CN112409486A

CN112409486A - anti-CD 40 antibody and application thereof

Info

Publication number: CN112409486A
Application number: CN202011349828.XA
Authority: CN
Inventors: 胡旻; 李明振; 蔡宁; 潘丽
Original assignee: Hangzhou Bailing Biological Technology Co ltd
Current assignee: Hangzhou Bailing Biological Technology Co ltd
Priority date: 2020-11-26
Filing date: 2020-11-26
Publication date: 2021-02-26
Anticipated expiration: 2040-11-26
Also published as: CN112409486B

Abstract

The invention discloses an antibody or an antigen binding part thereof specifically binding to CD40, and belongs to the technical field of antibodies. The heavy chain variable region CDR-H1, CDR-H2, CDR-H3 and the light chain variable region CDR-L1, CDR-L2 and CDR-L3 of the antibody or antigen binding portion thereof comprise the amino acid sequences shown in SEQ ID nos. 3-8, respectively. The anti-CD 40 antibody has extremely high affinity and specificity, has huge potential and advantages in relevant research and application fields, and in addition, can form a compound similar to CD40L-CD40 ligand receptors when being combined with CD40, thereby starting a signal path, promoting the proliferation of B cells, and stimulating the class conversion of the B cells and the differentiation into plasma cells.

Description

anti-CD 40 antibody and application thereof

Technical Field

The invention belongs to the field of antibodies, and particularly relates to an anti-CD 40 antibody and application thereof.

Background

CD40 is a reciprocal acceptor with CD40L, and CD40 is a type i membrane glycoprotein expressed on the surface of B cells and specialized antigen presenting cells of the immune system and in many non-hematopoietic cell types and cancer cells with a relative molecular mass of 48KD, and belongs to a member of the nerve growth factor receptor/tumor necrosis factor receptor superfamily. The CD40 precursor contains a signal peptide of 297 amino acids, 20 amino acids at the N-terminus, 193 amino acids in the extracellular region, 22 amino acids in the transmembrane region, and 62 amino acids in the intracellular region. Wherein 193 amino acids of the extracellular region constitute 4 cysteine-rich domains, and 9 serines and 7 threonines are contained in 71 amino acids of the hinge region, which are potential glycosylation sites. The glycosylation degree of the CD40 is high, and the relative molecular weight after glycosylation can reach 40 KD-50 KD.

After being combined with CD40 molecules, CD40L can enable membrane CD40 molecules to be crosslinked and aglucone, and then enable CD40 molecules to be polymerized, so that the CD40 signal conduction structural basis and initiation factors are formed. NF-. kappa.B, which is activated by CD40 signaling, activates phosphotyrosine kinase (PTK) and serine/serine kinase, which are key steps in CD 40-mediated B cell activation. Binding of CD40 on the surface of B cells to CD40L results in tyrosine phosphorylation of the non-receptor tyrosine kinase (JAK3) and activator of signal transduction and transcription 3(STAT3), which activates both signaling molecules. The JAK3-STAT3 signal pathway and TRAF signal transduction pathway, including NF- κ b and TRAF3 activation mediated by TNF receptor associated factor 2(TRAF2), are cooperatively involved in immunoglobulin class switching. Expressed in CD⁴⁺After binding of CD40L on the surface of T cells to CD40 molecules on the surface of naive B cells, it transmits necessary activation signals to B cells through the above signal pathway, thereby initiating proliferation, class switching and differentiation of B cells into plasma cells.

CD40 is expressed not only on normal immune cells, but also on many malignant cells. For example, CD40 is overexpressed in: NHL B line, Chronic Lymphocytic Leukemia (CLL), Hairy Cell Leukemia (HCL), Hodgkin's disease, multiple myeloma, bladder cancer, renal cancer, ovarian cancer, cervical cancer, breast cancer, lung cancer, nasopharyngeal cancer, malignant melanoma, etc.

Therefore, the development of the CD40 antibody is helpful for the auxiliary diagnosis of the treatment of related diseases including tumors.

Disclosure of Invention

The invention aims to provide an anti-CD 40 antibody and application thereof, and the technical scheme adopted by the invention is as follows:

in a first aspect, the invention provides an anti-CD 40 antibody or antigen-binding portion thereof, wherein the heavy chain variable region CDR-H1, CDR-H2, CDR-H3 and the light chain variable region CDR-L1, CDR-L2 and CDR-L3 comprise the amino acid sequences shown in SEQ ID NO.3-8, respectively.

In some embodiments of the invention, the antigen binding portion is selected from the group consisting of a Fab fragment, a Fab 'fragment, a F (ab')2 fragment, a Fv fragment, a scFv fragment, a Fd fragment, and a single domain antibody.

In some embodiments of the invention, the heavy chain variable region CDR-H1, CDR-H2, CDR-H3 and the light chain variable region CDR-L1, CDR-L2, CDR-L3 consist of the amino acid sequences shown in SEQ ID NOS: 3-8, respectively.

In a second aspect, the invention provides a gene encoding an antibody or antigen-binding portion thereof according to any one of the first aspect of the invention, the gene encoding the heavy chain comprising the nucleotide sequence set forth in SEQ ID No.1 and the gene encoding the light chain comprising the nucleotide sequence set forth in SEQ ID No. 2.

In a third aspect, the present invention provides an expression vector comprising the gene of the second aspect of the present invention. In some embodiments of the invention, the vector is a prokaryotic expression vector or a eukaryotic expression vector.

In a fourth aspect, the present invention provides a host cell comprising an expression vector according to the third aspect of the invention.

In some embodiments, the vector is a prokaryotic expression vector and the host cell is a prokaryotic cell, such as E.coli. In other embodiments, the vector is a eukaryotic expression vector and the host cell is a eukaryotic cell.

In a fifth aspect, the invention provides the use of an antibody or antigen-binding portion thereof according to the first aspect of the invention in the preparation of a kit for the detection of CD40 protein.

In some embodiments, the method of detecting CD40 protein is selected from the group consisting of enzyme-linked immunosorbent assay, western blotting, and flow cytometry.

In a sixth aspect, the invention provides a kit for detecting CD40 protein, comprising an antibody or antigen-binding portion thereof according to the first aspect of the invention.

In some embodiments, the kit is suitable for use in a detection method selected from the group consisting of enzyme-linked immunosorbent assay, western blotting, and flow cytometry.

In a seventh aspect, the invention provides the use of an antibody or antigen-binding portion thereof according to the first aspect of the invention in the manufacture of a kit for promoting B cell proliferation.

In a seventh aspect, the invention provides a kit for promoting B cell proliferation comprising an antibody or antigen-binding portion thereof according to the first aspect of the invention.

In some embodiments, the written antibodies or antigen binding portions thereof are capable of binding to CD40 to form a complex resembling the CD40L-CD40 ligand receptor, thereby initiating a signaling pathway that promotes B cell proliferation. Furthermore, B cell class conversion can be stimulated to differentiate into plasma cells.

The invention has the advantages of

Compared with the prior art, the invention has the following effective effects:

the rabbit monoclonal antibody against CD40 has very high specificity and dissociation equilibrium constant KD of 2.47 x 10^-11Has great potential and advantages in relevant research and application fields, such as the application of the CD40 targeted therapy scheme in the companion diagnosis.

The rabbit monoclonal antibody of the invention for resisting CD40 is combined with CD40, and can form the combination similar to CD40L-CD40 ligand receptors, thereby starting a signal path and promoting the proliferation of B cells. Furthermore, B cell class conversion can be stimulated to differentiate into plasma cells.

Drawings

FIG. 1 shows that anti-CD 40 antibodies of the invention can promote B cell proliferation. A: control, B: experimental group.

FIG. 2 shows the results of detection of CD40 recombinant protein by enzyme-linked immunosorbent assay using anti-CD 40 rabbit monoclonal antibody.

FIG. 3 shows the results of Western blotting of CD40 recombinant protein using anti-CD 40 rabbit monoclonal antibody. Lane 1: 1:500, lane 2: 1:1000, lane 3: 1:2000, lane 4: 1:4000, lane 5: 1:8000, lane 6: 1:16000, lane 7: 1:32000, tublin: tubulin.

FIG. 4 shows the results of flow cytometry assays for detecting Raji cell CD40 protein using anti-CD 40 rabbit monoclonal antibody. The left peak is the fluorescence intensity peak of Raji cells added with rabbit isotype control, and the right peak is the fluorescence intensity peak of Raji cells added with anti-CD 40 rabbit monoclonal antibody.

Fig. 5 shows an ELISA curve of anti-CD 40 rabbit monoclonal antibody competing with CD40L for binding to CD 40.

Detailed Description

In order to make the technical problems, technical solutions and advantageous effects solved by the present invention more apparent, the present invention is further described in detail below with reference to the following embodiments.

Examples

The following examples are used herein to demonstrate preferred embodiments of the invention. It will be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function in the invention, and thus can be considered to constitute preferred modes for its practice. Those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit or scope of the invention.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs and the disclosures and references cited herein and the materials to which they refer are incorporated by reference.

Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

In the following examples, the extracellular domain-specific recombinant protein sequence comprising human CD40 protein is: UniProtKB-P25942, aa21-aa150, manufactured by offshore protein science, Inc.

The experimental procedures in the following examples are conventional unless otherwise specified. The instruments used in the following examples are, unless otherwise specified, laboratory-standard instruments; the test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified.

Example 1 anti-CD 40 monoclonal antibody and preparation thereof

The experimental rabbit is immunized by back subcutaneous injection by taking a recombinant protein containing the extracellular domain specificity of the human CD40 protein as an immunogen. Taking experimental rabbit blood, separating Peripheral Blood Mononuclear Cells (PBMCs), marking and screening B cells in the PBMCs, obtaining B cell genetic information expressing an anti-CD 40 antibody for amplification and recombination, screening the genetic information meeting the requirement, loading the genetic information into a vector, transfecting vector cells, and purifying the antibody secreted by the vector cell culture to obtain the monoclonal antibody.

The method comprises the following specific steps:

1. an extracellular domain-specific recombinant protein (Novoprotein) comprising the human CD40 protein was synthesized.

2. Immunogen and adjuvant are mixed in equal volume, and then test rabbit is injected subcutaneously on back for immunization. 0.1mg of immunogen was used for each immunization, 4 times in total.

3. Separating serum from test rabbit blood after 4 times immunization, coating with 10 μ g/mL CD40 recombinant protein, sealing with 5% skimmed milk for 60min, cleaning for 3 times, diluting test rabbit serum from 1:100 at 4 times, incubating for 60min, cleaning for 3 times, adding HRP goat-anti-rabbit secondary antibody, incubating for 60min, cleaning for 3 times, adding TMB developing solution, incubating for 15min, terminating color reaction, reading OD450 absorbance on enzyme labeling instrument, and reading value higher than 0.5 serum

4. And (3) collecting 20mL of anticoagulated blood of the experimental rabbits with qualified serum values, adding 20mL of lymphocyte separation liquid, centrifuging at 1500RPM for 30min, removing the first layer of plasma, and then sucking the second layer of lymphocytes.

5. And (3) incubating the separated lymphocytes in biotin-crosslinked CD40 recombinant protein for 5min, then further incubating in avidin magnetic beads for 15min, adsorbing and eluting the hybrid cells by using a magnetic frame, washing for 3 times, and collecting specific lymphocyte counts.

6. Lymphocytes were seeded into 96-well plates for culture at 5 cells/well for limiting dilution.

After 7.3 days 50. mu.L of supernatant was aspirated for ELISA detection. Coating with 10 mu g/mL CD40 recombinant protein, sealing with 5% skimmed milk for 60min the next day, washing for 3 times, adding lymphocyte culture supernatant, incubating for 60min, washing for 3 times, adding HRP goat anti-rabbit secondary antibody (Jackson Immunoresearch, 111-.

8. And (3) cracking lymphocytes in the qualified supernatant to extract total RNA, and performing reverse transcription on the mRNA in the total RNA by using a primer and using reverse transcriptase to obtain cDNA. Then using cDNA as template to make PCR amplification so as to obtain H chain and L chain gene of positive B cell clone antibody.

H chain gene sequence: (SEQ ID NO.1)

ATGGAGACTGGGCTGCGCTGGCTTCTCCTGGTCGCTGTGCTCAAAGGTGTCCAGTGTCAGGAGCAGCTGGAGGAGTCCGGGGGAGACCTGGTCAAGCCTGAGGGATCCCTGACACTCACCTGCACAGCCTCTGGATTGTCCTTCAGTAACAAGTACGTGATGTCCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGATCGCATACATTGTTATTGGCAGTAGTGGTAGTAGTGCTACCACTTACTACGCGACCTGGGCGAAAGGCCGATTCACCATCTCCAAAACCTCGTCGACCACGGTGACTCTGCGAATGACCAGTCTGACAGCCGCGGACACGGCCACCTATTTCTGTGCAAAAAGATATAGTAGTAGTAGTGGTTATTATAGATCATTTAACTTGTGGGGCCCAGGCACCCTGGTCACCGTCTCCTCAGGGCAACCTAAGGCTCCATCAGTCTTCCCACTGGCCCCCTGCTGCGGGGACACACCCAGCTCCACGGTGACCCTGGGCTGCCTGGTCAAAGGGTACCTCCCGGAGCCAGTGACCGTGACCTGGAACTCGGGCACCCTCACCAATGGGGTACGCACCTTCCCGTCCGTCCGGCAGTCCTCAGGCCTCTACTCGCTGAGCAGCGTGGTGAGCGTGACCTCAAGCAGCCAGCCCGTCACCTGCAACGTGGCCCACCCAGCCACCAACACCAAAGTGGACAAGACCGTTGCGCCCTCGACATGCAGCAAGCCCACGTGCCCACCCCCTGAACTCCTGGGGGGACCGTCTGTCTTCATCTTCCCCCCAAAACCCAAGGACACCCTCATGATCTCACGCACCCCCGAGGTCACATGCGTGGTGGTGGACGTGAGCCAGGATGACCCCGAGGTGCAGTTCACATGGTACATAAACAACGAGCAGGTGCGCACCGCCCGGCCGCCGCTACGGGAGCAGCAGTTCAACAGCACGATCCGCGTGGTCAGCACCCTCCCCATCGCGCACCAGGACTGGCTGAGGGGCAAGGAGTTCAAGTGCAAAGTCCACAACAAGGCACTCCCGGCCCCCATCGAGAAAACCATCTCCAAAGCCAGAGGGCAGCCCCTGGAGCCGAAGGTCTACACCATGGGCCCTCCCCGGGAGGAGCTGAGCAGCAGGTCGGTCAGCCTGACCTGCATGATCAACGGCTTCTACCCTTCCGACATCTCGGTGGAGTGGGAGAAGAACGGGAAGGCAGAGGACAACTACAAGACCACGCCGGCCGTGCTGGACAGCGACGGCTCCTACTTCCTCTACAGCAAGCTCTCAGTGCCCACGAGTGAGTGGCAGCGGGGCGACGTCTTCACCTGCTCCGTGATGCACGAGGCCTTGCACAACCACTACACGCAGAAGTCCATCTCCCGCTCTCCGGGTAAATGA

L chain gene sequence: (SEQ ID NO.2)

ATGGACACGAGGGCCCCCACTCAGCTGCTGGGGCTCCTGCTGCTCTGGCTCCCAGGTGCCACATTTGCTCAAGTGCTGACCCAGACTCCATCCTCCGTGTCTGCAACTGTGGGAGGCACAGTCACCATCAATTGCCGGTCCAGTCCGAGTGTTTATAATAACAACTACTTAGCCTGGTTTCAGCAGAAACCAGGGCAGCCTCCCAAGCGCCTGATCTATTATACATCCACTCTGTCATCTGGGGTCTCATCGCGGTTCAAAGGCAGTGGATCTGGGACAGAGTTCACTCTCACCATCAGCGACGTGCAGTGTGACGATGCTGCCACTTACTACTGTCTAGGCACTTATGATGGTAGACGTGTTGACTATGCTACCTTCGGCGGGGGGACCGAGGTGGTGGTCAAAGGTGATCCAGTTGCACCTACTGTCCTCATCTTCCCACCAGCTGCTGATCAGGTGGCAACTGGAACAGTCACCATCGTGTGTGTGGCGAATAAATACTTTCCCGATGTCACCGTCACCTGGGAGGTGGATGGCACCACCCAAACAACTGGCATCGAGAACAGTAAAACACCGCAGAATTCTGCAGATTGTACCTACAACCTCAGCAGCACTCTGACACTGACCAGCACACAGTACAACAGCCACAAAGAGTACACCTGCAAGGTGACCCAGGGCACGACCTCAGTCGTCCAGAGCTTCAATAGGGGTGACTGTTAG

9. The H chain and L chain genes are connected to a vector and transferred into escherichia coli, plasmids of the genes are extracted and then transferred into 293 cells to be expressed, and the anti-CD 40 monoclonal antibody is obtained.

The amino acid sequences of the heavy chain variable regions CDR-H1, CDR-H3, CDR-H3 and light chain variable regions CDR-L1, CDR-L3 and CDR-L3 of the anti-CD 40 monoclonal antibody are analyzed as follows:

(1) the CDR-H1 amino acid sequence includes: SYAMN (SEQ ID NO: 3).

(2) The CDR-H2 amino acid sequence includes: YINIDSRAYYASWAKG (SEQ ID NO: 4).

(3) The CDR-H3 amino acid sequence includes; GVSGSDYVTTL (SEQ ID NO: 5).

(4) The CDR-L1 amino acid sequence includes: QASQSVDRNNDLA (SEQ ID NO: 6).

(5) The CDR-L2 amino acid sequence includes: FASKLAS (SEQ ID NO: 7).

(6) The CDR-L3 amino acid sequence includes: LGVYYGAGWDDV (SEQ ID NO: 8).

Example 2 determination of dissociation equilibrium constant of anti-CD 40 Rabbit monoclonal antibody

100ng/mL of CD40 recombinant protein, coating an enzyme label plate, sealing the plate with a sealing membrane, and standing overnight at 4 ℃.

2. The next day, the ELISA plate was placed on a plate washer, after washing the plate 3 times with PBST, BSA blocking solution was added to each well to block the ELISA plate, and the plate was kept at 30 ℃ and shaking-blocked in a constant temperature shaker for about 1 hour.

3. The anti-CD 40 rabbit monoclonal antibody prepared in example 1 was diluted 4-fold to 9 gradients of 1000ng/mL, 250ng/mL, 62.5ng/mL, 15.625ng/mL, 3.906ng/mL, 0.977ng/mL, 0.244ng/mL, 0.061ng/mL, 0.0153ng/mL, 50 μ L per well and incubated at 30 ℃ with shaking in a shaker at constant temperature for about 1 h.

4. The microplate was placed on a plate washer and washed 3 times with PBST

5. mu.L of HRP-conjugated secondary goat anti-rabbit IgG antibody (Jackson ImmunoResearch, 111-.

6. The microplate was placed on a plate washer and washed 3 times with PBST

7. Adding 50 μ LTMB substrate color developing solution into each well, placing at 30 deg.C, shaking with constant temperature shaking table, and developing for 15min in dark

8. Adding 50 mu L H₂SO₄And stopping the reaction by using the stop solution, and reading an OD450 light absorption value on a microplate reader after about 5 min. The microplate reader automatically calculates the dissociation equilibrium constant according to the following formula:

[RL]/[R]＝1/(1+KD/[L])

note: [ R ]: CD40 recombinant protein coating concentration;

[ L ]: CD40 rabbit monoclonal antibody concentration;

[ RL ]: CD40 recombinant protein and CD40 rabbit monoclonal antibody complex concentrations;

KD: the KD value, i.e.the affinity, of [ L relative to [ R ] is the EC50 value for [ L ] at the corresponding concentration.

The result shows that the dissociation equilibrium constant of the anti-CD 40 rabbit monoclonal antibody and the CD40 recombinant protein is KD ═ 2.47 x 10^-11It is shown that the anti-CD 40 rabbit monoclonal antibody prepared in example 1 has high binding ability with CD40 recombinant protein.

Example 3 use of anti-CD 40 rabbit monoclonal antibodies to promote B cell proliferation

Peripheral anticoagulation of experimental rabbits lymphocytes in peripheral blood were isolated using lymphocyte separation medium (density gradient method).

Lymphocytes were plated at3 cells/well in 10 96-well plates at limiting dilution. The 10 96-well plates were divided into two groups, experimental (plates 1-5) and control (plates 6-10), in which 2. mu.g/mL of the rabbit monoclonal antibody against CD40 prepared in example 1 was added to the experimental group, and none was added to the control group.

After 4 days, the control group B cells were all apoptotic, aggregated in clusters and did not form clones when observed under a microscope (FIG. 1A); about 38% of the wells in the experimental group to which the rabbit monoclonal antibody against CD40 was added were observed to proliferate B cells to form clones (FIG. 1B).

Therefore, the anti-CD 40 rabbit monoclonal antibody can bind to the lymphocyte surface CD40 to form a similar way of binding to CD40L ligand receptor, thereby opening the CD40-CD40L signal channel and stimulating the B cells to be transformed into plasma cells and proliferate.

Example 4 detection of CD40 recombinant protein by enzyme-linked immunosorbent assay Using anti-CD 40 rabbit monoclonal antibody

1. The microplate was coated with 10. mu.g/mL of CD40 recombinant protein and sealed with a membrane seal overnight at 4 ℃.

2. The next day, the ELISA plate was placed on a plate washer, after washing the plate 3 times with PBST, the ELISA plate was sealed by adding skim milk or BSA blocking solution to each well, and then the plate was kept at 30 ℃ for about 1 hour with shaking in a constant temperature shaker.

3. The anti-CD 40 rabbit monoclonal antibody prepared in example 1 was pre-diluted to 8 gradients of 1000ng/mL, 250ng/mL, 62.5ng/mL, 15.625ng/mL, 3.906ng/mL, 0.977ng/mL, 0.244ng/mL, 0.061ng/mL, 50. mu.L per well was incubated at 30 ℃ with shaking in a constant temperature shaker for about 1 h.

4. After washing the plate, 50. mu.L of HRP-conjugated secondary goat anti-rabbit IgG antibody (Jackson ImmunoResearch, 111-.

5. After washing the plate, 50 μ L of TMB substrate color developing solution was added to each well, and the mixture was placed at 30 ℃ and shaken in a constant temperature shaking table in a dark place for color development for about 15 min.

6. Adding 50 mu L H₂SO₄And stopping the reaction by using the stop solution, and reading a light absorption value on an enzyme-labeling instrument after about 5-30 min.

The results are shown in FIG. 2, and it is evident that the reading values are significantly different between the respective dilutions, demonstrating that the antibody is capable of specifically binding to the recombinant CD40 protein.

Example 5 detection of CD40 recombinant protein by Western blotting Using anti-CD 40 Rabbit monoclonal antibody

1. And preparing gel by using a CD40 recombinant protein lysate, and transferring the gel to a PVDF membrane by electrophoresis.

Sealing with 2.5% skimmed milk for 60 min.

3. And washing, adding 100ng/mL of the anti-CD 40 rabbit monoclonal antibody prepared in the example 1 into a lane 1, and adding 2-fold diluted anti-CD 40 rabbit monoclonal antibody into lanes 2-7 respectively for incubation for 60 min.

4. Washed and incubated for 60min with goat anti-rabbit HRP secondary antibody (Thermo Scientific, 31460).

5. After cleaning, 2mL of ECL developing solution is dripped, the developing solution is developed for 5min at room temperature, then the developing solution is exposed in an imager for 60 seconds, and pictures are taken.

As a result, as shown in FIG. 3, the intensity of the 42KD band at the specific position was weakened as the antibody dilution became larger, thereby confirming that the anti-CD 40 rabbit monoclonal antibody can specifically recognize the CD40 recombinant protein.

Example 6 detection of Raji cell CD40 protein Using anti-CD 40 Rabbit monoclonal antibody

1. Raji cells were taken and washed with PBS at 1500 rpm. After centrifugation at 4 ℃ for 5min, the cell density was adjusted to 3M/mL.

2. Add 100. mu.L of 4% paraformaldehyde fixative at 1M cells and mix gently. Cells were fixed at room temperature for about 10 min.

3. PBS was added and centrifuged at 1500rpm for 5min, the supernatant was discarded, the cells at the bottom of the centrifuge tube were resuspended in 1mL PBS, 10mL PBS was added to wash the cells, and the cells were centrifuged at 1500rpm for 5 min.

4. 3 clean 1.5mL centrifuge tubes were added to each tube 100. mu.L of 3M/mL Raji cells, i.e., each tube contained 0.3M Raji cells, centrifuged and the supernatant discarded, 100. mu.L PBS was added to one tube as a negative control, 100. mu.L of 1:100 anti-CD 40 rabbit monoclonal antibody prepared in example 1 was added to the other tube, 100. mu.L of 5. mu.g/mL rabbit isotype IgG was added to the other tube, and the tubes were incubated at room temperature for about 1 hour.

5. Cells were washed and 100. mu.L of FITC secondary antibody diluted 1:200 was added to each tube and incubated at room temperature for 40 min.

6. The cells were washed and 200. mu.L of PBS was added to each tube to measure the fluorescence intensity of the cells in each tube by flow cytometry.

The results are shown in FIG. 4, the left peak is the fluorescence intensity peak of Raji cells added with rabbit isotype control, and the right peak is the fluorescence intensity peak of Raji cells added with anti-CD 40 rabbit monoclonal antibody. It can be seen that after the rabbit monoclonal antibody against CD40 is specifically combined with Raji cell surface CD40 protein, the fluorescence intensity peak is obviously shifted compared with the control.

Example 7 anti-CD 40 Rabbit monoclonal antibody and CD40L Competition CD40 ELISA Curve

0.1. mu.g/mL of CD40 recombinant protein, coating the ELISA plate, sealing the plate with a membrane seal, and standing overnight at 4 ℃.

3. The anti-CD 40 rabbit monoclonal antibody prepared in example 1 was pre-adjusted to a starting concentration of 1000ng/mL, followed by dilution in duplicate on a dilution plate for 10 gradients to prepare for dilution of the CD40L recombinant protein (Novoprotein, C011) to 20 ng/mL. And (3) taking 50 mu L of the CD40 rabbit monoclonal antibody and 50 mu L of the CD40L recombinant protein, uniformly mixing the mixture on another clean dilution plate, placing the mixture on a constant temperature shaking table at 30 ℃ and 100rpm, and incubating for about 30 min.

4. After washing the microplate, 50. mu.L of the mixture of step 3 was added to each well, and incubated at 30 ℃ for about 1 hour with shaking in a constant temperature shaker.

5. After washing the plate, 50. mu.L of HRP-conjugated secondary goat anti-rabbit IgG antibody was added to each well, and incubated at 30 ℃ for about 45min with shaking in a constant temperature shaker.

6. After washing the plate, 50 mu LTMB substrate color developing solution is added into each hole, and the plate is placed at 30 ℃ and vibrated by a constant temperature shaking table in a dark place for color developing for about 15 min.

7. Adding 50 mu L H₂SO₄And stopping the reaction by using the stop solution, and reading a light absorption value on an enzyme-labeling instrument after about 5-30 min.

The results are shown in FIG. 5 and show that there is a clear difference in the readings between the dilutions, demonstrating that the rabbit monoclonal antibody against CD40 binds specifically to CD40 and competes with the binding site for the CD40-CD40L ligand receptor.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> Hangzhou Bailing Biotechnology Ltd

<120> anti-CD 40 antibody and application thereof

<130> AJ2010209

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1410

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atggagactg ggctgcgctg gcttctcctg gtcgctgtgc tcaaaggtgt ccagtgtcag 60

gagcagctgg aggagtccgg gggagacctg gtcaagcctg agggatccct gacactcacc 120

tgcacagcct ctggattgtc cttcagtaac aagtacgtga tgtcctgggt ccgccaggct 180

ccagggaagg ggctggagtg gatcgcatac attgttattg gcagtagtgg tagtagtgct 240

accacttact acgcgacctg ggcgaaaggc cgattcacca tctccaaaac ctcgtcgacc 300

acggtgactc tgcgaatgac cagtctgaca gccgcggaca cggccaccta tttctgtgca 360

aaaagatata gtagtagtag tggttattat agatcattta acttgtgggg cccaggcacc 420

ctggtcaccg tctcctcagg gcaacctaag gctccatcag tcttcccact ggccccctgc 480

tgcggggaca cacccagctc cacggtgacc ctgggctgcc tggtcaaagg gtacctcccg 540

gagccagtga ccgtgacctg gaactcgggc accctcacca atggggtacg caccttcccg 600

tccgtccggc agtcctcagg cctctactcg ctgagcagcg tggtgagcgt gacctcaagc 660

agccagcccg tcacctgcaa cgtggcccac ccagccacca acaccaaagt ggacaagacc 720

gttgcgccct cgacatgcag caagcccacg tgcccacccc ctgaactcct ggggggaccg 780

tctgtcttca tcttcccccc aaaacccaag gacaccctca tgatctcacg cacccccgag 840

gtcacatgcg tggtggtgga cgtgagccag gatgaccccg aggtgcagtt cacatggtac 900

ataaacaacg agcaggtgcg caccgcccgg ccgccgctac gggagcagca gttcaacagc 960

acgatccgcg tggtcagcac cctccccatc gcgcaccagg actggctgag gggcaaggag 1020

ttcaagtgca aagtccacaa caaggcactc ccggccccca tcgagaaaac catctccaaa 1080

gccagagggc agcccctgga gccgaaggtc tacaccatgg gccctccccg ggaggagctg 1140

agcagcaggt cggtcagcct gacctgcatg atcaacggct tctacccttc cgacatctcg 1200

gtggagtggg agaagaacgg gaaggcagag gacaactaca agaccacgcc ggccgtgctg 1260

gacagcgacg gctcctactt cctctacagc aagctctcag tgcccacgag tgagtggcag 1320

cggggcgacg tcttcacctg ctccgtgatg cacgaggcct tgcacaacca ctacacgcag 1380

aagtccatct cccgctctcc gggtaaatga 1410

<210> 2

<211> 720

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atggacacga gggcccccac tcagctgctg gggctcctgc tgctctggct cccaggtgcc 60

acatttgctc aagtgctgac ccagactcca tcctccgtgt ctgcaactgt gggaggcaca 120

gtcaccatca attgccggtc cagtccgagt gtttataata acaactactt agcctggttt 180

cagcagaaac cagggcagcc tcccaagcgc ctgatctatt atacatccac tctgtcatct 240

ggggtctcat cgcggttcaa aggcagtgga tctgggacag agttcactct caccatcagc 300

gacgtgcagt gtgacgatgc tgccacttac tactgtctag gcacttatga tggtagacgt 360

gttgactatg ctaccttcgg cggggggacc gaggtggtgg tcaaaggtga tccagttgca 420

cctactgtcc tcatcttccc accagctgct gatcaggtgg caactggaac agtcaccatc 480

gtgtgtgtgg cgaataaata ctttcccgat gtcaccgtca cctgggaggt ggatggcacc 540

acccaaacaa ctggcatcga gaacagtaaa acaccgcaga attctgcaga ttgtacctac 600

aacctcagca gcactctgac actgaccagc acacagtaca acagccacaa agagtacacc 660

tgcaaggtga cccagggcac gacctcagtc gtccagagct tcaatagggg tgactgttag 720

<210> 3

<211> 5

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Ser Tyr Ala Met Asn

1 5

<210> 4

<211> 16

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 4

Tyr Ile Asn Ile Asp Ser Arg Ala Tyr Tyr Ala Ser Trp Ala Lys Gly

1 5 10 15

<210> 5

<211> 11

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 5

Gly Val Ser Gly Ser Asp Tyr Val Thr Thr Leu

1 5 10

<210> 6

<211> 13

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 6

Gln Ala Ser Gln Ser Val Asp Arg Asn Asn Asp Leu Ala

1 5 10

<210> 7

<211> 7

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 7

Phe Ala Ser Lys Leu Ala Ser

1 5

<210> 8

<211> 12

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 8

Leu Gly Val Tyr Tyr Gly Ala Gly Trp Asp Asp Val

1 5 10

Claims

1. An antibody or antigen-binding portion thereof against CD40, wherein the heavy chain variable region CDR-H1, CDR-H2, CDR-H3 and the light chain variable region CDR-L1, CDR-L2, CDR-L3 each comprise the amino acid sequence set forth in SEQ ID No. 3-8.

2. The antibody, or antigen-binding portion thereof, of claim 1, wherein the antigen-binding portion is selected from the group consisting of a Fab fragment, a Fab 'fragment, a F (ab')2 fragment, a Fv fragment, a scFv fragment, a Fd fragment, and a single domain antibody.

3. A gene encoding the antibody or antigen-binding portion thereof of claim 1 or 2, wherein the gene encoding the heavy chain comprises the nucleotide sequence set forth in SEQ ID No.1 and the gene encoding the light chain comprises the nucleotide sequence set forth in SEQ ID No. 2.

4. An expression vector comprising the gene of claim 3.

5. A host cell comprising the expression vector of claim 4.

6. Use of the antibody or antigen-binding portion thereof of claim 1 or 2 in the manufacture of a kit for detecting CD40 protein.

7. The use according to claim 6, wherein the method for detecting CD40 protein is selected from the group consisting of enzyme-linked immunosorbent assay, Western blotting and flow cytometry.

8. A kit for detecting CD40 protein, comprising the antibody or antigen-binding portion thereof of claim 1 or 2.

9. Use of the antibody or antigen-binding portion thereof of claim 1 or 2 in the manufacture of a kit for promoting B cell proliferation.

10. A kit for promoting B cell proliferation comprising the antibody or antigen-binding portion thereof of claim 1 or 2.