 ℃ for 30 minutes.
(2) The fixative was discarded and washed 3 times with PBS solution.
(3) 0.1% silver nitrate dye solution is dripped in, and dyeing is carried out for 10min under the strong light irradiation.
(4) Carefully aspirate the dye solution and the DD H2O rinse off the float.
(5) The formation of black mineralized nodules was observed under a mirror and photographed on a white light plate.
4.4 results
Mineralization induction was performed by culturing mouse BMSCs, adding 0.5. mu.g/ml or 1. mu.g/ml of the polypeptide B5P. ALP staining was performed on day 7 after mineralization induction, and osteogenic differentiation effect of BMSCs was observed. On day 21 after mineralization induction, BMSC mineralization effect was observed by alizarin red and Von kossa staining. The results are shown in fig. 30, ALP staining was enhanced after 7 days of induction of BMSCs mineralization and BMSCs mineralized nodule formation was significantly increased. Suggesting that the polypeptide B5P can promote osteogenic differentiation of BMSC.
5. Signal path study
5.1 Western blot
Proteins of BMSC after 14 days of induction by adding 0.5 mu g/ml or 1 mu g/ml B5P are extracted, and changes of cell important signal transduction pathways FAK, AKT, ERK and the like are verified by Western blot. The results are shown in fig. 31A, with a significant change in FAK-AKT signaling pathway, and increased expression of phosphorylated FAK and AKT.
5.2 inhibition of integrin α 5
Further study of integrin receptors, important receptors of FAK-AKT pathway, and study of their effects on the bone-promoting effects of B5P by inhibiting integrin receptor of FAK-AKT pathway (integrin. alpha.5)
5.2.1 interference experiments
The method comprises the following steps: when the cells grow to 90% of the bottom of the bottle, the cells are digested, 20 ten thousand cells per well are inoculated into a 6-well culture plate, when the cells grow to 40% of the bottom of the plate, the cells are transfected according to the instructions of Lipofectamine 3000, the NC siRNA sequence of the control group transfection is CGGCAAGCTGACCCTGAAGT (SEQ ID NO.11), and the integrin alpha 5siRNA sequence of the experimental group transfection is GGACCAGGAAGCTATTTCT (SEQ ID NO. 12). Cells were harvested 48 hours after transfection and assayed.
5.2.2 staining
ALP staining (fig. 31B) and alizarin red staining (fig. 31C) results show that B5P caused the bone action to be blocked after integrin α 5 inhibition. It was suggested that B5P might promote osteogenic differentiation of stem cells by activating integrin α 5, which in turn activates the FAK-AKT signaling pathway.
Example 8 evaluation of biological safety of polypeptide B5P
The biological safety of the polypeptide B5P is studied by methods such as erythrocyte agglutination, serum biochemical index evaluation, pathological section analysis of important organs and the like.
1. Agglutination test of red blood cells
1.1 step
(1) 0.5ml of wild-type mouse plasma was collected and centrifuged at 1800rpm for 10 minutes in an EP tube at room temperature for more than one hour (or 37 ℃ water bath for 1 hour, 4 ℃ refrigerator for 2 hours or overnight). The lower layer was collected and diluted with 1ml of physiological saline. 10. mu.l of the dilution was aspirated and 1ml of physiological saline (co-diluted 1000-fold) was added. Centrifuge at 1800rpm for 10 minutes.
(2) The precipitate was collected, added to 1ml of erythrocyte storage solution (Ashi solution), mixed well, centrifuged at 1800rpm for 5min, and the supernatant was discarded. Adding physiological saline to dilute into 1% erythrocyte suspension.
(3) A96-well plate was used, and 50. mu.l of the above erythrocyte suspension was added thereto.
(4) The reagent additions are shown in Table 6.
TABLE 6 HA sample application Table
Figure BDA0002805477620000321
(3) The agglutination of the red blood cells was observed under an upright microscope, photographed and marked.
1.2 results
As shown in FIG. 32, the concentration of 0, 1, 10, 1000ng/ml did not cause significant agglutination of erythrocytes. Representative pictures show that with the addition of 10mg/ml of polypeptide B5P, the erythrocytes were scattered and no significant cell aggregation or hemolysis occurred.
2. ELISA detection
After the mice are injected with the polypeptide B5P, the serum levels of BUN (blood urea nitrogen), CK (creatine kinase), ALT (alanine aminotransferase) and ALS (aldosterone) are detected by ELISA, and the influence of the small molecular polypeptide on biochemical indexes is evaluated.
2.1 step
2.1.1 mouse serum Collection
(1) Blood collection of the retroorbital venous plexus of the mouse:
taking a glass capillary tube with the inner diameter of 1.0-1.5mm, breaking the glass capillary tube into a capillary tube section with the length of 2-2.5 cm before use, immersing the capillary tube section into 1% heparin solution, and drying the capillary tube for use. When blood is taken, the left hand grasps the skin of the back and neck between the two ears of a mouse to fix the head, gently presses the two sides of the neck downwards to cause difficulty in backflow of the blood of the head vein to cause congestion of orbital venous plexus, the right hand holds the capillary tube, inserts the capillary tube into a conjunctiva from the inner canthus, then gently pushes the capillary tube towards the direction of the fundus oculi, gently rotates the capillary tube to cut the venous plexus, and the blood flows along the capillary tube and is received into a container prepared in advance. After blood sampling, the gauze slightly presses the eyes to stop bleeding.
(2) After blood was obtained by the above method, it was left to stand in an EP tube at room temperature for more than one hour (or in a water bath at 37 ℃ for 1 hour, in a refrigerator at 4 ℃ for 2 hours or overnight) and centrifuged at 3000rpm for 10 minutes, and the supernatant was serum. Can be stored at-80 deg.C.
2.1.2 enzyme-linked immunosorbent assay (ELISA)
(1) Balancing: CK (creatine kinase), BUN (blood urea nitrogen), ALS (aldosterone) ALT (glutamic pyruvic transaminase) were removed and ELISA kit equilibrated for 20min at room temperature.
(2) Diluting the washing solution: dd H2Dilute 20X wash to 1X.
(3) Serum preparation: after blood collection using a tube without heat source and endotoxin (which is required to avoid any cell irritation during subsequent experimental manipulations), serum and red blood cells were separated by careful aspiration after centrifugation at 3000rpm for 10 minutes at room temperature.
(4) Sample adding: the desired number of plates are removed and placed on a 96-well plate, and the plate is marked with the order of the sample application. To the blank and standard wells, 20. mu.l of Matrix solution was added, and to the standard 20. mu.l each of 0, 0.025, 0.05, 0.1, 0.2, 0.4ng/ml standard was added. The diluted sera of mice in the control group and the polypeptide B5P group were added to each sample well in an amount of 10. mu.l, and then 40. mu.l of the sample diluent was added to each sample well, but no blank well was added.
(5) Manually washing the plate: slowly adding plate washing solution along the hole wall, standing for 1min, discarding the plate washing solution, and patting on absorbent paper. Repeat 5 times. And the gun head is replaced in time when different samples are added, so that pollution is avoided.
Automatic plate washing: mu.l of washing solution was added to each reaction well, and the procedure was 1min soaking and 5 plate washing.
(6) In addition to blank wells, 100. mu.l of detection antibody labeled with horseradish peroxidase (HRP) was added to the standard reaction wells and the sample reaction wells, and after the reaction wells were sealed with a sealing plate film, the wells were incubated in a 37 ℃ water bath or incubator for 60 min.
(7) Washing the plate: the plate was washed 5 times in the above manner.
(8) Color development: 50. mu.l of each of the substrates A and B was added to each reaction well, and incubated at 37 ℃ for 15min in the absence of light.
(9) Measurement: adding 50 mul of stop solution into each hole, and reading the absorbance at the wavelength of 450nm by using an enzyme-labeling instrument after 10 min. After a standard curve is made, the content of each protein in the sample is calculated by using a corresponding formula.
2.2 results
The results are shown in FIG. 33, and the indicators of BUN, CK, ALT and ALS are not significantly different after wild-type mice are injected with 200mg/kg of the polypeptide B5P 1 for a month.
3. H & E staining
The pathological evaluation of H & E staining of important organs was carried out by injecting 200mg/kg of the polypeptide B5P, and whether the polypeptide B5P has chronic toxicological effects on the organs of the internal organs was investigated. Tissues such as heart, lung, liver, spleen, kidney, etc. were paraffin sectioned and H & E stained. The results are shown in fig. 34, and compared with the control group, the significant pathological changes such as tumor or inflammatory infiltration of the important organs (heart, lung, liver, spleen, kidney) did not occur after one month of polypeptide B5P injection.
The results of this example show that no significant cytotoxicity and histo-organic pathological changes were observed within one month of the observation period, indicating that the polypeptide B5P has better biological safety.
Example 9 Effect of polypeptide B5P on pregnancy outcome in rats
1. Step (ii) of
After the male and female of SPF Wistar rat are paired, 80 pregnant rats are screened and divided into solvent control group and 4 groups of low, medium and high dosage, 20 of each. Peptides were injected intravenously in unison 2 times a week for 2 weeks. Rats were sacrificed on day 18.5 of gestation, uterine implantation number and live and dead fetus number were counted immediately after dissection, uterine weight, placenta weight, corpus luteum number after ovarian HE sectioning, etc.
2. Results
As shown in Table 7, no effect of low, medium, and high dose injection of the polypeptide B5P on pregnancy outcome in rats was observed.
TABLE 7 statistical Table of the Effect of the polypeptide B5P on the pregnancy outcome of rats
Figure BDA0002805477620000351
Example 10 Effect of polypeptide B5P on Biochemical indicators of serum of aged Kiwi
1. Step (ii) of
Aged female macaques between 20 and 23 years old were randomly divided into 2 groups. The control group was injected with irrelevant polypeptide, and the experimental group was injected with polypeptide B5P intravenously at 20mg/kg 2 times per week. Animal behavior was observed and videoed within 2 hours after injection. After 4 hours of injection, 2ml of blood is extracted, and after centrifugal separation of serum, an automatic biochemical analyzer tests the content of 8 biochemical indexes such as CK, HDLC and the like.
2. Results
20mg/kg of old female macaca mulatta aged around 22 years old are intravenously injected with the polypeptide 2 times a week for 12 weeks, and the result is shown in figure 35, and the polypeptide B5P does not cause the change of serum biochemical indexes after injection.
The above-described embodiments are only for illustrating the present invention and are not to be construed as limiting the present invention. As will be understood by those of ordinary skill in the art: various changes, modifications, substitutions and alterations can be made to the embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the claims and their equivalents.

Claims (17)

1. A polypeptide having the general formula: (XSSXS) n, wherein X is glutamic acid or aspartic acid, S is serine, and n is 1-8.
2. A polypeptide derivative comprising a modification product of the polypeptide of claim 1, a variant of the polypeptide of claim 1, a conjugate of the polypeptide of claim 1 with another substance, the variant being any one of the following groups:
said variant being obtained by adding 1 to 3 glycines at the amino-terminus or carboxy-terminus of the polypeptide of claim 1;
said variant being obtained by the simultaneous addition of 1 to 2 glycines at the amino-and carboxy-termini of the polypeptide of claim 1;
the variant is obtained by replacing a natural amino acid with a non-natural D-amino acid of serine at the carboxy-terminus of the polypeptide of claim 1.
3. The polypeptide derivative of claim 2, wherein the modification comprises methylation modification, myristoylation modification, PEG modification, fluorine modification, biotin modification, fluorescence labeling modification, cyclization modification, carboxylation modification, fatty acid modification, acetylation modification, phosphorylation modification, glycosylation modification, amidation modification, or other known polypeptide modification.
4. The polypeptide derivative of claim 2, wherein the other substances comprise proteins, polypeptides, drugs.
5. The polypeptide derivative of claim 4, wherein the protein comprises serum albumin; the polypeptide comprises an Fc region, a signal peptide and a polypeptide label; the medicine comprises bisphosphonate medicines and iridoid compounds.
6. The polypeptide derivative according to claim 5, wherein the bisphosphonates comprises alendronate, ibandronate, zoledronic acid; the iridoid compounds include geniposide, genipin-gentiobioside, geniposide and geniposidic acid.
7. A pharmaceutically acceptable salt or ester of the polypeptide of claim 1 or the polypeptide derivative of any one of claims 2-6.
8. A pharmaceutical composition comprising the polypeptide of claim 1 or the polypeptide derivative of any one of claims 2 to 6.
9. The pharmaceutical composition of claim 8, further comprising a pharmaceutically acceptable carrier.
10. The pharmaceutical composition of claim 9, wherein the pharmaceutically acceptable carrier comprises diluents, fillers, excipients, binders, wetting agents, disintegrants, effervescent agents, surfactants, absorption enhancers, lubricants, adsorption carriers, sustained release microspheres, implants, microspheres, liposomes, microemulsions, hydrogels, nanoparticles, protease inhibitors, bioadhesives.
11. The pharmaceutical composition of claim 10, wherein the sustained release microspheres are PLGA sustained release microspheres.
12. A nucleic acid molecule encoding the polypeptide of claim 1 or encoding the variant in the polypeptide derivative of claim 2 or a vector comprising the nucleic acid molecule.
13. A host cell comprising the nucleic acid molecule of claim 12 or comprising the vector of claim 12.
14. Use of the polypeptide of claim 1, wherein said use comprises any one of the following:
1) use in the preparation of a polypeptide derivative according to any one of claims 2 to 6;
2) use in the manufacture of a pharmaceutical composition according to any one of claims 8 to 11;
3) use in the manufacture of a medicament for promoting osteoblast differentiation, maturation or calcification;
4) use in the manufacture of a medicament for the prevention or treatment of bone diseases including osteoporosis, rickets, osteomalacia, osteogenesis imperfecta, fibrodysplasia, rheumatoid arthritis, Gorham-Stout disease, McCune-Albright syndrome, loss of bone mass, periodontitis, bone fracture, bone defects, dental implant repair.
15. The use according to claim 14, wherein the osteoporosis comprises postmenopausal osteoporosis, senile osteoporosis in both men and women, glucocorticoid-induced osteoporosis, arrests osteoporosis, weight loss induced osteoporosis, post-transplant osteoporosis, migratory osteoporosis, idiopathic osteoporosis, juvenile osteoporosis.
16. Use of a polypeptide derivative according to any one of claims 2 to 6, wherein said use comprises use according to any one of the following:
1) use in the manufacture of a pharmaceutical composition according to any one of claims 8 to 11;
2) use in the manufacture of a medicament for promoting osteoblast differentiation, maturation or calcification;
3) the use in the preparation of a medicament for the prevention or treatment of bone diseases,
the bone diseases include osteoporosis, rickets, osteomalacia, osteogenesis imperfecta, abnormal fibrous hyperplasia, rheumatoid arthritis, Gorham-Stout disease, McCune-Albright syndrome, bone loss, periodontitis, fracture, bone defect, and dental implant repair.
17. The use according to claim 16, wherein the osteoporosis comprises postmenopausal osteoporosis, senile osteoporosis in both men and women, glucocorticoid-induced osteoporosis, arrests osteoporosis, weight loss induced osteoporosis, post-transplant osteoporosis, migratory osteoporosis, idiopathic osteoporosis, juvenile osteoporosis.
CN202011366096.5A 2020-11-29 2020-11-29 Bone formation promoting polypeptide and application thereof Active CN112457371B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202011366096.5A CN112457371B (en) 2020-11-29 2020-11-29 Bone formation promoting polypeptide and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202011366096.5A CN112457371B (en) 2020-11-29 2020-11-29 Bone formation promoting polypeptide and application thereof

Publications (2)

Publication Number Publication Date
CN112457371A CN112457371A (en) 2021-03-09
CN112457371B true CN112457371B (en) 2021-12-10

Family

ID=74809293

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202011366096.5A Active CN112457371B (en) 2020-11-29 2020-11-29 Bone formation promoting polypeptide and application thereof

Country Status (1)

Country Link
CN (1) CN112457371B (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115322245A (en) * 2021-06-30 2022-11-11 北京泽勤生物医药有限公司 Polypeptide for improving osteoblast activity
CN114621432B (en) * 2022-03-07 2024-02-13 中国科学院长春应用化学研究所 Polyamino acid with capability of inducing cell calcification as well as preparation method and application thereof
CN117965441A (en) * 2024-04-02 2024-05-03 青岛宝迈得生物科技有限公司 Method for improving immunoregulation capacity of umbilical cord mesenchymal stem cells

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0336760A2 (en) * 1988-04-06 1989-10-11 Celtrix Pharmaceuticals, Inc. Bone-inducing protein
WO2004014949A2 (en) * 2002-08-08 2004-02-19 The Nottingham Trent University Gastric and colon cancer-associated antigens
CN1933859A (en) * 2004-03-19 2007-03-21 首尔国立大学工业基金会 Bone graft and scaffolding materials immobilized with osteogenesis enhancing peptides on the surface
CN101272801A (en) * 2005-09-28 2008-09-24 加利福尼亚大学董事会 Calcium binding peptides
CN101772351A (en) * 2007-06-05 2010-07-07 东方酵母工业株式会社 A novel bone mass increasing agent
CN104922655A (en) * 2009-02-06 2015-09-23 加利福尼亚大学董事会 Calcium-binding agents induce hair growth and/or nail growth
CN106075389A (en) * 2016-07-27 2016-11-09 同济大学 A kind of targeting is enhanced to the osteoplastic medicine of osteocyte and synthetic method thereof
CN111467478A (en) * 2020-04-14 2020-07-31 上海长征医院 Application of polypeptide Kp-10 in preparation of medicine for treating and preventing osteosarcoma

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0336760A2 (en) * 1988-04-06 1989-10-11 Celtrix Pharmaceuticals, Inc. Bone-inducing protein
WO2004014949A2 (en) * 2002-08-08 2004-02-19 The Nottingham Trent University Gastric and colon cancer-associated antigens
CN1933859A (en) * 2004-03-19 2007-03-21 首尔国立大学工业基金会 Bone graft and scaffolding materials immobilized with osteogenesis enhancing peptides on the surface
CN101272801A (en) * 2005-09-28 2008-09-24 加利福尼亚大学董事会 Calcium binding peptides
CN103819538A (en) * 2005-09-28 2014-05-28 加利福尼亚大学董事会 Calcium binding peptides
CN101772351A (en) * 2007-06-05 2010-07-07 东方酵母工业株式会社 A novel bone mass increasing agent
CN104922655A (en) * 2009-02-06 2015-09-23 加利福尼亚大学董事会 Calcium-binding agents induce hair growth and/or nail growth
CN106075389A (en) * 2016-07-27 2016-11-09 同济大学 A kind of targeting is enhanced to the osteoplastic medicine of osteocyte and synthetic method thereof
CN111467478A (en) * 2020-04-14 2020-07-31 上海长征医院 Application of polypeptide Kp-10 in preparation of medicine for treating and preventing osteosarcoma

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
Bone-Targeting Systems to Systemically Deliver Therapeutics to Bone Fractures for Accelerated Healing;Jeffery J. Nielsen等;《Current Osteoporosis Reports》;20200829;第18卷;第453页左栏第3段-右栏第1段 *
Selective interference of ACTH4–10 with discriminative responding based on the narcotic cue;Francis C.Colpaert等;《Psychoneuroendocrinology》;19781231;第3卷(第2期);203-210 *
Specific Binding and Mineralization of Calcified Surfaces by Small Peptides;Daniel K. Yarbrough等;《Calcified Tissue International volume》;20091201;第86卷;58-66 *
骨质疏松性椎体压缩骨折的治疗进展;张义龙等;《河北医学》;20171231;第23卷(第8期);1398-1401 *

Also Published As

Publication number Publication date
CN112457371A (en) 2021-03-09

Similar Documents

Publication Publication Date Title
CN112457371B (en) Bone formation promoting polypeptide and application thereof
US7078221B2 (en) Nucleic acid molecules encoding osteogenic proteins
US5814604A (en) Methods for inducing endochondral bone formation comprising administering CBMP-2A, CBMP-2B, and/or virants thereof
CA2572964C (en) Purified amphiphilic peptide compositions and uses thereof
RU2557654C2 (en) Therapeutic agents for reduction of parathyroid hormone levels
EP1270585B1 (en) Peptide derivative
RU2198182C2 (en) Analogs of parathyroid gland hormone
JP5508275B2 (en) Bone morphogenic protein binding peptide
CN101534846A (en) Glucagon analogs exhibiting physiological solubility and stability
CN102481330A (en) Variants of c-type natriuretic peptide
JP5466017B2 (en) Surgical application for BMP binding proteins
CN113388005B (en) Polypeptide for enhancing osteoblast activity and application thereof in treating orthopedic diseases
WO2006041205A1 (en) Angiogenesis promoter
JP2002540216A (en) Treatment of bone disorders using adrenomedullin or adrenomedullin agonist
AU2015342341A1 (en) Novel Growth Hormone-Releasing Hormone Analogs and Application Thereof in Preparation of Drugs for Treating Infertility
US6352973B1 (en) Bone stimulating factor
CN110225920B (en) Bifunctional novel peptides with cell permeability and bone tissue regeneration capability and uses thereof
WO2022110092A1 (en) Osteogenesis-promoting polypeptide and use thereof
US11624060B2 (en) Collagen-binding agent compositions and methods of using the same
JPH11506337A (en) Bone stimulating factor
WO2016073435A1 (en) Conjugated polypeptides and uses thereof
CN103547591A (en) Growth hormone releasing factor (GRF) analogs and uses thereof
WO2023272658A1 (en) Polypeptide for enhancing osteoblast activity, and application thereof in treatment of orthopedic disease
CN106084029B (en) For promoting peptide and its application of Osteoblast Differentiation or vascularization
EP4368629A1 (en) Peptide and composition

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant