CN112442512A - Gene editing system for Japanese medaka embryos and cells based on tRNA-gRNA-cRNA - Google Patents

Abstract

The invention belongs to the field of molecular biology, and discloses a tRNA-gRNA system constructed by utilizing tRNA sequences of rice, which can generate gRNAs with functionality under the action of RNA polymerase promoter CMV in medaka embryos and cells without in vitro first transcription of the gRNAs, so that the medaka genome can be subjected to gene editing under the combined action of the system and a CRISPR/Cas9 system. The method proves that the CMV-tRNA-gRNA sequence can generate functional gRNA in fish cells and embryos and carries out gene editing together with Cas9, and meanwhile, the cRNA-tRNA strategy is designed to provide convenience for cloning a multi-gene target from a template of the strategy in one step, provide a scheme for synchronously cloning and knocking out the multi-gene target, and provide a more convenient way for constructing a stable gene knockout cell line and a strain with a knocked out specific tissue.

Description

Gene editing system for Japanese medaka embryos and cells based on tRNA-gRNA-cRNA

Technical Field

The invention belongs to the field of molecular biology, and particularly relates to a method, namely a RNA polymerase promoter CMV is used for driving a tRNA-sgRNA system to stably express sgRNA in vivo, and gene editing can be carried out in fish cells and embryos by combining with a Cas9 expression vector or a Cas9 protein.

Background

A CRISPR/Cas system formed by Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) and CRISPR-associated protein (Cas) is an important acquired immune system in archaea (Jinek et al, 2012). As one of the members of this system, the optimized CRISPR/Cas9 system has been developed as a powerful tool for gene editing technology. The CRISPR/Cas9 system cuts genomic DNA under the guidance of sgRNA by using Cas9 protein in the process of realizing gene editing to generate nonhomologous end connection and homologous end repair (Mali et al, 2013; Ran et al, 2013), thereby realizing the mutation of sequences near target positions in eukaryotic, prokaryotic and viral genomes (Jiang et al, 2013; Platt et al, 2014; Tang et al, 2017; Wevers et al, 2017; A.Xu et al, 2015).

In order to achieve multigene knock-out or gene editing in specific tissues in organisms using the CRISPR/Cas9 system, most researchers have generally used RNA polymerase class III promoters (e.g., U6, 7SK, H1) to drive expression of sgrnas to achieve multigene editing, or tissue-specific RNA polymerase class II promoters to drive specific expression of Cas9 protein to achieve gene editing in specific tissues (Chen et al, 2017; Merenda et al, 2017). However, related studies have shown that the sequence or function of these promoters is not conserved across species. For example, in medaka in japan, expression of sgRNA cannot be driven using the human U6 promoter (liu et al, 2018). Recently, new strategies are applied to generate sgrnas with function in vivo. The first strategy, which utilizes the sgRNA sequence linked to the target sequence of endonuclease Csy4 to be cleaved by Csy4 protein to form functional sgRNA, has successfully achieved gene knock-out in yeast, higher plants, zebrafish, and human cell lines (Cermak et al, 2017; Ferreira et al, 2018; Nissim et al, 2014; Qin et al, 2015). However, zebrafish embryos co-injected with Csy4 mRNA, Cas9 mRNA and Csy4-gRNA exhibited severe malformations, suggesting that Csy4 protein was severely toxic to zebrafish embryos ((Qin et al, 2015). the second strategy was to cleave Ribozyme-linked sgRNA sequences with ribozymes (ribozymes) to form sgrnas, and to induce conditional gene knock-out under the control of RNA polymerase class II promoters (He et al, 2017). in this strategy, since Hammerhead ribozymes (HH) had 5 'end cleavage activity and hepatitis delta virus ribozymes (HDV) had 3' end cleavage activity, it was required to be applied simultaneously to the method to cleave transcripts containing Ribozyme and sgRNA sequences (Avis), and the sequences of these two ribozymes were not identical when the long expression of the tRNA sequences was most convenient and the long expression of the 3 'plasmid was also complicated and the construction of the 3' plasmid was most convenient ' characteristics of cleavage at the ends by RNase P and RNase Z, respectively (Forster & Altman, 1990; Schiffer et al, 2002), whereby the length of the sequence joining multiple sgRNAs to tRNA is shorter than the length of the sequence joining sgRNAs to ribozymes, has been achieved in the knock-out of multiple genes in plants, fruit flies, zebrafish, and human cells (Knapp et al, 2019; Port & Bullock, 2016; Qi et al, 2016; Shiraki & Kawakami, 2018; Xie et al, 2015). In addition, under the control of tissue-specific promoters, this approach achieves gene knockout of specific tissues in mice (Xu et al, 2017). Undoubtedly, the tRNA-gRNA system is currently the best solution to mediate multiple gene knockouts or tissue conditional knockouts.

Recently, the CRISPR/Cas9 system has been deployed in japanese medaka to obtain mutants, mainly by co-injection of sgRNA and optimized Cas9 mRNA into embryos at cell stage 1 (Fang et al, 2018). However, a method of multigene knockout or tissue conditional knockout has not been established in medaka in Japan, and it is a problem that active gRNAs can be expressed in fish cells.

Disclosure of Invention

The invention aims to provide a sequence unit for expressing gRNA in medaka embryos or cells; the unit is obtained by connecting tRNA (sequence shown in SEQ ID NO. 1), target gene gRNA and cRNA (sequence shown in SEQ ID NO. 2) in sequence.

Another object of the present invention is to provide use of the above sequence units, which can produce functional gRNA in medaka after inserting the N sequence units in tandem (N is 1 or 2 or 3) into a fish-expressing plasmid vector, and thus can be used for gene editing of medaka.

The last purpose of the invention is to provide a medaka embryo or cell gene editing method which is simple, can edit a plurality of genes simultaneously and has high editing efficiency.

In order to achieve the purpose, the invention adopts the following technical measures:

a sequence unit for expressing a gRNA in a medaka embryo or cell; the unit is obtained by connecting tRNA (sequence shown in SEQ ID NO. 1), target gene gRNA and cRNA (sequence shown in SEQ ID NO. 2) in sequence.

Use of a sequence unit for expressing a gRNA in a medaka embryo or cell, wherein the sequence unit can be used for gene editing of the medaka embryo or spermatogonial stem cell;

in the above applications, preferably, the N sequence units are inserted into a fish expression plasmid vector after being connected in series (N is 1 or 2 or 3), and the obtained vector and the linearized Cas9 mRNA are microinjected into medaka embryos or are transfected into spermatogonial stem cells with a plasmid expressing Cas9 protein, so as to achieve editing of a target gene.

A method for single gene editing of a medaka embryo or cell, comprising the steps of:

1) tRNA (sequence shown in SEQ ID NO. 1), target gene gRNA and cRNA (sequence shown in SEQ ID NO. 2) are connected in sequence to obtain tRNA-gRNA-cRNA;

2) inserting tRNA-gRNA-cRNA into pCS2+ plasmid digested with BamHI and Xho I to form pCS2-tRNA-gRNA plasmid;

3) linearizing the pZCAS9 plasmid, transcribing in vitro to synthesize ZCAS9 mRNA, and microinjecting the mRNA and tRNA-gRNA-cRNA into medaka embryos at 1 cell stage; or the pZCAS9 plasmid is mixed with the pCS2-tRNA-gRNA plasmid to transfect medaka spermatogonial stem cells.

In the above-described method, preferably, when the target gene is tyr, the sequence of tRNA-gRNA-cRNA is: SEQ ID NO.7 or SEQ ID NO. 3.

A medaka embryo or cell double-gene editing method is characterized in that step 1) in a single-gene editing method is replaced by: the tRNA-gRNA1-cRNA is connected with the tRNA-gRNA2-cRNA in series to obtain gRNA1-cRNA-tRNA-gRNA 2; gRNA1 and gRNA2 refer to grnas of other different target genes; the rest of the operation is the same.

Compared with the prior art, the invention has the following advantages:

1. the invention utilizes an RNA polymerase promoter CMV to stably express sgRNA.

2. tRNA is basically non-toxic to fish cells and embryos and can produce functional gRNA.

3. The constructed pCS2-tRNA-tyr gRNA can be used for transcribing gRNA in vitro or stably expressing the gRNA in vivo, and a cloning site (BbsI-BbsI) in the middle of the plasmid is convenient for inserting the gRNA of an exogenous fragment, so that the designed BbsI-BbsI site can remove all bases in the middle of the tRNA-cRNA without remaining bases, and can be used for directly cloning other gene targets.

4. The constructed vector can generate a cRNA-tRNA fusion fragment, provides a template for knocking out double genes, can design a target site of any double gene (gRNA1/gRNA2, gRNA1 and gRNA2 refer to gRNAs of other different target genes) to perform simple PCR amplification to obtain a double-gene knocked-out fragment gRNA1-cRNA-tRNA-gRNA2, constructs a knocked-out plasmid, can be cloned to the middle of pCS2-tRNA-tyr gRNA (CMV-SP 6-tRNA-MCS-cRNA-tRNA-tyrRNA-cRNA) through simple one-step fusion-PCR, and obtains a vector (CMV-SP6-tRNA-gRNA 1-cRNA-tRNA-gRNA-2-cRNA-tRNA-tyrRNA-cRNA) containing a plurality of gRNAs so as to knock out double genes or triple genes.

Drawings

FIG. 1 is a schematic diagram showing the construction of a single gene (tyr) and double gene (pax6.1, tyr) editing vector in medaka.

FIG. 2 shows the sequences and sequencing results of the mutants obtained after editing the tyr gene in medaka embryos and SG3 cells.

FIG. 3 shows the reproducible mutants obtained after editing the tyr gene in the embryo.

FIG. 4 is the observation and sequence analysis of medaka embryos after double editing of pax6.1 and tyr genes;

the graph shows that medaka embryos are phenotypically mutated and further confirmed from the DNA sequence by sequencing.

Detailed Description

The technical scheme of the invention is a conventional mode in the field if not specifically stated; the reagents or materials used, if not specifically indicated, are commercially available. The present invention is described by taking tyr of a Japanese medaka as an example, and the editing purpose can be achieved by using other genes pax6.1 and tyr.

Example 1:

single gene editing of medaka embryos in japan based on tRNA sequences:

1. experimental Material

The wild Orange-Red strain Japanese medaka is bred in a 28 ℃ constant temperature water circulation system at an aquatic institute experimental teaching base of Huazhong university of agriculture, the illumination period is 14h of illumination, and 10h of no light treatment is carried out. The embryos used for microinjection are obtained by natural oviposition of male and female medaka. Medaka spermatogonial stem cells SG3(Hong et al, 2004) were stored in the laboratory and cultured in an incubator at 28 ℃.

2. Plasmid construction

The tRNA-MCS-cRNA-tRNA-tyr gRNA-cRNA (SEQ ID NO.3) sequence was artificially synthesized by Hakkaimingyi Biotechnology Co., Ltd (http:// www.dna1953.com.cn/index. html), and this fragment was inserted into a BamH I + Xho I-digested pCS2+ plasmid (Yu et al, 2017) to construct a pCS2-tRNA-tyr gRNA plasmid (FIG. 1, SEQ ID NO. 4). The sequence shown in SEQ ID NO.3 was used in this step to construct a pCS2-tRNA-tyr gRNA plasmid as a template for the introduction of a new target gene gRNA in example 2.

3. Microinjection

The pZCAS9 plasmid (Fan et al, 2018) was linearized with XbaI, followed by mMESSAGEEMMAC HINE^TMThe T7 Transcription Kit is used for in vitro Transcription synthesis of ZCAS9 mRNA. A mixed solution of ZCAS9 mRNA at a final concentration of 500 ng/. mu.L, pCS2-tRNA-tyr gRNA plasmid at a final concentration of 30 ng/. mu.L, and 0.05% phenol red was injected into embryos at 1-cell stage using a Picoiter microinjector injector (Warner, USA). The injected embryos were cultured in ERM medium in a 28 ℃ incubator (Chen et al, 2017) (Fang et al, 2018). The ocular pigment loss was observed and photographed on the fifth day of injection using a Leica M205 FA microscope.

4. Cell culture and transfection

Uniformly spreading the medaka spermatogonial stem cells SG3 with good growth in a 12-well plate, wherein the cell density is 5 multiplied by 10⁵Transfection was performed when the cells grew to 70%. During transfection, the cell culture medium is sucked out, and 1mL of Opti-MEM culture medium is added; two enzyme-free sterile EP tubes were taken, one added with 50. mu. LOpti-MEM and 1. mu.g of plasmid (pCS2-tRNA-tyr gRNA: pZCAS9 ═ 1:1), and the other with 50. mu. LOpti-MEM and 3. mu.L of lipofectamine 2000, and incubated at room temperature for 5 min; mixing the mixed solution in the two EP tubes, and incubating for 10min at room temperature; the combined mixture was added to the cell wells, the cell plates were gently shaken and mixed, placed in an incubator for 3h, and the Opti-MEM medium was changed to normal medium for culture (Xue et al, 2018). Transfections were performed every 2 days for 3 times. After transfection was complete, the cells were observed under an inverted fluorescence microscope and photographed.

5. Mutation detection

Collection of phenotypically mutated embryos, wild-type embryos, transfected cells and untransfected cells genomic DNA was extracted separately. Only a single embryo is needed for extracting the embryo genome DNA. Putting the collected embryos or cells into a 1.5mL centrifuge tube, respectively adding 600ul of cell lysate and 10 uL of proteinase K with the concentration of 50 ng/uL, incubating for 4h at 65 ℃, taking out the embryos or the cells after complete lysis, cooling at room temperature, adding 200 u L7.5M ammonium acetate, turning the mixture upside down, uniformly mixing, putting the mixture on ice for 5min, and centrifuging at 12000rpm for 10min at 4 ℃; collecting supernatant 600 μ L to a new tube, adding 600 μ L isopropanol, shaking to separate out precipitate, and standing for 1-2 min; centrifuging at 12000rpm at 4 deg.C for 10min, and removing supernatant; adding 1mL of 75% ethanol, shaking gently, mixing, centrifuging at 12000rpm at 4 deg.C for 5min, and removing supernatant; adding 100% ethanol 1mL, centrifuging at 12000rpm at 4 deg.C for 5min, discarding supernatant, drying precipitate in air to obtain translucent precipitate, adding appropriate amount of TE solution, dissolving, and storing at-20 deg.C (Wang et al, 2011).

A fragment near the tyr gRNA target site was amplified. The primers are tyr-F:5 'CGAGTACGCCTACCTGTT and tyr-R: 5' CTAGATGTGGTCGGTGAGA. The amplification system was as follows 1. mu.L of 100 ng/. mu.L gDNA, 1. mu.L of 10. mu.m tyr-F + tyr-R, 10. mu.L of LTaq enzyme Mix, 8. mu.L of sterile water. The amplification condition is 94 ℃ for 3 min; 30 cycles of 94 ℃ for 30s, 60 ℃ for 30s, and 72 ℃ for 30 s; preserving at 72 deg.C for 5min and 4 deg.C. After the detection of the agar gel electrophoresis, the PCR amplification product is purified by a gel recovery kit for cutting gel. The recovered DNA fragment was ligated to pMD18-T vector, and the ligation product was transformed into DH 5. alpha. competent cells and plated. 10 clones were picked for PCR identification of bacterial solutions, and then sent to Tianyihui-Chi Biotech Ltd for sequencing. The sequencing results were analyzed using Snapgene software (https:// www.snapgene.com /). Through sequence analysis, a total of 5 clones showed sequence mutations, and gene mutations occurred mainly near the target sequence, resulting in various frame shift mutations;

partial results of mutation and sequencing of embryos and SG3 cells, as shown in fig. 2; the obtained mutant embryos showed albinism trait and could be propagated (fig. 3).

In the above embodiment, the gene editing can also be performed by replacing tRNA-MCS-cRNA-tRNA-tyr gRNA-cRNA (SEQ ID NO.3) with tRNA-tyr gRNA-cRNA (SEQ ID NO. 7).

Example 2:

double gene (pax6.1 and tyr) editing of medaka embryos in japan based on tRNA sequences:

BbsI digestion of plasmid pCS2-tRNA-tyr gRNA, amplification with primers F:5 'TTCCCGGCTGGTGCATGCCTGGTGGAATCCGGCAGGTTTTAGAGCTAGAAATAGC and R: 5' TTCTAGCTCTAAAACTCATCTGTGGCTCTGGACTGTGCACCAGCCGGGAATCGAA (the gRNA of gene pax6.1 was introduced by primers) to obtain the sequence shown in SEQ ID NO.5, and use of the primer

II One Step Cloning Kit (C112-01, Vazyme) the amplified fragment was inserted into BbsI digested pCS2-tRNA-tyr gRNA plasmid, to obtain the double gene edited vector pCS2-tRNA-PT gRNA (SEQ ID NO. 6).

2. Microinjection

The pZCAS9(Fan et al, 2018) plasmid was linearized with XbaI, followed by mMESSAGEEMMAC HINE^TMThe T7 Transcription Kit is used for in vitro Transcription synthesis of ZCAS9 mRNA. A mixed solution of ZCAS9 mRNA at a final concentration of 500 ng/. mu.L, pCS2-tRNA-PT gRNA plasmid at a final concentration of 30 ng/. mu.L, and 0.05% phenol red was injected into embryos at 1-cell stage using a Picoiter microinjector injector (Warner, USA). The injected embryos were incubated in a 28 ℃ incubator with ERM medium (Chen et al)2017) (Fang et al, 2018). The ocular pigment loss was observed and photographed on the fifth day of injection using a Leica M205 FA microscope.

3. Mutation detection

And collecting the phenotype mutation embryo and the wild embryo to respectively extract genome DNA. Only a single embryo is needed for extracting the embryo genome DNA. Putting the collected embryos into a 1.5mL centrifuge tube, respectively adding 600ul of cell lysate and 10 uL of 50 ng/. mu.L proteinase K, incubating for 4h at 65 ℃, taking out the embryos or cells after complete lysis, cooling at room temperature, adding 200 u L7.5M ammonium acetate, turning upside down, uniformly mixing, putting on ice for 5min, and centrifuging at 12000rpm at 4 ℃ for 10 min; collecting supernatant 600 μ L to a new tube, adding 600 μ L isopropanol, shaking to separate out precipitate, and standing for 1-2 min; centrifuging at 12000rpm at 4 deg.C for 10min, and removing supernatant; adding 1mL of 75% ethanol, shaking gently, mixing, centrifuging at 12000rpm at 4 deg.C for 5min, and removing supernatant; adding 100% ethanol 1mL, centrifuging at 12000rpm at 4 deg.C for 5min, discarding supernatant, drying precipitate in air to obtain translucent precipitate, adding appropriate amount of TE solution, dissolving, and storing at-20 deg.C (Wang et al, 2011).

A fragment near the tyr gRNA target site was amplified. The primers are tyr-F:5 'CGAGTACGCCTACCTGTT and tyr-R: 5' CTAGATGTGGTCGGTGAGA;

amplifying fragments near the target site of pax6.1, wherein primers are pax6.1-F:5 'TTTGCTCATTGATACTGTTGTGGGT and pax6.1-R: 5' ATGTCATGCCTTTGTTGCCC;

the amplification system was as follows 1. mu.L of 100 ng/. mu.L gDNA, 1. mu.L of 10 μm tyr-F + tyr-R, 10. mu.L of the LTaq enzyme Mix, 8. mu.L of sterile water. The amplification condition is 94 ℃ for 3 min; 30 cycles of 94 ℃ for 30s, 60 ℃ for 30s, and 72 ℃ for 30 s; preserving at 72 deg.C for 5min and 4 deg.C. After the detection of the agar gel electrophoresis, the PCR amplification product is purified by a gel recovery kit for cutting gel. The recovered DNA fragment was ligated to pMD18-T vector, and the ligation product was transformed into DH 5. alpha. competent cells and plated. And selecting a single clone to perform PCR identification on the bacterial liquid, and then sending the bacterial liquid to Zengyihui Biotechnology limited company for sequencing. The sequencing results were analyzed using Snapgene software (https:// www.snapgene.com /). Through sequence analysis, 1 mutation occurs in 8 clones picked from the tyr gene, 3 mutations occur in 48 clones picked from the pax6.1 gene, and the mutations mainly occur near a target sequence, so that a plurality of frameshift mutations are caused.

The phenotype of the mutated embryo after double gene editing is shown in FIG. 4. The embryos selected in the double gene knock-out are tested and the result is double gene mutation.

Sequence listing

<110> university of agriculture in Huazhong

<120> tRNA-gRNA-cRNA-based gene editing system for Japanese medaka embryos and cells

<160> 13

<170> SIPOSequenceListing 1.0

<210> 1

<211> 77

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

aacaaagcac cagtggtcta gtggtagaat agtaccctgc cacggtacag acccgggttc 60

gattcccggc tggtgca 77

<210> 2

<211> 82

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gttttagagc tagaaatagc aagttaaaat aaggctagtc cgttatcaac ttgaaaaagt 60

ggcaccgagt cggtgctttt tt 82

<210> 3

<211> 350

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aacaaagcac cagtggtcta gtggtagaat agtaccctgc cacggtacag acccgggttc 60

gattcccggc tggtgcaggg tcttcgagaa gacctgtttt agagctagaa atagcaagtt 120

aaaataaggc tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg caacaaagca 180

ccagtggtct agtggtagaa tagtaccctg ccacggtaca gacccgggtt cgattcccgg 240

ctggtgcagg acaaacctct gacctgtggt tttagagcta gaaatagcaa gttaaaataa 300

ggctagtccg ttatcaactt gaaaaagtgg caccgagtcg gtgctttttt 350

<210> 4

<211> 4438

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cgccattctg cctggggacg tcggagcaag cttgatttag gtgacactat agaatacaag 60

ctacttgttc tttttgcagg atcccatcga ttcgaattca acaaagcacc agtggtctag 120

tggtagaata gtaccctgcc acggtacaga cccgggttcg attcccggct ggtgcagggt 180

cttcgagaag acctgtttta gagctagaaa tagcaagtta aaataaggct agtccgttat 240

caacttgaaa aagtggcacc gagtcggtgc aacaaagcac cagtggtcta gtggtagaat 300

agtaccctgc cacggtacag acccgggttc gattcccggc tggtgcagga caaacctctg 360

acctgtggtt ttagagctag aaatagcaag ttaaaataag gctagtccgt tatcaacttg 420

aaaaagtggc accgagtcgg tgcttttttc tcgagcctct agaactatag tgagtcgtat 480

tacgtagatc cagacatgat aagatacatt gatgagtttg gacaaaccac aactagaatg 540

cagtgaaaaa aatgctttat ttgtgaaatt tgtgatgcta ttgctttatt tgtaaccatt 600

ataagctgca ataaacaagt taacaacaac aattgcattc attttatgtt tcaggttcag 660

ggggaggtgt gggaggtttt ttaattcgcg gccgcggcgc caatgcattg ggcccggtac 720

ccagcttttg ttccctttag tgagggttaa ttgcgcgctt ggcgtaatca tggtcatagc 780

tgtttcctgt gtgaaattgt tatccgctca caattccaca caacatacga gccggaagca 840

taaagtgtaa agcctggggt gcctaatgag tgagctaact cacattaatt gcgttgcgct 900

cactgcccgc tttccagtcg ggaaacctgt cgtgccagct gcattaatga atcggccaac 960

gcgcggggag aggcggtttg cgtattgggc gctcttccgc ttcctcgctc actgactcgc 1020

tgcgctcggt cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt 1080

tatccacaga atcaggggat aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg 1140

ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca taggctccgc ccccctgacg 1200

agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga ctataaagat 1260

accaggcgtt tccccctgga agctccctcg tgcgctctcc tgttccgacc ctgccgctta 1320

ccggatacct gtccgccttt ctcccttcgg gaagcgtggc gctttctcat agctcacgct 1380

gtaggtatct cagttcggtg taggtcgttc gctccaagct gggctgtgtg cacgaacccc 1440

ccgttcagcc cgaccgctgc gccttatccg gtaactatcg tcttgagtcc aacccggtaa 1500

gacacgactt atcgccactg gcagcagcca ctggtaacag gattagcaga gcgaggtatg 1560

taggcggtgc tacagagttc ttgaagtggt ggcctaacta cggctacact agaaggacag 1620

tatttggtat ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt 1680

gatccggcaa acaaaccacc gctggtagcg gtggtttttt tgtttgcaag cagcagatta 1740

cgcgcagaaa aaaaggatct caagaagatc ctttgatctt ttctacgggg tctgacgctc 1800

agtggaacga aaactcacgt taagggattt tggtcatgag attatcaaaa aggatcttca 1860

cctagatcct tttaaattaa aaatgaagtt ttaaatcaat ctaaagtata tatgagtaaa 1920

cttggtctga cagttaccaa tgcttaatca gtgaggcacc tatctcagcg atctgtctat 1980

ttcgttcatc catagttgcc tgactccccg tcgtgtagat aactacgata cgggagggct 2040

taccatctgg ccccagtgct gcaatgatac cgcgagaccc acgctcaccg gctccagatt 2100

tatcagcaat aaaccagcca gccggaaggg ccgagcgcag aagtggtcct gcaactttat 2160

ccgcctccat ccagtctatt aattgttgcc gggaagctag agtaagtagt tcgccagtta 2220

atagtttgcg caacgttgtt gccattgcta caggcatcgt ggtgtcacgc tcgtcgtttg 2280

gtatggcttc attcagctcc ggttcccaac gatcaaggcg agttacatga tcccccatgt 2340

tgtgcaaaaa agcggttagc tccttcggtc ctccgatcgt tgtcagaagt aagttggccg 2400

cagtgttatc actcatggtt atggcagcac tgcataattc tcttactgtc atgccatccg 2460

taagatgctt ttctgtgact ggtgagtact caaccaagtc attctgagaa tagtgtatgc 2520

ggcgaccgag ttgctcttgc ccggcgtcaa tacgggataa taccgcgcca catagcagaa 2580

ctttaaaagt gctcatcatt ggaaaacgtt cttcggggcg aaaactctca aggatcttac 2640

cgctgttgag atccagttcg atgtaaccca ctcgtgcacc caactgatct tcagcatctt 2700

ttactttcac cagcgtttct gggtgagcaa aaacaggaag gcaaaatgcc gcaaaaaagg 2760

gaataagggc gacacggaaa tgttgaatac tcatactctt cctttttcaa tattattgaa 2820

gcatttatca gggttattgt ctcatgagcg gatacatatt tgaatgtatt tagaaaaata 2880

aacaaatagg ggttccgcgc acatttcccc gaaaagtgcc acctaaattg taagcgttaa 2940

tattttgtta aaattcgcgt taaatttttg ttaaatcagc tcatttttta accaataggc 3000

cgaaatcggc aaaatccctt ataaatcaaa agaatagacc gagatagggt tgagtgttgt 3060

tccagtttgg aacaagagtc cactattaaa gaacgtggac tccaacgtca aagggcgaaa 3120

aaccgtctat cagggcgatg gcccactacg tgaaccatca ccctaatcaa gttttttggg 3180

gtcgaggtgc cgtaaagcac taaatcggaa ccctaaaggg agcccccgat ttagagcttg 3240

acggggaaag ccggcgaacg tggcgagaaa ggaagggaag aaagcgaaag gagcgggcgc 3300

tagggcgctg gcaagtgtag cggtcacgct gcgcgtaacc accacacccg ccgcgcttaa 3360

tgcgccgcta cagggcgcgt cccattcgcc attcaggctg cgcaactgtt gggaagggcg 3420

atcggtgcgg gcctcttcgc tattacgcca gtcgaccata gccaattcaa tatggcgtat 3480

atggactcat gccaattcaa tatggtggat ctggacctgt gccaattcaa tatggcgtat 3540

atggactcgt gccaattcaa tatggtggat ctggacccca gccaattcaa tatggcggac 3600

ttggcaccat gccaattcaa tatggcggac ttggcactgt gccaactggg gaggggtcta 3660

cttggcacgg tgccaagttt gaggaggggt cttggccctg tgccaagtcc gccatattga 3720

attggcatgg tgccaataat ggcggccata ttggctatat gccaggatca atatataggc 3780

aatatccaat atggccctat gccaatatgg ctattggcca ggttcaatac tatgtattgg 3840

ccctatgcca tatagtattc catatatggg ttttcctatt gacgtagata gcccctccca 3900

atgggcggtc ccatatacca tatatggggc ttcctaatac cgcccatagc cactccccca 3960

ttgacgtcaa tggtctctat atatggtctt tcctattgac gtcatatggg cggtcctatt 4020

gacgtatatg gcgcctcccc cattgacgtc aattacggta aatggcccgc ctggctcaat 4080

gcccattgac gtcaatagga ccacccacca ttgacgtcaa tgggatggct cattgcccat 4140

tcatatccgt tctcacgccc cctattgacg tcaatgacgg taaatggccc acttggcagt 4200

acatcaatat ctattaatag taacttggca agtacattac tattggaagg acgccagggt 4260

acattggcag tactcccatt gacgtcaatg gcggtaaatg gcccgcgatg gctgccaagt 4320

acatccccat tgacgtcaat ggggaggggc aatgacgcaa atgggcgttc cattgacgta 4380

aatgggcggt aggcgtgcct aatgggaggt ctatataagc aatgctcgtt tagggaac 4438

<210> 5

<211> 223

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ttcccggctg gtgcatgcct ggtggaatcc ggcaggtttt agagctagaa atagcaagtt 60

aaaataaggc tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg caacaaagca 120

ccagtggtct agtggtagaa tagtaccctg ccacggtaca gacccgggtt cgattcccgg 180

ctggtgcaca gtccagagcc acagatgagt tttagagcta gaa 223

<210> 6

<211> 4613

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cgccattctg cctggggacg tcggagcaag cttgatttag gtgacactat agaatacaag 60

ctacttgttc tttttgcagg atcccatcga ttcgaattca acaaagcacc agtggtctag 120

tggtagaata gtaccctgcc acggtacaga cccgggttcg attcccggct ggtgcatgcc 180

tggtggaatc cggcaggttt tagagctaga aatagcaagt taaaataagg ctagtccgtt 240

atcaacttga aaaagtggca ccgagtcggt gcaacaaagc accagtggtc tagtggtaga 300

atagtaccct gccacggtac agacccgggt tcgattcccg gctggtgcac agtccagagc 360

cacagatgag ttttagagct agaaatagca agttaaaata aggctagtcc gttatcaact 420

tgaaaaagtg gcaccgagtc ggtgcaacaa agcaccagtg gtctagtggt agaatagtac 480

cctgccacgg tacagacccg ggttcgattc ccggctggtg caggacaaac ctctgacctg 540

tggttttaga gctagaaata gcaagttaaa ataaggctag tccgttatca acttgaaaaa 600

gtggcaccga gtcggtgctt ttttctcgag cctctagaac tatagtgagt cgtattacgt 660

agatccagac atgataagat acattgatga gtttggacaa accacaacta gaatgcagtg 720

aaaaaaatgc tttatttgtg aaatttgtga tgctattgct ttatttgtaa ccattataag 780

ctgcaataaa caagttaaca acaacaattg cattcatttt atgtttcagg ttcaggggga 840

ggtgtgggag gttttttaat tcgcggccgc ggcgccaatg cattgggccc ggtacccagc 900

ttttgttccc tttagtgagg gttaattgcg cgcttggcgt aatcatggtc atagctgttt 960

cctgtgtgaa attgttatcc gctcacaatt ccacacaaca tacgagccgg aagcataaag 1020

tgtaaagcct ggggtgccta atgagtgagc taactcacat taattgcgtt gcgctcactg 1080

cccgctttcc agtcgggaaa cctgtcgtgc cagctgcatt aatgaatcgg ccaacgcgcg 1140

gggagaggcg gtttgcgtat tgggcgctct tccgcttcct cgctcactga ctcgctgcgc 1200

tcggtcgttc ggctgcggcg agcggtatca gctcactcaa aggcggtaat acggttatcc 1260

acagaatcag gggataacgc aggaaagaac atgtgagcaa aaggccagca aaaggccagg 1320

aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc tccgcccccc tgacgagcat 1380

cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga caggactata aagataccag 1440

gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc cgaccctgcc gcttaccgga 1500

tacctgtccg cctttctccc ttcgggaagc gtggcgcttt ctcatagctc acgctgtagg 1560

tatctcagtt cggtgtaggt cgttcgctcc aagctgggct gtgtgcacga accccccgtt 1620

cagcccgacc gctgcgcctt atccggtaac tatcgtcttg agtccaaccc ggtaagacac 1680

gacttatcgc cactggcagc agccactggt aacaggatta gcagagcgag gtatgtaggc 1740

ggtgctacag agttcttgaa gtggtggcct aactacggct acactagaag gacagtattt 1800

ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa gagttggtag ctcttgatcc 1860

ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt gcaagcagca gattacgcgc 1920

agaaaaaaag gatctcaaga agatcctttg atcttttcta cggggtctga cgctcagtgg 1980

aacgaaaact cacgttaagg gattttggtc atgagattat caaaaaggat cttcacctag 2040

atccttttaa attaaaaatg aagttttaaa tcaatctaaa gtatatatga gtaaacttgg 2100

tctgacagtt accaatgctt aatcagtgag gcacctatct cagcgatctg tctatttcgt 2160

tcatccatag ttgcctgact ccccgtcgtg tagataacta cgatacggga gggcttacca 2220

tctggcccca gtgctgcaat gataccgcga gacccacgct caccggctcc agatttatca 2280

gcaataaacc agccagccgg aagggccgag cgcagaagtg gtcctgcaac tttatccgcc 2340

tccatccagt ctattaattg ttgccgggaa gctagagtaa gtagttcgcc agttaatagt 2400

ttgcgcaacg ttgttgccat tgctacaggc atcgtggtgt cacgctcgtc gtttggtatg 2460

gcttcattca gctccggttc ccaacgatca aggcgagtta catgatcccc catgttgtgc 2520

aaaaaagcgg ttagctcctt cggtcctccg atcgttgtca gaagtaagtt ggccgcagtg 2580

ttatcactca tggttatggc agcactgcat aattctctta ctgtcatgcc atccgtaaga 2640

tgcttttctg tgactggtga gtactcaacc aagtcattct gagaatagtg tatgcggcga 2700

ccgagttgct cttgcccggc gtcaatacgg gataataccg cgccacatag cagaacttta 2760

aaagtgctca tcattggaaa acgttcttcg gggcgaaaac tctcaaggat cttaccgctg 2820

ttgagatcca gttcgatgta acccactcgt gcacccaact gatcttcagc atcttttact 2880

ttcaccagcg tttctgggtg agcaaaaaca ggaaggcaaa atgccgcaaa aaagggaata 2940

agggcgacac ggaaatgttg aatactcata ctcttccttt ttcaatatta ttgaagcatt 3000

tatcagggtt attgtctcat gagcggatac atatttgaat gtatttagaa aaataaacaa 3060

ataggggttc cgcgcacatt tccccgaaaa gtgccaccta aattgtaagc gttaatattt 3120

tgttaaaatt cgcgttaaat ttttgttaaa tcagctcatt ttttaaccaa taggccgaaa 3180

tcggcaaaat cccttataaa tcaaaagaat agaccgagat agggttgagt gttgttccag 3240

tttggaacaa gagtccacta ttaaagaacg tggactccaa cgtcaaaggg cgaaaaaccg 3300

tctatcaggg cgatggccca ctacgtgaac catcacccta atcaagtttt ttggggtcga 3360

ggtgccgtaa agcactaaat cggaacccta aagggagccc ccgatttaga gcttgacggg 3420

gaaagccggc gaacgtggcg agaaaggaag ggaagaaagc gaaaggagcg ggcgctaggg 3480

cgctggcaag tgtagcggtc acgctgcgcg taaccaccac acccgccgcg cttaatgcgc 3540

cgctacaggg cgcgtcccat tcgccattca ggctgcgcaa ctgttgggaa gggcgatcgg 3600

tgcgggcctc ttcgctatta cgccagtcga ccatagccaa ttcaatatgg cgtatatgga 3660

ctcatgccaa ttcaatatgg tggatctgga cctgtgccaa ttcaatatgg cgtatatgga 3720

ctcgtgccaa ttcaatatgg tggatctgga ccccagccaa ttcaatatgg cggacttggc 3780

accatgccaa ttcaatatgg cggacttggc actgtgccaa ctggggaggg gtctacttgg 3840

cacggtgcca agtttgagga ggggtcttgg ccctgtgcca agtccgccat attgaattgg 3900

catggtgcca ataatggcgg ccatattggc tatatgccag gatcaatata taggcaatat 3960

ccaatatggc cctatgccaa tatggctatt ggccaggttc aatactatgt attggcccta 4020

tgccatatag tattccatat atgggttttc ctattgacgt agatagcccc tcccaatggg 4080

cggtcccata taccatatat ggggcttcct aataccgccc atagccactc ccccattgac 4140

gtcaatggtc tctatatatg gtctttccta ttgacgtcat atgggcggtc ctattgacgt 4200

atatggcgcc tcccccattg acgtcaatta cggtaaatgg cccgcctggc tcaatgccca 4260

ttgacgtcaa taggaccacc caccattgac gtcaatggga tggctcattg cccattcata 4320

tccgttctca cgccccctat tgacgtcaat gacggtaaat ggcccacttg gcagtacatc 4380

aatatctatt aatagtaact tggcaagtac attactattg gaaggacgcc agggtacatt 4440

ggcagtactc ccattgacgt caatggcggt aaatggcccg cgatggctgc caagtacatc 4500

cccattgacg tcaatgggga ggggcaatga cgcaaatggg cgttccattg acgtaaatgg 4560

gcggtaggcg tgcctaatgg gaggtctata taagcaatgc tcgtttaggg aac 4613

<210> 7

<211> 179

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

aacaaagcac cagtggtcta gtggtagaat agtaccctgc cacggtacag acccgggttc 60

gattcccggc tggtgcagga caaacctctg acctgtggtt ttagagctag aaatagcaag 120

ttaaaataag gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgctttttt 179

<210> 8

<211> 55

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ttcccggctg gtgcatgcct ggtggaatcc ggcaggtttt agagctagaa atagc 55

<210> 9

<211> 55

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ttctagctct aaaactcatc tgtggctctg gactgtgcac cagccgggaa tcgaa 55

<210> 10

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

cgagtacgcc tacctgtt 18

<210> 11

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ctagatgtgg tcggtgaga 19

<210> 12

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

tttgctcatt gatactgttg tgggt 25

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

atgtcatgcc tttgttgccc 20

Claims (6)

1. A sequence unit for expressing a gRNA in a medaka embryo or cell; the unit is obtained by connecting tRNA, target gene gRNA and cRNA in sequence;

the tRNA has the sequence of SEQ ID NO.1, and the cRNA has the sequence of SEQ ID NO. 2.

2. Use of the sequence unit according to claim 1 in gene editing of medaka embryos or spermatogonial stem cells.

3. The use according to claim 2, wherein 1 or 2 or 3 sequence units of claim 1 are inserted into a fish expression plasmid vector after being connected in series, and the obtained vector is microinjected with linearized Cas9 mRNA into medaka embryos or transfected with plasmids expressing Cas9 protein into spermatogonial stem cells; however, when the sequence unit is 2 or 3, the gRNA of the target gene in the sequence unit is different.

4. A method for single gene editing of a medaka embryo or cell, comprising the steps of:

1) the tRNA, the target gene gRNA and the cRNA are sequentially connected to obtain tRNA-gRNA-cRNA; the tRNA has a sequence of SEQ ID NO.1, and the cRNA has a sequence of SEQ ID NO. 2;

2) inserting tRNA-gRNA-cRNA into pCS2+ plasmid digested with BamHI and Xho I to form pCS2-tRNA-gRNA plasmid;

3) linearizing the pZCAS9 plasmid, transcribing in vitro to synthesize ZCAS9 mRNA, and microinjecting the mRNA and tRNA-gRNA-cRNA into medaka embryos at 1 cell stage; or the pZCAS9 plasmid is mixed with the pCS2-tRNA-gRNA plasmid to transfect medaka spermatogonial stem cells.

5. The method of claim 1, wherein when the gene of interest is tyr, the sequence of the tRNA-gRNA-cRNA is: SEQ ID NO.7 or SEQ ID NO. 3.

6. A method for double-gene editing of an embryo or cell of a medaka, comprising the step 1) substitution into: tRNA-gRNA1-cRNA and tRNA-gRNA2-cRNA are connected in series to obtain

gRNA1-cRNA-tRNA-gRNA 2; gRNA1 and gRNA2 refer to grnas of other different target genes;

the rest of the operation is the same.

Images