CN112439026A - Application of dry dendrobium alcohol extract in preparing medicament for treating lipid metabolism disorder - Google Patents
Application of dry dendrobium alcohol extract in preparing medicament for treating lipid metabolism disorder Download PDFInfo
- Publication number
- CN112439026A CN112439026A CN202011160478.2A CN202011160478A CN112439026A CN 112439026 A CN112439026 A CN 112439026A CN 202011160478 A CN202011160478 A CN 202011160478A CN 112439026 A CN112439026 A CN 112439026A
- Authority
- CN
- China
- Prior art keywords
- alcohol extract
- dendrobium
- dry
- cholesterol
- lipid metabolism
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/18—Magnoliophyta (angiosperms)
- A61K36/88—Liliopsida (monocotyledons)
- A61K36/898—Orchidaceae (Orchid family)
- A61K36/8984—Dendrobium
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/06—Antihyperlipidemics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2236/00—Isolation or extraction methods of medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicine
- A61K2236/30—Extraction of the material
- A61K2236/33—Extraction of the material involving extraction with hydrophilic solvents, e.g. lower alcohols, esters or ketones
- A61K2236/333—Extraction of the material involving extraction with hydrophilic solvents, e.g. lower alcohols, esters or ketones using mixed solvents, e.g. 70% EtOH
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2236/00—Isolation or extraction methods of medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicine
- A61K2236/30—Extraction of the material
- A61K2236/39—Complex extraction schemes, e.g. fractionation or repeated extraction steps
Landscapes
- Health & Medical Sciences (AREA)
- Natural Medicines & Medicinal Plants (AREA)
- Life Sciences & Earth Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Engineering & Computer Science (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- General Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Organic Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Obesity (AREA)
- Hematology (AREA)
- Diabetes (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Alternative & Traditional Medicine (AREA)
- Botany (AREA)
- Medical Informatics (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Epidemiology (AREA)
- Medicines Containing Plant Substances (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention belongs to the technical field of pharmacy, and relates to application of a dry dendrobium alcohol extract in preparation of a medicament for treating lipid metabolism disorder. Experimental results prove that the dry dendrobium alcohol extract prepared by the invention not only can obviously increase the mRNA expression levels of scavenger receptor class B I, proprotein convertase subtilisin kexin9, low-density lipoprotein receptor and lecithin cholesterol acyltransferase so as to effectively regulate the metabolism of cholesterol, but also can effectively inhibit the expression level of insulin-induced gene (INSIG2) so as to effectively regulate the synthesis of cholesterol, and also can obviously inhibit the expression level of Microsomal Triacylglycerol Transport Protein (MTTP) so as to effectively regulate the anabolism of Triglyceride (TG). Therefore, the dry dendrobium alcohol extract provided by the invention can be used for preparing a medicament for treating lipid metabolism disorder, and has a good development prospect in the aspect of treating the lipid metabolism disorder.
Description
Technical Field
The invention relates to the technical field of pharmacy, in particular to application of a dry dendrobium alcohol extract in preparing a medicament for treating lipid metabolism disorder.
Background
Lipids are a generic term for fats, cholesterol, phospholipids, lipoproteins, glycolipids. The lipid metabolism disorder includes various diseases caused by enzyme deficiency in the metabolic process of fatty acid, cholesterol, lipoprotein, sphingolipid, etc. The two major lipids in blood are: cholesterol and triglycerides. Fats and certain proteins combine to form lipoproteins that circulate in the blood. The major lipoproteins are Chylomicrons (CM), Very Low Density Lipoproteins (VLDL), Low Density Lipoproteins (LDL) and High Density Lipoproteins (HDL). Each lipoprotein has a different use, and the route of breakdown and elimination is slightly different. Such as chylomicrons, originate in the intestine and carry some of the digested fat from the intestine into the blood. The fat in chylomicrons is then removed as energy or stored in adipocytes through the action of a series of enzymes. Finally, residual chylomicrons, which have lost most of the fat (triglycerides), are cleared from the blood by the liver.
There are two main ways in which the body regulates lipoprotein levels: one is to reduce lipoprotein synthesis and allow them to enter the blood circulation. The other is to speed up or slow down the removal of lipoproteins from the blood. Abnormal levels of circulating fat, particularly cholesterol, in the blood can lead to long-term effects. With increasing total cholesterol levels in an individual, there is an increased risk of atherosclerosis and coronary or carotid artery disease (and thus an increased risk of vascular disease or stroke). Not all cholesterol increases the risk of cardiovascular disease. Increased cholesterol (so-called bad cholesterol) carried by Low Density Lipoproteins (LDL) increases risk; cholesterol carried by High Density Lipoproteins (HDL), the so-called good cholesterol, is less dangerous and often beneficial.
Disclosure of Invention
The invention aims to provide application of a dry dendrobium alcohol extract in preparing a medicament for treating lipid metabolism disorder, and the application is a new application of the dendrobium extract. At present, no report indicates that the dendrobium extract is applied to the treatment of lipid metabolism disorder.
The invention provides application of a dry dendrobium alcohol extract in preparing a medicament for treating lipid metabolism disorder, wherein the dry dendrobium alcohol extract is obtained by extracting dendrobium medicinal materials. Further, the dendrobium stem is one or a combination of more than two of dendrobium huoshanense, dendrobium officinale, dendrobium nobile, dendrobium fimbriatum and dendrobium chrysotoxum.
Further, the preparation steps of the dry dendrobium alcohol extract are as follows: extracting herba Dendrobii dry powder with 18-20 times of 75% ethanol at 55-60 deg.C, repeatedly extracting, mixing extracts, concentrating under reduced pressure to 1/6-1/8, and freeze drying to constant weight.
Furthermore, the dry dendrobium alcohol extract can be prepared into any pharmaceutically acceptable oral and non-oral preparation forms, such as one of granules, pills, capsules, tablets, powder, paste and oral liquid.
The invention has the beneficial effects that:
the dry dendrobe alcohol extract prepared by the invention not only can obviously increase the mRNA expression levels of scavenger receptor type B I, proprotein convertase subtilisin kexin9, low-density lipoprotein receptor and lecithin cholesterol acyltransferase so as to effectively regulate the metabolism of cholesterol, but also can effectively inhibit the expression level of insulin-induced gene (INSIG2) so as to effectively regulate the synthesis of cholesterol, and also can obviously inhibit the expression level of Microsomal Triacylglycerol Transfer Protein (MTTP) so as to effectively regulate the anabolism of Triglyceride (TG). Therefore, the dry dendrobium alcohol extract provided by the invention can be used as a medicine for treating lipid metabolism disorder.
Drawings
FIG. 1 is a graph of dried extract of Dendrobium nobile Lindl which increases gene expression of atherosclerotic scavenger receptor class B I, proprotein convertase subtilisin/kexin 9, low density lipoprotein receptor and lecithin cholesterol acyltransferase in HuH7 cells; where data are expressed as means ± SD, SRB 1: the atherosclerotic scavenger receptor type B class I,＊＊＊p is less than 0.05; PCSK 9: the proprotein convertase subtilisin/kexin type 9,＊＊p is less than 0.01; LDLR: (ii) a low-density lipoprotein receptor, wherein the lipoprotein receptor is a low-density lipoprotein receptor,＊＊＊p is less than 0.05; LCAT: a lecithin cholesterol ester acyltransferase that is capable of converting cholesterol ester into a phospholipid,＊＊＊p is less than 0.05; a administration group vs blank group; DEE: an alcohol extract of dry dendrobium nobile from DryDendrobium Ethanol Extraction; fold: multiple times.
FIG. 2 shows that the dry dendrobe alcohol extract inhibits the gene expression of mRNA of insulin-induced gene; wherein, the data are expressed as means ± SD, and INSIG 2: an insulin-inducible gene, which is capable of inducing insulin,＊＊P＜0.01，＊＊＊p is less than 0.05; a administration group vs blank group; DEE: dry dendrobe extract from Ethanol extract of Dry dendrobe extract; fold: multiple times.
FIG. 3 shows that the dry dendrobium extract inhibits the gene expression of microsomal triacylglycerol transporter in HuH7 cells(ii) a Wherein, data are expressed as means ± SD, MTTP: a microsomal triacylglycerol transporter protein,＊＊＊p is less than 0.05; a administration group vs blank group; DEE: dry dendrobe extract from Ethanol extract of Dry dendrobe extract; fold: multiple times.
Detailed Description
The present invention will be further illustrated with reference to the following specific examples.
Generally, lipoprotein levels are regulated by: one is to reduce lipoprotein synthesis and allow them to enter the blood circulation; the other is to speed up or slow down the removal of lipoproteins from the blood.
In the body, cholesterol is bound to proteins, mainly in the form of lipoproteins, and is transported in the body mainly in the form of high density lipoprotein cholesterol (HDL-C) and low density lipoprotein cholesterol (LDL-C). Of these, HDL-C is called good cholesterol.
High Density Lipoprotein (HDL) has the effect of reversing cholesterol transport back to the liver. In the process, Lecithin Cholesterol Acyltransferase (LCAT) plays a crucial role in the synthesis of HDL and reverse cholesterol transfer, LCAT is synthesized and released by liver into blood circulation and plays a role in catalyzing blood plasma, LCAT transfers C2 unsaturated fatty acid of HDL Lecithin to free cholesterol to generate lysolecithin and cholesterol ester, and plasma cholesterol is almost 70% -80% cholesterol ester and is all caused by the catalytic generation of LCAT.
Low Density Lipoprotein Receptor (LDLR) is one of the major members of the Low Density Lipoprotein Receptor family, and is capable of binding to Low Density Lipoprotein (LDL), playing an important role in the metabolism of cholesterol in vivo. LDLR is expressed in almost all cells, but in the largest number in the liver. LDL binds to LDLR on the surface of cell membrane, and is swallowed into cells, and LDLB is hydrolyzed by lysosomal enzyme to release free cholesterol and fatty acid for the cells to utilize. Cholesterol can regulate the transcription of LDLR through a negative feedback regulation mechanism, and when the level of cholesterol in cells is increased, the transcription of LDLR is reduced; when intracellular cholesterol is consumed, transcription of LDLR is activated.
Proprotein convertase subtilisin/kexin type 9 (PCSK9), also known as neuronal apoptosis regulating convertase (neuralaApoptosis-regulated convertase1, NARC-1)), inhibitors of which have been approved by the regulatory agencies for the treatment of patients with inadequate LDL-C decline. PCSK9 is a serine protease encoded by the PCSK9 gene, produced mainly by the liver, and PCSK9 binds to LDL receptors (LDL-R) on the surface of hepatocytes, and is capable of degrading LDL-R and elevating LDL-C levels in the blood.
Antibodies to PCSK9 interfere with their binding to LDL-R, allowing the liver to express more LDL-R and lower blood LDL-C levels. The atherosclerotic scavenger receptor class I (SRBI) plays an important role in regulating High Density Lipoprotein (HDL) mediated cholesterol and cholesterol ester uptake, can promote reverse cholesterol transport, clear excessive cholesterol in blood and tissues, protect blood vessels, prevent the formation of atherosclerosis or improve the formed atherosclerosis. SRB1 is a well-known HDL receptor, a key receptor for mediating reverse cholesterol transport, and is capable of causing bidirectional cholesterol transport. On one hand, SRBI can mediate excessive free cholesterol in peripheral cells to flow out, so as to prevent atherosclerosis caused by excessive accumulation of free cholesterol; on the other hand, SRBI can bind to HDL, promoting the uptake of cholesterol in HDL by hepatocytes, returning excess cholesterol to the liver for further metabolism.
The metabolism of cholesterol is regulated by a common transcription factor family-Sterol Regulatory Element Binding Protein (SREBP), and SREBPs regulated by intracellular cholesterol levels are mediated by both SREBP cleavage-active protein (SCAP) and insulin-induced gene (insulin-induced gene, INSIG). There are two subtypes of the INSIG gene, INSIG1 and INSIG2, with 59% sequence homology. Both are involved in the transport of cholesterol regulatory factor binding proteins. The SREBP family has wide effects and has direct activation effects on more than 30 genes involved in fatty acid metabolism, triglyceride synthesis and cholesterol balance regulation. The SREBP family includes three members: namely SREBP-IC, SREBP-la and SREBP-2 c; among them, SREBP2 is one of the existing subtypes of cholesterol regulatory element binding proteins (SREBPs), which contains three subtypes, i.e., SREBP1a, SREBP1c and SREBP 2. SREBP1a and SREBP1c easily activate genes in the synthesis process of fatty acid and triacylglycerol, while SREBP2 can specifically bind to sterol regulatory element 1 (SRE-1), SRE-1 is an enhancer for Low-density lipoprotein receptor (LDLR) and HMG-COAR genes, and SREBP2 stimulates the enhancement of gene expression containing SRE-1, thereby activating HMGCR gene expression. Thus, the protein INSIG2 regulates the transcription of enzymes required for adipocyte differentiation and lipid synthesis by affecting the activation of SREBPs.
Triglycerides (TG) are the main form of biological energy storage, and when the energy intake of a human body exceeds the energy it consumes, the excess energy is stored in the form of TG in adipose tissue. In the body, cholesterol can bind to proteins and exist in the form of lipoproteins.
Microsomal Triacylglycerol Transporter (MTTP) is a protein complex that is mainly present in the endoplasmic reticulum and microsomes of hepatocytes and intestinal epithelial cells, and its main physiological function is to transport Triglyceride (TG), cholesterol ester, and phosphatidylcholine outside the endoplasmic reticulum to the lumen of the endoplasmic reticulum, to participate in the synthesis of lipoproteins containing apolipoprotein b (apob), and is an essential lipid transporter for the synthesis and secretion of Very Low Density Lipoprotein (VLDL) in hepatocytes and Chylomicron (CM) in intestinal epithelial cells. Studies have shown that MTTP activity is significantly reduced and intracellular TG accumulation is inhibited. The high and low expression level of MTTP can directly influence the metabolism of lipid and lipoprotein, thereby causing diseases such as lipid metabolism disorder and the like.
According to the invention, the application effect of the dendrobium stem alcohol extract as a medicament in treating lipid metabolism disorder is researched by detecting the expression level of mRNA related to cholesterol synthesis, metabolism and triglyceride anabolism.
Because the types of the existing medicinal dendrobium are various, the embodiment of the invention takes dendrobium huoshanense as an example, and researches the application effect of the dendrobium alcohol extract in the aspect of treating lipid metabolism disorder, but the dendrobium in the invention is not limited to dendrobium huoshanense, and can also be medicinal dendrobium of other same genera, such as dendrobium candidum, dendrobium nobile, dendrobium fimbriatum or dendrobium chrysotoxum.
The dendrobium huoshanense is originally produced in places such as Anhuoshan in China, is the first protective variety in more than 200 endangered rare varieties which are important special items for Chinese traditional medicines in China, is an extreme product in medicinal dendrobium, is also a unique and famous traditional Chinese medicine material with geographical marks of original production places in Hohan county, and is historically known as the first of nine major Chinese immortals and healthy soft gold, and is recorded in Shen nong Ben Cao and Ben Cao gang mu. The polysaccharide contained in the dendrobium huoshanense can greatly improve SOD (main substance for delaying senility) in a human body, and has obvious effects on enhancing immunity, resisting fatigue, delaying senility, promoting cancer cell apoptosis and the like, thereby achieving the effects of health care and life prolonging.
Example 1
Preparing the dry dendrobium alcohol extract as follows:
preparing the dry dendrobium alcohol extract: weighing 20g of dendrobium huoshanense dry powder, extracting with 400mL of 75% ethanol at 55-60 ℃ for 2 times, extracting for 24h each time, combining the extracting solutions for 2 times, concentrating the combined extracting solutions under reduced pressure to 1/6-1/8 of the original volume, and freeze-drying to constant weight to obtain the dry dendrobium huoshanense alcohol extract with the mass volume concentration of 100 mg/mL. The dry dendrobium alcohol extract with the mass concentration of 100mg/mL prepared in the example 1 is filtered and sterilized by a filter membrane with the thickness of 0.22 μm before the test, and then diluted to prepare a series of dry dendrobium alcohol extract liquid medicines with the mass concentrations of 10 μ g/mL and 100 μ g/mL in sequence, and the dry dendrobium alcohol extract liquid medicines are refrigerated and stored for the test for later use.
(I) Detecting the expression grouping of the dendrobium stem alcohol extract on mRNA of genes related to cholesterol synthesis, metabolism and triglyceride synthesis in vitro HuH7 cells: after the HuH7 cells are recovered, DMEM culture solution is used for transferring the cells into a culture dish, the cells are cultured under the conditions of 37 ℃ and 5% CO2, the cells are synchronized for 12 hours, and the cells are randomly divided into 2 groups, namely: blank control group: no drug administration (0. mu.g/ml); (ii) administration group: the dose group of the dry dendrobe alcohol extract (DEE: 100 mu g/mL) and the low dose group of the dry dendrobe alcohol extract (DEE: 10 mu g/mL) have the administration effect of 12 hours, and the fluorescence quantitative PCR: total RNA from HuH7 cells was extracted using RNAiso Plus, 1. mu.g of total RNA was reverse transcribed into cDNA by Oligo dT18 by quantitative PCR technique, and primers were PCR amplified using Toyobo company ThunderBirdSYBR qPCR Mix reagents as per instructions. Each set of samples had 3 duplicate wells to ensure validity of experimental data. Using GAPDH as an internal reference, mRNA of the scavenger receptor class B type I (SRBI), proprotein convertase subtilisin kexin9 type (PCSK9), Low Density Lipoprotein Receptor (LDLR), Lecithin Cholesterol Acyltransferase (LCAT), insulin inducible gene (INSIG2), and Microsomal Triacylglycerol Transporter (MTTP) of interest was quantified relative to the expression of the internal reference Gene (GAPDH), respectively. Data (i.e., fold change in expression of the gene of interest in the experimental group relative to the blank control group) was analyzed using Graphpad 7. The primers used were: SRB1 (hSRBI-f: CTGTGGGTGAGATCATGTGG; hSRBI-r:
GCTCAGCTGCAGTTTCACAG)、PCSK9(hPCSK9-f：AGTTGCCCCATGTCGACTAC；hPCSK9-r：GAGATACACCTCCACCAGGC)、LDLR(hLDLR-f-2：
AGGAGACGTGCTTGTCTGTC；hLDLR-r-2：CTGAGCCGTTGTCGCAGT)、LCAT(hLCAT-f：ACGGGGCCCTACTGTAATAA；hLCAT-r：AGATGCAGCACTGGAAGGAG)、INSIG2(h-INSIG2-f：GTCCAGTGTAATGCGGTGTG；h-INSIG2-r：
TACTCCAAGGCCAAAACCAC) and MTTP (hMTTP-f: GAGCTTGTACAGCCGGTCAT, respectively; hMTTP-r: CAGTTGAGGATTGCTGGTCA).
The experimental results shown in fig. 1 show that the dry dendrobe alcohol extract prepared by the invention can obviously increase the mRNA expression levels of scavenger receptor class B type I (SRBI), proprotein convertase subtilisin kexin9 type PCSK9 (PCSK9), Low Density Lipoprotein Receptor (LDLR) and Lecithin Cholesterol Acyl Transferase (LCAT) compared with a blank control group (administration concentration is 0 mug/mL) by administration of a low dose of dry dendrobe alcohol extract, and can obviously increase the expression level of Lecithin Cholesterol Acyl Transferase (LCAT) by administration of a medium dose of dry dendrobe alcohol extract. Therefore, the dry dendrobium alcohol extract can effectively regulate the metabolism of cholesterol. Therefore, the dry dendrobium alcohol extract can be used as a medicine for treating lipid metabolism disorder.
The experimental results shown in the attached figure 2 show that the dry dendrobe alcohol extract prepared by the invention can obviously inhibit the expression level of an insulin-induced gene (INSIG2) in comparison with a blank control group (the administration concentration is 0 mu g/mL), and the administration of the low-dose and medium-dose dry dendrobe alcohol extract can obviously inhibit the expression level of the insulin-induced gene (INSIG 2). Therefore, the dry dendrobium alcohol extract can effectively regulate the biosynthesis of cholesterol.
The experimental results shown in the attached figure 3 show that the dry dendrobe alcohol extract prepared by the invention can obviously inhibit the expression level of Microsomal Triacylglycerol Transporter (MTTP) by taking the dry dendrobe alcohol extract with low dosage to a blank control group (the administration concentration is 0 mug/mL). Therefore, the dry dendrobe alcohol extract can effectively regulate the anabolism of Triglyceride (TG).
In conclusion, the dry dendrobium alcohol extract provided by the invention not only can obviously increase the mRNA expression levels of scavenger receptor class B I, proprotein convertase subtilisin kexin9, low-density lipoprotein receptor and lecithin cholesterol acyltransferase and effectively regulate the metabolism of cholesterol, but also can effectively inhibit the expression level of insulin-induced gene (INSIG2) and effectively regulate the synthesis of cholesterol, and also can obviously inhibit the expression level of Microsomal Triacylglycerol Transport Protein (MTTP) and effectively regulate the anabolism of Triglyceride (TG). Therefore, the dry dendrobium alcohol extract provided by the invention can be used as a medicine for treating lipid metabolism disorder.
The above description is only for the preferred embodiment of the present invention, but the scope of the present invention is not limited thereto, and any person skilled in the art should be considered to be within the technical scope of the present invention, and the technical solutions and the inventive concepts thereof according to the present invention should be equivalent or changed within the scope of the present invention.
Claims (4)
1. The application of the dry dendrobium alcohol extract in preparing the medicament for treating lipid metabolism disorder is characterized in that the dry dendrobium alcohol extract is extracted from dendrobium medicinal materials.
2. The use of the dry dendrobium alcohol extract of claim 1 in the preparation of a medicament for treating lipid metabolism disorder, wherein the dendrobium is one or a combination of more than two of dendrobium huoshanense, dendrobium officinale, dendrobium nobile, dendrobium stem tassel and dendrobium chrysotoxum.
3. The use of the dry dendrobe alcohol extract in the preparation of a medicament for treating lipid metabolism disorder according to claim 1, wherein the dry dendrobe alcohol extract is prepared by the following steps: extracting herba Dendrobii dry powder with 18-20 times of 75% ethanol at 55-60 deg.C, repeatedly extracting, mixing extractive solutions, concentrating under reduced pressure to 1/6-1/8, and freeze drying to constant weight.
4. The use of the dry alcohol extract of dendrobii nobile as claimed in any one of claims 1 to 3 in the manufacture of a medicament for the treatment of lipid metabolism disorders, wherein the dry alcohol extract of dendrobii nobile can be prepared into any pharmaceutically acceptable oral and non-oral dosage forms.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011160478.2A CN112439026A (en) | 2020-10-27 | 2020-10-27 | Application of dry dendrobium alcohol extract in preparing medicament for treating lipid metabolism disorder |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011160478.2A CN112439026A (en) | 2020-10-27 | 2020-10-27 | Application of dry dendrobium alcohol extract in preparing medicament for treating lipid metabolism disorder |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112439026A true CN112439026A (en) | 2021-03-05 |
Family
ID=74736661
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011160478.2A Pending CN112439026A (en) | 2020-10-27 | 2020-10-27 | Application of dry dendrobium alcohol extract in preparing medicament for treating lipid metabolism disorder |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112439026A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114304064A (en) * | 2021-12-16 | 2022-04-12 | 首都医科大学 | Method for establishing animal model with head deformity accompanied with nerve-dyskinesia |
-
2020
- 2020-10-27 CN CN202011160478.2A patent/CN112439026A/en active Pending
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114304064A (en) * | 2021-12-16 | 2022-04-12 | 首都医科大学 | Method for establishing animal model with head deformity accompanied with nerve-dyskinesia |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Lee et al. | Benefit of Monascus-fermented products for hypertension prevention: a review | |
| Huang et al. | Nutritional preconditioning of apigenin alleviates myocardial ischemia/reperfusion injury via the mitochondrial pathway mediated by notch1/hes1 | |
| Jiang et al. | Banxia Baizhu Tianma decoction attenuates obesity-related hypertension | |
| KR101523820B1 (en) | Pharmaceutical composition for preventing or treating obesity or metabolic disorders comprising Aster glehni extract as an active ingredient | |
| CN101836725B (en) | Application of red rice residue product in preparing health-care food for lowering blood fat | |
| Chiang et al. | Adlay seed (Coix lacryma-jobi L.) extracts exhibit a prophylactic effect on diet-induced metabolic dysfunction and nonalcoholic fatty liver disease in mice | |
| Kim et al. | Perilla leaf extract ameliorates obesity and dyslipidemia induced by high‐fat diet | |
| Wu et al. | Red yeast rice prevents atherosclerosis through regulating inflammatory signaling pathways | |
| CN102302153B (en) | Health-care composition and preparation method and application thereof | |
| TW201038205A (en) | The compositions of Monascus fermented products with a function that reduces body fatness formation and the method for manufacturing the same | |
| KR101708165B1 (en) | Composition for prevention, improvement or treatment of peripheral neuropathy comprising Lithospermi Radix extract as effective component | |
| CN112439026A (en) | Application of dry dendrobium alcohol extract in preparing medicament for treating lipid metabolism disorder | |
| CN101057678A (en) | Composition containing natural plant extraction or monomer | |
| CN1895393B (en) | Health-care composition for regulating blood fat | |
| CN112494471A (en) | Application of cholesterol ester synthetase ACAT1 inhibitor in preparing medicine for preventing/treating non-alcoholic fatty liver disease | |
| CN102934769B (en) | Bee pollen mixture buccal tablet for alleviating hangovers | |
| CN111759952A (en) | Application of dendrobe extract in preparation of drugs for regulating cholesterol metabolism | |
| CN111729037A (en) | Application of dry dendrobium alcohol extract in preparing medicament for treating lipid metabolism disorder | |
| Skinner et al. | Impact of obesity on the toxicity of a multi-ingredient dietary supplement, OxyELITE Pro™(New Formula), using the novel NZO/HILtJ obese mouse model: Physiological and mechanistic assessments | |
| CN105832721B (en) | In the method for wedelia chinensis extract treatment hypertriglyceridema | |
| JPS6212721A (en) | Production of shiitake reishi | |
| CN111803591A (en) | Application of dry dendrobium aqueous extract in preparation of obesity treatment drug | |
| CN111773324A (en) | Application of fresh dendrobium aqueous extract in preparing medicine for treating metabolic diseases | |
| Ma et al. | Intervention and effect analysis of Achyranthes bidentata blume combined with aerobic exercise to interfere with type 2 diabetes. | |
| CN112107653A (en) | Application of dendrobe extract in preparation of drugs for regulating cholesterol metabolism |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication |