CN112426534A - Ferritin nanoparticle with C-terminal modified tumor penetrating peptide RGERPPR, and preparation method and application thereof - Google Patents

Abstract

The invention discloses a ferritin nanoparticle of C-terminal modified tumor penetrating peptide RGERPPR, a preparation method and application thereof. Ferritin nanoparticles with C-terminal modified RGERPPR, which is linked to the C-terminus of ferritin via a linker sequence, exposed to the exterior of ferritin. The ferritin nano-particle of the C-terminal modified tumor penetrating peptide RGERPPR has stronger targeting capability and cell penetrating power, can be strongly combined with tumor cells, has stronger cytotoxicity of the prepared antitumor drug, provides a very good carrier model for the subsequent drug targeted tumor cell treatment, and has good application prospect.

Description

Ferritin nanoparticle with C-terminal modified tumor penetrating peptide RGERPPR, and preparation method and application thereof

Technical Field

The invention relates to a ferritin nanoparticle of C-terminal modified tumor penetrating peptide RGERPPR, a preparation method and application thereof, belonging to the technical field of anti-tumor.

Background

The protein cage has good stability, biocompatibility and biodegradability, and is widely applied to drug delivery and vaccine development. The ferritin is self-assembled by 24 protein subunits to form a nano hollow cage-shaped structure, the nano cage has good water solubility, strong biocompatibility, good in-vivo stability and uniform size, has targeting property, and can be specifically combined with transferrin receptor 1(TfR1) overexpressed in tumor cells. Although ferritin's inherent tumor targeting ability makes it a simple drug delivery vehicle, it is not limited to targeting only the native receptor TfR1, and additional targeting moieties can be readily modified for a variety of uses.

A large number of researches show that the expression level of Neuropilin 1(Neuropilin-1, NRP-1) on the surfaces of tumor cells and tumor vascular endothelial cells is too high, and the target treatment of tumors by using the NRP-1 as a target to mediate a nano drug delivery system has been developed. The surface modified tumor penetrating peptide RGERPPR nano particle can be specifically combined with NRP-1 over-expressed by tumor cells and NRP-1 over-expressed by tumor new vessels, enters cells under the mediation of the NRP-1, enhances the uptake of ferritin nano particles by the cells, and provides good feasibility for the transfer of medicaments. In order to further improve the ability to target tumor cells, it is necessary to research and develop novel nanoparticles that are stronger in cell penetration ability and cell binding effect.

Disclosure of Invention

In order to overcome the defects that the existing nanoparticles are not strong enough in targeting ability and high in efficiency on tumor cells, the invention provides the ferritin nanoparticles with the C-terminal modified tumor penetrating peptide RGERPPR, and the preparation method and the application thereof, so that the ferritin nanoparticles are expected to effectively deliver to tumor neovessels and penetrate the vessels to realize double targeting effects on tumor cell transferrin receptor 1(TfR1) and neuropilin receptor 1(NRP-1) while targeting the tumor cells, a very good model is provided for subsequent drug-targeted tumor cell therapy, and the ferritin nanoparticles have a very good application prospect.

In order to solve the technical problems, the technical scheme adopted by the invention is as follows:

a ferritin nanoparticle with C-terminal modified RGERPPR is prepared by linking RGERPPR with ferritin C-terminal via a linking sequence, wherein the RGERPPR is exposed outside ferritin.

The ferritin of the C-terminal modified tumor penetrating peptide RGERPPR is a ferritin modification-based fusion protein.

RGERPPR represents a tumor penetrating peptide.

Adding MMP-2 enzyme cutting site or mutating MMP-2 enzyme cutting site sequence into the connecting sequence to respectively obtain HFtn-MMP2-RGE and HFtn-mMMP2-RGE, wherein MMP2 represents the site which can be cut by MMP-2 enzyme, and the sequence is PLGLAG; mMMP2 represents the MMP-2 cleavage site that is mutated with the sequence ALGAAG; HFtn is a nano-protein cage consisting of 24 ferritin subunits. RGE is an abbreviation for the tumor penetrating peptide RGERPPR. The MMP-2 enzyme is a recombinant human matrix metalloproteinase 2.

The ferritin coding gene containing MMP-2 enzyme cutting site of the C-terminal modified tumor penetrating peptide RGERPPR is SEQ ID No. 1; the ferritin coding gene containing the enzyme cutting site of mutant MMP-2 of the C-terminal modified tumor penetrating peptide RGERPPR is SEQ ID No. 2; the coding protein of the C-terminal modified tumor penetrating peptide RGERPPR is SEQ ID No. 3.

The ferritin is human heavy chain ferritin. The linker sequence is a linker sequence on human heavy chain ferritin.

The preparation method of the ferritin nanoparticle of the C-terminal modified tumor penetrating peptide RGERPPR comprises the following steps:

(1) construction of recombinant ferritin expression engineering bacteria:

based on an HFtn coding gene, connecting a tumor penetrating peptide RGERPPR with a ferritin C terminal through a connecting sequence at the 3' end of the HFtn coding gene, inserting an MMP-2 enzyme cutting site in the connecting sequence and cloning the MMP-2 enzyme cutting site into a plasmid vector to obtain an HFtn-MMP2-RGE plasmid; inserting a mutant MMP-2 enzyme cutting site in the connecting sequence and cloning the site into a plasmid vector to obtain an HFtn-mMMP2-RGE plasmid; respectively transforming the two plasmids into escherichia coli competent cells, and screening a positive monoclonal transformant through ampicillin resistance to obtain a target recombinant ferritin expression engineering bacterium;

(2) expression and purification of recombinant ferritin:

inoculating engineering bacteria for expressing target recombinant ferritin into a culture medium containing ampicillin at an inoculation ratio of 1 +/-0.02%, adding IPTG (isopropyl thiogalactoside) to induce expression when the OD600 value of the bacteria liquid reaches 0.6-0.8, centrifuging to collect precipitate, then ultrasonically crushing the precipitate, centrifuging to collect supernatant, heating the supernatant in a water bath, centrifuging again, and purifying the target recombinant ferritin multiple times by Size Exclusion Chromatography (SEC) to obtain target recombinant ferritin HFtn-MMP2-RGE and HFtn-mMMP 2-RGE.

In the present application, the term "volume percentage" means a volume percentage unless otherwise specified.

In the step (1), GGTGGTGGTGGTAGCGGTCCGCTGGGTCTGGCAGGTGGTGGTGGTGGTAGCGGTGG TGGTGGTAGCGGTGGTGGTGGTAGCCGTGGTGAACGTCCGCCGCGT is inserted into the connecting sequence to encode the MMP-2 enzyme cutting site, and the gene sequence is subcloned into pET-20b (+) plasmid vector to obtain HFtn-MMP2-RGE plasmid. The host bacteria is escherichia coli; screening by positive single clone and culturing in LB culture medium in large quantity.

In the step (1), the coding gene of the mutant MMP-2 enzyme cutting site inserted into the connecting sequence is GGTGGTGGTGGTAGCGGTGCACTGGGTGCAGCAGGTGGTGGTGGTGGTAGCGGTG GTGGTGGTAGCGGTGGTGGTGGTAGCCGTGGTGAACGTCCGCCGCGT, and the gene sequence is subcloned into a pET-20b (+) plasmid vector to obtain the HFtn-mMMP2-RGE plasmid. The host bacteria is escherichia coli; screening by positive single clone and culturing in LB culture medium in large quantity.

In order to improve the yield, in the step (2), the final concentration of IPTG is 0.5 +/-0.02 mM; and (2) heating the supernatant in water bath at the temperature of 60 +/-5 ℃ for 8-12 min.

The HFtn-MMP2-RGE described above was used to verify that the tumor penetrating peptide RGERPPR is exposed outside of ferritin.

The method for verifying the exposure of the tumor penetrating peptide RGERPPR to the outside of ferritin comprises the following steps: activating recombinant human MMP-2 protein at 1 + -0.02 mM APMA (p-aminophenylmercuric acetate) at 37 + -2 deg.C for 55-65 min, and adding MMP-2 and HFtn-MMP2-RGE proteins activated at gradient concentration into TCBN buffer solution (50mM Tris-HCl, pH 7.5,150mM NaCl,10mM CaCl₂0.05% Brij-35) at 37. + -. 2 ℃ for 55-65 min, verified by 4-20% SDS-PAGE.

For improved accuracy, the gradient concentrations of MMP-2 were 0, 50, 100, 250, and 500 ng/mL.

The target protein can be characterized by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Transmission Electron Microscopy (TEM).

The ferritin nano-particle of the C-terminal modified tumor penetrating peptide RGERPPR is used for preparing antitumor drugs.

Preferably, the ferritin nanoparticles of the C-terminal modified tumor penetrating peptide RGERPPR are used for preparing ferritin-paclitaxel nano drugs of the anti-tumor drugs C-terminal modified tumor penetrating peptide RGERPPR.

The preparation method of the ferritin-paclitaxel nano-drug of the C-terminal modified tumor penetrating peptide RGERPPR comprises the following steps:

A. mixing an HFtn-mMMP2-RGE protein solution with a paclitaxel solution to form a mixed solution, wherein the molar ratio of the HFtn-mMMP2-RGE protein to the paclitaxel is 1 (500 +/-50);

B. b, adjusting the pH value of the mixed solution obtained in the step A to 2-3, stirring for 8-12 min, and then re-adjusting the pH value of the solution to 7.0-7.5;

C. and D, putting the solution obtained in the step B into a dialysis bag with the cut-off value of 6-8kDa for dialysis to remove free paclitaxel, taking out after dialysis for 12-18h, and centrifuging to obtain a supernatant, namely the ferritin-paclitaxel nano medicament of the C-terminal modified tumor penetrating peptide RGERPPR.

The prior art is referred to in the art for techniques not mentioned in the present invention.

The ferritin nano-particle of the C-terminal modified tumor penetrating peptide RGERPPR has stronger targeting capability and cell penetrating power, can be strongly combined with tumor cells, has stronger cytotoxicity of the prepared antitumor drug, provides a very good carrier model for the subsequent drug targeted tumor cell treatment, and has good application prospect.

Drawings

FIG. 1 is a graphical representation of the HFtn-MMP2-RGE and HFtn-mMMP2-RGE proteins of example 3; a is SDS-PAGE picture after recombinant protein purification; b is a transmission electron microscope picture after recombinant protein purification; c is size exclusion chromatogram after HFtn, HFtn-mMMP2-RGE protein purification; d is a circular dichroism chromatogram after the purification of HFtn, HFtn-mMMP2-RGE protein;

FIG. 2 is a SDS-PAGE graph of the enzyme digestion of the gradient concentration MMP-2 of HFtn-MMP2-RGE in example 4;

FIG. 3 is a characterization of HFtn-PTX, HFtn-mMMP2-RGE-PTX in example 5; a is transmission electron micrograph of HFtn-PTX, HFtn-mMMP 2-RGE-PTX; b is a size exclusion chromatogram of HFtn-PTX, HFtn-mMMP 2-RGE-PTX; c is a circular dichrogram of HFtn-PTX, HFtn-mMMP 2-RGE-PTX;

FIG. 4 is the release profile of paclitaxel from HFtn-PTX, HFtn-mMMP2-RGE-PTX paclitaxel nano-drugs in example 6;

FIG. 5 shows the survival rate of A549 cells in example 7 under the action of different concentrations of PTX, HFtn-mMMP2-RGE-PTX nano-drug;

FIG. 6 shows the results of confocal laser scanning and flow cytometry used in example 8 to detect the uptake of HFtn, HFtn-mMMP2-RGE by A549 cells;

FIG. 7 is a graph showing the penetration of HFtn-mMMP2-RGE into A549 three-dimensional tumor spheres in example 9;

FIG. 8 is a graph of the growth inhibition of HFtn-mMMP2-RGE-PTX on A549 three-dimensional tumor spheres in example 10.

Detailed Description

In order to better understand the present invention, the following examples are further provided to illustrate the present invention, but the present invention is not limited to the following examples.

Example 1

Construction of HFtn-MMP2-RGE and HFtn-mMMP2-RGE recombinant ferritin:

based on the HFtn coding gene, the 3' end of the HFtn coding gene is connected with the C terminal of human heavy chain ferritin (Nanjing Sipulin organism) through a connecting sequence, and the coding gene added with MMP-2 enzyme cutting sites in the connecting sequence is as follows: GGTGGTGGTGGTAGCGGTCCGCTGGGTCTGGCAGGTGGTGGTGGTGGTAGCGGTGG TGGTGGTAGCGGTGGTGGTGGTAGCCGTGGTGAACGTCCGCCGCGT, and subcloning the gene sequence into pET-20b (+) plasmid vector to obtain HFtn-MMP2-RGE plasmid;

based on an HFtn coding gene, connecting a tumor penetrating peptide RGERPPR with the C terminal of human heavy chain ferritin at the 3' end of the HFtn coding gene through a connecting sequence, adding GGTGGTGGTGGTAGCGGTGCACTGGGTGCAGCAGGTGGTGGTGGTGGTAGCGGTG GTGGTGGTAGCGGTGGTGGTGGTAGCCGTGGTGAACGTCCGCCGCGT as a coding gene of a mutant MMP-2 enzyme cutting site into the connecting sequence, subcloning the gene sequence into a pET-20b (+) plasmid vector to obtain an HFtn-mMMP2-RGE plasmid;

the two plasmids are respectively heat shocked to escherichia coli competent cells, and positive monoclonals are screened by means of ampicillin resistance, gene sequencing and the like.

Example 2

Expression of HFtn-MMP2-RGE and HFtn-mMMP2-RGE recombinant ferritin:

inoculating 1% of positive recombinant bacteria of HFtn-MMP2-RGE and HFtn-mMMP2-RGE into LB culture medium containing ampicillin (the final concentration is 100 micrograms/ml), at 37 ℃, at 210r/min, shaking overnight to activate the strains for 12 h; adding the activated bacterial liquid into 400mL LB culture medium containing ampicillin (final concentration 100 microgram/mL) with the inoculation amount of 1%, culturing at 37 deg.C and 210r/min until the bacterial liquid OD600 reaches 0.7, adding IPTG with the final concentration of 0.5mM into the culture medium, inducing and culturing at 30 deg.C for 9h, 4 deg.C and 8000 Xg, centrifuging for 5min, collecting thallus, discarding supernatant, adding 5mL lysine buffer (50mM NaH) solution₂PO₄300mM NaCl,10mM Imidazole pH 8) were performedAfter suspending and resuspending, the cells were centrifuged again under the same conditions, and the supernatant was discarded to collect the cells, which were resuspended in 5mL of Lysis buffer and stored at 4 ℃.

Example 3

Separation and purification of HFtn-MMP2-RGE and HFtn-mMMP2-RGE recombinant ferritin:

ultrasonically crushing the bacterial liquid re-suspended by the HFtn-MMP2-RGE and the HFtn-mMMP2-RGE under the ultrasonic conditions that: performing ultrasonic treatment for 5s and 5s at intervals for 30min, centrifuging at 8000 Xg for 10min to collect supernatant, performing water bath at 60 ℃ for 10min, centrifuging at 8000 Xg for 30min again to collect supernatant, and performing multiple purification on the target recombinant ferritin by Size Exclusion Chromatography (SEC) to obtain the target recombinant ferritin HFtn-MMP2-RGE and HFtn-mMMP2-RGE, wherein the characterization results are shown in FIG. 1.

Example 4

MMP-2 cleavage of HFtn-MMP2-RGE recombinant ferritin:

the recombinant human MMP-2 protein was activated at 37 ℃ for 1h with 1mM APMA (p-aminophenylmeruric acid). Gradient concentrations of activated MMP-2(0, 50, 100, 250, 500ng/mL) and HFtn-MMP2-RGE protein were buffered in TCBN (50mM Tris-HCl, pH 7.5,150mM NaCl,10mM CaCl₂And 0.05% Brij-35) system at 37 ℃ for 1h, and using 4-20% SDS-PAGE to verify from FIG. 2 that a protein band lacking RGERPPR appears below the HFtn-MMP2-RGE protein band in the presence of recombinant human MMP-2 protein, it can be confirmed that the short peptide modifying RGERPPR at the C-terminal of ferritin is located outside ferritin.

Example 5

Preparation of HFtn-mMMP2-RGE-PTX paclitaxel nano-drug:

mixing the HFtn-mMMP2-RGE protein solution with paclitaxel dissolved in an absolute ethanol solvent according to a molar ratio of 1:500 (molar ratio of HFtn-mMMP2-RGE protein to paclitaxel) to form a mixed solution, adjusting the pH of the mixed solution to 2.5, slowly stirring for 10min, and then re-adjusting the pH of the solution to 7.0-7.5; putting the solution into a dialysis bag with cut-off value of 6-8kDa, dialyzing for 15h, taking out, centrifuging at 6000rpm for 10min, and collecting the supernatant as the paclitaxel nano-drug with ferritin of C-terminal modified tumor penetrating peptide RGERPPR as carrier, wherein the characterization result is shown in figure 3. Taking part of the supernatant, readjusting the pH to 2.5 to release paclitaxel in ferritin into solution again, detecting the content of paclitaxel in the paclitaxel nano-drug by HPLC, and calculating that about 36 PTX molecules in each protein cage are encapsulated, and the encapsulation rate is 13.25%.

Example 6

The stability and in vitro release studies of the HFtn-mMMP2-RGE-PTX paclitaxel nano-drug are as follows:

in order to study the stability and in vitro release characteristics of the paclitaxel nano-drug, the paclitaxel nano-drug is put into a dialysis bag (with a molecular weight cut-off of 6-8kDa), incubated in PBS buffer solution with pH 7.4 at 37 ℃, and then sampled and quantified by HPLC for incubation times of 0, 0.5, 1, 2, 3, 4, 6, 8, 12, 24, 48, and 60 hours, wherein the released amount of paclitaxel is the total amount of released paclitaxel/paclitaxel, as shown in fig. 4, the paclitaxel nano-drug is relatively stable at pH 7.4, but the paclitaxel is very easily released in the paclitaxel nano-drug at pH 5.0, which indicates that the release form of the paclitaxel nano-drug is pH-dependent.

Example 7

In vitro cytotoxicity study of HFtn-mMMP2-RGE-PTX paclitaxel nano-drug:

to study the cytotoxicity of paclitaxel nanopharmaceuticals in vitro, a549 cells (cell bank of the national institute of sciences type culture collection) were seeded in 96-well plates at a density of 5000 cells per well, and after 24 hours of incubation at 37 ℃, PTX, HFtn-mmps 2-RGE-PTX with paclitaxel content of 0.001-10mg/mL were added to the same well for 24 hours, washed twice with PBS, and after 4 hours of incubation with MTT, supernatant was carefully removed by centrifugation and dimethyl sulfoxide was added, and uv absorption was measured at 570nm, and the survival rate of a549 cells under the action of PTX, HFtn-mmps 2-RGE-PTX paclitaxel nanopharmaceuticals at different concentrations was as shown in fig. 5, indicating that HFtn-mmps 2-RGE-PTX exhibited strong cytotoxicity.

Example 8

In vitro targeting studies of HFtn-mMMP2-RGE nanoparticles:

to study the uptake of HFtn-mMMP2-RGE nanoparticles by cells, A549 was usedCells were plated at 1X 10 per well⁵Inoculating to a laser copolymerization dish, culturing for 24h, adding 10 mu g/mL of FITC-labeled HFtn and HFtn-mMMP2-RGE nanoparticles, incubating for 4h, washing cells for 3 times with PBS, and fixing with 4% paraformaldehyde for 15 min; DAPI (10 μ g/mL) was then added for nuclear staining, cells were imaged using confocal laser, and in a competitive receptor study, cells were incubated with excess HFtn protein for 1 hour to saturate TfR1 receptors on the tumor cell surface, followed by the addition of FITC-labeled HFtn or HFtn-mmps 2-RGE nanoparticles, with the result that the fluorescence intensity of FITC-labeled HFtn-mmps 2-RGE nanoparticles was significantly higher than that of the FITC-labeled HFtn and FITC groups, as shown in fig. 6. And in competitive experiments, the FITC-labeled HFtn-mMMP2-RGE group still showed higher fluorescence intensity when the TfR1 receptor was saturated. This indicates that RGERPPR modified HFtn enhances cellular uptake of HFtn-mMMP2-RGE, and the same results were obtained in flow cytometry quantification.

Example 9

Penetration of HFtn-mMMP2-RGE nanoparticles into three-dimensional tumor spheres:

to study the capacity of HFtn-mmps 2-RGE nanoparticles to permeate three-dimensional tumor spheres, a549 cells were seeded per well 5000 in 96-well plates with agarose plated at the bottom, centrifuged at 1000 × g for 10min, during which the growth of tumor spheres was observed, half the volume of the solution was changed every 24h, after one week a regular dense tumor sphere model was to be formed, 10 μ g/mL of FITC-labeled HFtn and HFtn-mmps 2-RGE nanoparticles were added, after incubation for 4h the cells were washed 3 times with PBS and fixed with 4% paraformaldehyde for 15 min, and the cells were imaged using confocal laser. As a result, as shown in FIG. 7, the distribution of the fluorescence intensity in the tumor sphere was decreased in the FITC group and the FITC-HFtn group, indicating that the FITC group and the FITC-HFtn group failed to penetrate deep into the tumor sphere. The FITC-HFtn-mMMP2-RGE group showed the strongest fluorescence intensity inside the tumor sphere, and these results indicate that RGERPPR peptide-modified HFtn enhances the uptake of A549 cells and the penetration effect of the tumor sphere.

Example 10

The 10HFtn-mMMP2-RGE-PTX taxol nano-drug inhibits the growth of three-dimensional tumor spheres:

in order to study the growth inhibition of HFtn-mMMP2-RGE nanoparticles to three-dimensional tumor spheres, A549 cells are inoculated into a 96-well plate with agarose paved at the bottom by 5000 holes per hole, the centrifugation is carried out for 10min at 1000 Xg, the growth of the tumor spheres is observed during the period, the liquid is changed in half every 24h, a regular and compact tumor sphere model is formed after one week, paclitaxel nano-drugs of PTX, HFtn-PTX and HFtn-mMMP2-RGE-PTX with the paclitaxel content of 5 mu g/mL are added, and the liquid is changed in half every other day; after administration, the morphology and volume change of tumor spheroids were observed and measured by an inverted microscope at the same time every day for 6 days, and as a result, as shown in FIG. 8, PTX and HFtn-PTX groups showed some inhibition of the growth of three-dimensional tumor spheroids, but HFtn-mMMP2-RGE-PTX group showed the strongest inhibition ability, and the size of tumor spheroids was continuously decreased, indicating that the cell-penetrating action of HFtn-mMMP2-RGE allows more drug to enter and kill tumor cells.

Sequence listing

<110> Nanjing university of forestry

<120> ferritin nanoparticle of C-terminal modified tumor penetrating peptide RGERPPR, preparation method and application thereof

<130> 2020

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 219

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Met Thr Thr Ala Ser Thr Ser Gln Val Arg Gln Asn Tyr His Gln Asp

1 5 10 15

Ser Glu Ala Ala Ile Asn Arg Gln Ile Asn Leu Glu Leu Tyr Ala Ser

20 25 30

Tyr Val Tyr Leu Ser Met Ser Tyr Tyr Phe Asp Arg Asp Asp Val Ala

35 40 45

Leu Lys Asn Phe Ala Lys Tyr Phe Leu His Gln Ser His Glu Glu Arg

50 55 60

Glu His Ala Glu Lys Leu Met Lys Leu Gln Asn Gln Arg Gly Gly Arg

65 70 75 80

Ile Phe Leu Gln Asp Ile Lys Lys Pro Asp Cys Asp Asp Trp Glu Ser

85 90 95

Gly Leu Asn Ala Met Glu Cys Ala Leu His Leu Glu Lys Asn Val Asn

100 105 110

Gln Ser Leu Leu Glu Leu His Lys Leu Ala Thr Asp Lys Asn Asp Pro

115 120 125

His Leu Cys Asp Phe Ile Glu Thr His Tyr Leu Asn Glu Gln Val Lys

130 135 140

Ala Ile Lys Glu Leu Gly Asp His Val Thr Asn Leu Arg Lys Met Gly

145 150 155 160

Ala Pro Glu Ser Gly Leu Ala Glu Tyr Leu Phe Asp Lys His Thr Leu

165 170 175

Gly Asp Ser Asp Asn Glu Ser Leu Glu Gly Gly Gly Gly Ser Gly Pro

180 185 190

Leu Gly Leu Ala Gly Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly

195 200 205

Gly Gly Gly Ser Arg Gly Glu Arg Pro Pro Arg

210 215

<210> 2

<211> 219

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Thr Thr Ala Ser Thr Ser Gln Val Arg Gln Asn Tyr His Gln Asp

1 5 10 15

Ser Glu Ala Ala Ile Asn Arg Gln Ile Asn Leu Glu Leu Tyr Ala Ser

20 25 30

Tyr Val Tyr Leu Ser Met Ser Tyr Tyr Phe Asp Arg Asp Asp Val Ala

35 40 45

Leu Lys Asn Phe Ala Lys Tyr Phe Leu His Gln Ser His Glu Glu Arg

50 55 60

Glu His Ala Glu Lys Leu Met Lys Leu Gln Asn Gln Arg Gly Gly Arg

65 70 75 80

Ile Phe Leu Gln Asp Ile Lys Lys Pro Asp Cys Asp Asp Trp Glu Ser

85 90 95

Gly Leu Asn Ala Met Glu Cys Ala Leu His Leu Glu Lys Asn Val Asn

100 105 110

Gln Ser Leu Leu Glu Leu His Lys Leu Ala Thr Asp Lys Asn Asp Pro

115 120 125

His Leu Cys Asp Phe Ile Glu Thr His Tyr Leu Asn Glu Gln Val Lys

130 135 140

Ala Ile Lys Glu Leu Gly Asp His Val Thr Asn Leu Arg Lys Met Gly

145 150 155 160

Ala Pro Glu Ser Gly Leu Ala Glu Tyr Leu Phe Asp Lys His Thr Leu

165 170 175

Gly Asp Ser Asp Asn Glu Ser Leu Glu Gly Gly Gly Gly Ser Gly Ala

180 185 190

Leu Gly Ala Ala Gly Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly

195 200 205

Gly Gly Gly Ser Arg Gly Glu Arg Pro Pro Arg

210 215

<210> 3

<211> 7

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Arg Gly Glu Arg Pro Pro Arg

1 5

<210> 4

<211> 102

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ggtggtggtg gtagcggtcc gctgggtctg gcaggtggtg gtggtggtag cggtggtggt 60

ggtagcggtg gtggtggtag ccgtggtgaa cgtccgccgc gt 102

<210> 5

<211> 102

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ggtggtggtg gtagcggtgc actgggtgca gcaggtggtg gtggtggtag cggtggtggt 60

ggtagcggtg gtggtggtag ccgtggtgaa cgtccgccgc gt 102

Claims (10)

1. A ferritin nanoparticle comprising a C-terminally modified tumor penetrating peptide RGERPPR, wherein: the tumor penetrating peptide RGERPPR is linked to the C-terminus of ferritin via a linker sequence, which exposes the outside of ferritin.

2. The ferritin nanoparticle of C-terminally modified tumor penetrating peptide RGERPPR of claim 1, wherein: adding MMP-2 enzyme cutting site or mutating MMP-2 enzyme cutting site sequence into the connecting sequence to respectively obtain HFtn-MMP2-RGE and HFtn-mMMP2-RGE, wherein MMP2 represents the site which can be cut by MMP-2 enzyme, and the sequence is PLGLAG; mMMP2 represents the MMP-2 cleavage site that is mutated with the sequence ALGAAG; HFtn is a nano-protein cage consisting of 24 ferritin subunits.

3. The ferritin nanoparticle of C-terminally modified tumor penetrating peptide RGERPPR of claim 2, wherein: the ferritin coding gene containing MMP-2 enzyme cutting site of the C-terminal modified tumor penetrating peptide RGERPPR is SEQ ID No. 1; the ferritin coding gene containing the enzyme cutting site of mutant MMP-2 of the C-terminal modified tumor penetrating peptide RGERPPR is SEQ ID No. 2; the coding protein of the C-terminal modified tumor penetrating peptide RGERPPR is SEQ ID No. 3.

4. The ferritin nanoparticles of C-terminally modified tumor penetrating peptide RGERPPR according to any one of claims 1 to 3, wherein: ferritin is human heavy chain ferritin.

5. A method for preparing ferritin nanoparticles of C-terminally modified tumor penetrating peptide RGERPPR according to any of claims 1 to 4, characterized in that: the method comprises the following steps:

(1) construction of recombinant ferritin expression engineering bacteria:

based on an HFtn coding gene, connecting a tumor penetrating peptide RGERPPR with a ferritin C terminal through a connecting sequence at the 3' end of the HFtn coding gene, inserting an MMP-2 enzyme cutting site in the connecting sequence and cloning the MMP-2 enzyme cutting site into a plasmid vector to obtain an HFtn-MMP2-RGE plasmid; inserting a mutant MMP-2 enzyme cutting site in the connecting sequence and cloning the site into a plasmid vector to obtain an HFtn-mMMP2-RGE plasmid; respectively transforming the two plasmids into escherichia coli competent cells, and screening a positive monoclonal transformant through ampicillin resistance to obtain a target recombinant ferritin expression engineering bacterium;

(2) expression and purification of recombinant ferritin:

inoculating engineering bacteria for expressing target recombinant ferritin into a culture medium containing ampicillin at an inoculation ratio of 1 +/-0.02%, adding IPTG (isopropyl-beta-thiogalactoside) to induce expression when the OD600 value of the bacteria liquid reaches 0.6-0.8, centrifuging to collect precipitates, then carrying out ultrasonic crushing on the precipitates, centrifuging to collect supernatant, heating the supernatant in a water bath, centrifuging again, and carrying out multiple purification on the target recombinant ferritin through size exclusion chromatography to obtain target recombinant ferritin HFtn-MMP2-RGE and HFtn-mMMP 2-RGE.

6. The method of claim 5, wherein: in the step (1), the coding gene of the MMP-2 enzyme cutting site inserted into the connecting sequence is SEQ ID No. 4:

GGTGGTGGTGGTAGCGGTCCGCTGGGTCTGGCAGGTGGTGGTGGTGGTAGCGGTGGTGGTGGTAGCGGTGGTGGTGGTAGCCGTGGTGAACGTCCGCCGCGT, subcloning the gene sequence into pET-20b (+) plasmid vector to obtain HFtn-MMP2-RGE plasmid;

in the step (1), the coding gene of the enzyme cutting site of the mutant MMP-2 inserted into the connecting sequence is SEQ ID No. 5: GGTGGTGGTGGTAGCGGTGCACTGGGTGCAGCAGGTGGTGGTGGTGGTAGCGGTGGTGGTGGTAGCGGTGGTGGTGGTAGCCGTGGTGAACGTCCGCCGCGT, subcloning the gene sequence into pET-20b (+) plasmid vector to obtain HFtn-mMMP2-RGE plasmid;

in the step (2), the final concentration of IPTG is 0.5 +/-0.02 mM; in the step (2), the temperature of the upper clear water bath is 60 +/-5 ℃, and the time is 8-12 min.

7. The method of claim 5 or 6, wherein: HFtn-MMP2-RGE was used to verify that the tumor penetrating peptide RGERPPR is exposed to the outside of ferritin, the verification method comprising the following steps: the recombinant human MMP-2 protein is activated for 55-65 min at the temperature of 37 +/-2 ℃ under the condition of 1 +/-0.02 mM APMA, and the MMP-2 and HFtn-MMP2-RGE protein activated under the gradient concentration are incubated for 55-65 min at the temperature of 37 +/-2 ℃ in TCBN buffer solution, and the verification is carried out by using 4-20% SDS-PAGE.

8. Use of ferritin nanoparticles of the C-terminally modified tumor penetrating peptide RGERPPR according to any of claims 1 to 4, characterized in that: can be used for preparing antitumor drugs.

9. The use of claim 8, wherein: is used for preparing the ferritin-paclitaxel nano-medicament of the C-terminal modified tumor penetrating peptide RGERPPR of the antitumor medicament.

10. The use of claim 9, wherein: the preparation method of the ferritin-paclitaxel nano-drug of the C-terminal modified tumor penetrating peptide RGERPPR comprises the following steps:

A. mixing an HFtn-mMMP2-RGE protein solution with a paclitaxel solution to form a mixed solution, wherein the molar ratio of the HFtn-mMMP2-RGE protein to the paclitaxel is 1 (500 +/-50);

B. b, adjusting the pH value of the mixed solution obtained in the step A to 2-3, stirring for 8-12 min, and then re-adjusting the pH value of the solution to 7.0-7.5;

C. and D, putting the solution obtained in the step B into a dialysis bag with the cut-off value of 6-8kDa for dialysis to remove free paclitaxel, taking out after dialysis for 12-18h, and centrifuging to obtain a supernatant, namely the ferritin-paclitaxel nano medicament of the C-terminal modified tumor penetrating peptide RGERPPR.

Images