CN112400021A

CN112400021A - Plant expression enhancer

Info

Publication number: CN112400021A
Application number: CN201980032546.6A
Authority: CN
Inventors: 皮尔-奥利弗·拉沃伊; 马克-安德鲁·德奥斯特; 加藤晃; 山崎正太郎
Original assignee: Medicago Inc; Nara Institute of Science and Technology NUC; Mitsubishi Tanabe Pharma Corp
Current assignee: Medicago Inc; Nara Institute of Science and Technology NUC; Mitsubishi Tanabe Pharma Corp
Priority date: 2018-03-14
Filing date: 2019-03-14
Publication date: 2021-02-23
Also published as: EP3765618A4; MX2020009495A; AU2019233860A1; RU2020132255A; WO2019173924A1; JP7423875B2; US20210246462A1; JP7423875B6; CA3093592A1; JP2021516977A; EP3765618A1; BR112020018639A2

Abstract

The present invention provides isolated expression enhancers that are active in plants, parts of plants, or plant cells. The isolated expression enhancer may be selected from the group consisting of nbMT78(SEQ ID NO: 1), nbATL75(SEQ ID NO: 2), nbDJ46(SEQ ID NO: 3), nbBCHP 79(SEQ ID NO: 4), nbEN42(SEQ ID NO: 5), atHSP69(SEQ ID NO: 6), atGRP62(SEQ ID NO: 7), atPK65(SEQ ID NO: 8), atRP46(SEQ ID NO: 9), nb30S72(SEQ ID NO: 10), nbGT61(SEQ ID NO: 11), nbPV55(SEQ ID NO: 12), nbPPI43(SEQ ID NO: 13), nbPM64(SEQ ID NO: 14), and nbH2A86(SEQ ID NO: 15). Methods of using the isolated expression enhancers are also provided.

Description

Plant expression enhancer

Technical Field

The present invention relates to expression enhancers active in plants. The invention also relates to expressing a protein of interest in a plant, and provides methods and compositions for producing a protein of interest in a plant.

Background

Plants have great potential as production systems for recombinant proteins. One method of producing exogenous proteins in plants is to produce stable transgenic plant lines. However, this is a time consuming and labor intensive process. An alternative to transgenic plants is the use of plant virus-based expression vectors. Plant virus-based vectors allow rapid, high-level, transient expression of proteins in plants.

High levels of transient expression of foreign Proteins in Plants have been obtained using vectors based on RNA Plant viruses including comovirus viruses such as cowpea mosaic virus (CPMV) (see, e.g., WO2007/135480, WO2009/087391, US2010/0287670, Sainsbury F. et al, 2008, Plant Physiology; 148: 121-1218; Sainsbury F. et al, 2008, Plant Biotechnology Journal; 6: 82-92; Sainsbury F. et al, 2009, Plant Biotechnology Journal; 7: 682-693; Sainsbury F. et al, 2009, method Molecular Biology, Rebinant Proteins From Plants, Vol. 483: 25-39).

When the 5'UTR of RNA-2 of cowpea mosaic virus (CPMV) is modified, additional expression enhancer activity (as determined by the expression level of the nucleic acid or protein of interest) is produced compared to the wild-type CPMV 5' UTR. For example, mutation of the start codon 161 in the CPMV RNA-2 vector (U162C; HT) increased the expression level of the protein encoded by the sequence inserted after the start codon 512. This allows the production of high levels of foreign proteins without the need for viral replication production, known as the CPMV-HT system (WO 2009/087391; Sainsbury and Lomonossoff, 2008, Plant physiol.148, 1212-1218). In the pEAQ expression plasmid (Sainsbury et al, 2009, Plant Biotechnology Journal, pages 7, 682-693; US 2010/0287670), the sequence to be expressed is located between the 5'UTR and the 3' UTR. The 5' UTR in the pEAQ series carries the U162C (HT) mutation.

Other modifications of the CPMV 5' UTR region have been described which further enhance expression of the nucleic acid of interest in plants. Such as "CMPV HT +" (including nucleotides 1-160 of the CPMV 5' UTR, ATGs with modifications at positions 115-117 and 161-163; WO 2015/143567; incorporated herein by reference) and "CPMVX" (X ═ 160, 155, 150 or 114 nucleic acids in length; WO 2015/103704; incorporated herein by reference). An example of CMPVX is the expression enhancer "CPMV 160". Expression of a nucleic acid sequence operably linked to "CPMV HT +" results in a significant increase in the production of the protein of interest encoded by the nucleic acid sequence, compared to the production of the same protein of interest using the same nucleic acid sequence operably linked to a "CPMV HT" expression enhancer (see FIGS. 2 and 3 of WO 2015/143567). Furthermore, expression of a nucleic acid sequence operably linked to a "CPMV 160" expression enhancer results in a significant increase in the production of the protein of interest encoded by the nucleic acid sequence compared to the production of the same protein of interest using the same nucleic acid sequence operably linked to a "CPMV HT" expression enhancer (see FIGS. 2 and 3 of WO 2015/143567).

Diamos et al (Frontiers in Plant Science, 2016, Vol. 171-15; which is incorporated herein by reference) describe several expression enhancers that can be used to increase protein production in plants (see Table 2 of Diamos et al, including the expression enhancer NbPsaK 23'). As shown in FIG. 4 of Diamos et al (2016), production of a protein of interest encoded by a nucleic acid operably linked to NbPsaK 23' results in increased protein production as compared to production of the same protein encoded by the same nucleic acid sequence operably linked to an otherwise truncated psaK expression enhancer.

Disclosure of Invention

The present invention relates to expression enhancers active in plants. The invention also relates to the expression of a protein of interest in plants, and methods and compositions for producing a protein of interest in plants are provided.

It is an object of the present invention to provide improved expression enhancers which are active in plants.

According to the present invention there is provided an isolated expression enhancer active in plants, selected from the group consisting of:

nbMT78(SEQ ID NO：1)；

nbATL75(SEQ ID NO：2)；

nbDJ46(SEQ ID NO：3)；

nbCHP79(SEQ ID NO：4)；

nbEN42(SEQ ID NO：5)；

atHSP69(SEQ ID NO：6)；

atGRP62(SEQ ID NO：7)；

atPK65(SEQ ID NO：8)；

atRP46(SEQ ID NO：9)；

nb30S72(SEQ ID NO：10)；

nbGT61(SEQ ID NO：11)；

nbPV55(SEQ ID NO：12)；

nbPPI43(SEQ ID NO：13)；

nbPM64(SEQ ID NO：14)；

nbH2A86(SEQ ID NO: 15), and

and SEQ ID NO: 1 to 15, wherein the nucleotide sequence has 90 to 100% sequence identity. Wherein the expression enhancer when operatively linked to a nucleic acid of interest (e.g., a heterologous nucleic acid of interest) allows expression of the nucleic acid of interest. Furthermore, when the expression enhancer is operatively linked to a nucleic acid of interest (e.g., a heterologous nucleic acid of interest), the expression level of the nucleic acid of interest or the heterologous nucleic acid of interest can be increased as compared to the expression level of the same nucleic acid of interest or heterologous nucleic acid not operatively linked to the expression enhancer or, for example, operatively linked to the prior art expression enhancer CPMV160 (SEQ ID NO: 16).

The present disclosure also provides a nucleic acid sequence comprising one of the isolated expression enhancers described above operably linked to a heterologous nucleotide sequence encoding a protein of interest. The heterologous nucleotide sequence may encode a viral protein or antibody, for example, without being considered limiting, the viral protein may be an influenza protein or a norovirus protein. If the protein of interest is an influenza protein, it may comprise M2, a hemagglutinin protein selected from H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, H15, H16, influenza type B hemagglutinin, or a combination thereof. If the protein of interest is a norovirus protein, it may comprise a VP1 protein, a VP2 protein, or a combination thereof, selected from GI.1, GI.2, GI.3, GI.5, GI.7, GII.1, GII.2, GII.3, GII.4, GII.5, GII.6, GII.7, GII.12, GII.13, GII.14, GII.17, and GII.21.

The invention also provides a plant expression system comprising one or more of the above nucleic acid sequences. The plant expression system may further comprise a 3' UTR of cowpea mosaic virus.

The invention also provides a plant expression system comprising one or more of the isolated nucleic acid sequences described above operably linked to a heterologous nucleic acid or nucleotide sequence. The plant expression system may further comprise a 3' UTR of cowpea mosaic virus.

Also disclosed herein is a method of producing a protein of interest in a plant or a part of a plant, the method comprising introducing into the plant or the part of the plant a plant expression system comprising one or more nucleic acid sequences as described above, and culturing the plant, the part of the plant or the plant cell under conditions that allow expression of each heterologous nucleotide sequence encoding the protein of interest. For example, the protein of interest may be a viral protein, such as an influenza protein or a norovirus protein. If the protein of interest is an influenza protein, it may comprise M2, a hemagglutinin protein selected from the group consisting of H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, H15, H16, influenza type B hemagglutinin, and combinations thereof. If the protein of interest is a norovirus protein, it may comprise a VP1 protein, a VP2 protein, or a combination thereof, selected from GI.1, GI.2, GI.3, GI.5, GII.1, GII.2, GII.3, GII.4, GII.5, GII.6, GII.7, GII.12, GII.13, GII.14, GII.17, and GII.21.

Also described herein are methods of producing multimeric proteins of interest. The method involves co-expressing in a plant, a part of a plant, or a plant cell, two or more of the above nucleic acid sequences in a stable or transient manner, wherein each of the two or more nucleic acid sequences encodes a component of a multimeric protein, and growing the plant, the part of a plant, or the plant cell under conditions that allow expression of each heterologous nucleotide sequence encoding the multimeric protein of interest.

Also provided herein are plants, parts of plants, or plant cells transiently transformed or stably transformed with the above plant expression systems.

A plant-based expression system comprising an expression enhancer as described herein results in the expression of a nucleic acid of interest. Furthermore, a plant-based expression system comprising an expression enhancer as described herein results in increased or enhanced expression of a nucleotide sequence encoding a heterologous open reading frame operably linked to the expression enhancer, the nucleotide sequence being obtained from a nucleic acid encoding a Secreted Protein (SPEE) nucleic acid, or obtained from or expressing an enhancer of a nucleic acid encoding a Cytoplasmic Protein (CPEE). Increased expression can be determined by comparing the expression level obtained using the expression enhancers described herein to the expression level of the same nucleotide sequence encoding the heterologous open reading frame but not operably linked to the expression enhancer or, for example, operably linked to the prior art expression enhancer CPMV160 (SEQ ID NO: 16).

Plant-based expression systems, vectors, constructs, and nucleic acids comprising one or more expression enhancers as described herein can also have a variety of properties, such as including suitable cloning sites for a gene or nucleotide sequence of interest, which can be used to readily transform plants in a cost-effective manner, which can result in efficient local or systemic transformation of the inoculated plant. Furthermore, transformation of plants can provide good yields of useful protein material.

This summary of the invention does not necessarily describe all features of the invention.

Drawings

These and other features of the present invention will become more apparent from the following description with reference to the accompanying drawings, in which:

figure 1A is prior art and shows the relative titers of influenza H1 california, H3 victoria, H5 indonesia and B wisconsin produced in plants by expression of a nucleic acid encoding each of these proteins, operably linked to a CPMV HT expression enhancer (illustrated in WO 2009/087391) or a CPMV160 + expression enhancer (illustrated in WO 2015/103704). Figure 1B is prior art and shows the relative titers of H1 california, H3 victoria, B brisbane + H1Tm, B massachusetts + H1Tm, B wisconsin, and B wisconsin + H1Tm produced in plants by expression of nucleic acids encoding each of these proteins, operably linked to a CPMV HT expression enhancer (described in WO 2009/087391) or a CPMV160 + expression enhancer (described in WO 2015/103704). Fig. 1C is prior art and shows the relative yield of GFP produced in plants by expression of a nucleic acid encoding a GFP protein, wherein the nucleic acid is operably linked to the following expression enhancers: NbPsaK 23 '(referred to herein as nbPK74), AtPsaK 3' (referred to herein as atPK41), NbPsaKl 3 ', AtPskK, AtPsak 5', TMV, NbPsaK2, and NbPSak1(Diamos et al, Frontiers in Plant Science, 2016, Vol.7, pages 1-15).

FIG. 2 shows the fluorescence activity of a Dasher protein (Dasher GFP; FPB-27269; from ATUM) produced in plants by expression of a nucleic acid encoding the Dasher protein operably linked to a prior art expression enhancer, CPMV160 (described in WO2015/103704) or atPK41 (described in Diamos et al, Frontiers in Plant science.2016, Vol.7, pages 1-15) or an expression enhancer of the invention: nbMT78(SEQ ID NO: 1), nbATL75(SEQ ID NO: 2), nbDJ46(SEQ ID NO: 3), nbCHP79(SEQ ID NO: 4), nbEN42(SEQ ID NO: 5), atHSP69(SEQ ID NO: 6), atGRP62(SEQ ID NO: 7), atPK65(SEQ ID NO: 8), atRP46(SEQ ID NO: 9), nb30S72(SEQ ID NO: 10), nbGT61(SEQ ID NO: 11), nbPV55(SEQ ID NO: 12), nbPPI43(SEQ ID NO: 13), nbPM64(SEQ ID NO: 14) and nbH2A86(SEQ ID NO: 15).

FIG. 3A shows the HA titres of the H1 California/7/09 influenza virus produced in plants by expression of a nucleic acid encoding the H1 California protein operably linked to either the prior art expression enhancer CPMV160 (described in WO2015/103704) or atPK41 (described in Diamos et al, Frontiers in Plant science.2016, Vol.7, pp.1-15) or the expression enhancer of the invention: nbMT78(SEQ ID NO: 1), nbATL75(SEQ ID NO: 2), nbDJ46(SEQ ID NO: 3), nbCHP79(SEQ ID NO: 4), nbEN42(SEQ ID NO: 5), atHSP69(SEQ ID NO: 6), atGRP62(SEQ ID NO: 7), atPK65(SEQ ID NO: 8), atRP46(SEQ ID NO: 9), nb30S72(SEQ ID NO: 10), nbGT61(SEQ ID NO: 11), nbPV55(SEQ ID NO: 12), nbPPI43(SEQ ID NO: 13), nbPM64(SEQ ID NO: 14) and nbH2A86(SEQ ID NO: 15). FIG. 3B shows HA titers of H1 Mich/45/15, H3 HK/4801/14, HA B Bris/60/08 and HA B Phu/3073/13 produced in plants by expression of nucleic acids encoding the indicated HA proteins, each of which encodes a given protein, in combination with either the prior art expression enhancer CPMV160 (described in WO2015/103704) or the expression enhancer of the invention: nbMT78(SEQ ID NO: 1), nbATL75(SEQ ID NO: 2), nbCHP79(SEQ ID NO: 4) and atHSP69(SEQ ID NO: 6) are operably linked.

Figure 4 shows the relative yield of norovirus gii.4/sydney 2012 VP1 VLPs after gradient centrifugation, VLPs produced in plants by expression of a nucleic acid encoding VP1 protein, wherein each nucleic acid encoding VP1 protein is operably linked to: the prior art expression enhancer CPMV160 (described in WO2015/103704), the prior art expression enhancer NbPsaK 23' (referred to herein as nbPK 74; Diamos et al), or the expression enhancer of the invention: nbMT78(SEQ ID NO: 1), nbATL75(SEQ ID NO: 2), nbCHP79(SEQ ID NO: 4) and atHSP69(SEQ ID NO: 6).

Figure 5 shows the relative yields of rituximab multimer protein produced in plants by co-expressing a first nucleic acid encoding the Light Chain (LC) of a rituximab antibody and a second nucleic acid encoding the Heavy Chain (HC) of a rituximab antibody, operably linked to various combinations of expression enhancers. With respect to HC nucleic acids: c160: both the first nucleic acid and the second nucleic acid encoding the multimeric protein are operatively linked to a prior art expression enhancer, CPMV160 (described in WO 2015/103704); nbATL 75: the second nucleic acid encoding the HC multimeric protein is operably linked to the nbATL75 expression enhancer, the first nucleic acid encoding the LC is operably linked to one of the nbMT78(SEQ ID NO: 1), nbATL75(SEQ ID NO: 2), nbCHP79(SEQ ID NO: 4), and atHSP69(SEQ ID NO: 6) expression enhancers; nbCHP 79: the second nucleic acid encoding the HC multimeric protein is operably linked to the nbCHP79 expression enhancer, and the first nucleic acid encoding the LC is operably linked to one of the nbMT78(SEQ ID NO: 1), nbATL75(SEQ ID NO: 2), nbCHP79(SEQ ID NO: 4), and atHSP69(SEQ ID NO: 6) expression enhancers; nbMT 78: the second nucleic acid encoding the HC multimeric protein is operably linked to the nbMT78 expression enhancer, the first nucleic acid encoding the LC is operably linked to one of the nbMT78(SEQ ID NO: 1), nbATL75(SEQ ID NO: 2), nbCHP79(SEQ ID NO: 4) and atHSP69(SEQ ID NO: 6) expression enhancers; atHSP 69: the second nucleic acid encoding HC multimeric protein is operably linked to the atHSP69 expression enhancer, and the first nucleic acid encoding LC is operably linked to one of the nbMT78(SEQ ID NO: 1), nbATL75(SEQ ID NO: 2), nbCHP79(SEQ ID NO: 4), and atHSP69(SEQ ID NO: 6) expression enhancers.

Figure 6 shows a construct encoding the Dasher protein; FIG. 6A shows construct 1666 (2X 35S promoter-CPMV 3' UTR/NOS-based expression cassette comprising a sequence encoding co-expression of a silent TBSV P19 repressor under the alfalfa plastocyanin gene promoter and terminator). FIG. 6B shows construct 4467 (2X 35S-5 'UTR nbMT78-Dasher (FPB-27-609) -CPMV 3' UTR/NOS); FIG. 6C shows construct 4160 (including the influenza M2 ion channel gene under the control of the alfalfa plastocyanin promoter and terminator in addition to the 2X35S promoter-CPMV 3' UTR/NOS-based expression framework); FIG. 6D shows construct 4170 (including, in addition to the 2X35S promoter-CPMV 3' UTR/NOS-based expression framework, a Matrix Attachment Region (MAR) regulatory element from tobacco RB7 gene following the NOS terminator); FIG. 6E shows construct 4460 (2X 35S-5 'UTR CPMV 160-Dasher (FPB-27-609) CPMV 3' UTR/NOS); FIG. 6F shows construct 4461 (2X 35S-5 'UTR nbGT61-Dasher (FPB-27-609) CPMV 3' UTR/NOS); FIG. 6G shows construct 4462 (2X 35S-5 'UTR nbATL75-Dasher (FPB-27-609) -CPMV 3' UTR/NOS); FIG. 6H shows construct 4463 (2X 35S-5 'UTR nbDJ46-Dasher (FPB-27-609) -CPMV 3' UTR/NOS); FIG. 6I shows construct 4464 (2X 35S-5 'UTR nbCHP79-Dasher (FPB-27-609) -CPMV 3' UTR/NOS); FIG. 6J shows construct 4465 (2X 35S-5 'UTR nbEN42-Dasher (FPB-27-609) -CPMV 3' UTR/NOS); FIG. 6K shows construct 4466 (2X 35S-5 'UTR nb30S72-Dasher (FPB-27-609) -CPMV 3' UTR/NOS); FIG. 6L shows construct 4468 (2X 35S-5 'UTR nbPV55-Dasher (FPB-27-609) -CPMV 3' UTR/NOS); FIG. 6M shows construct 4469 (2X 35S-5 'UTR nbPPI43-Dasher (FPB-27-609) -CPMV 3' UTR/NOS); FIG. 6N shows construct 4470 (2X 35S-5 'UTR nbPM64-Dasher (FPB-27-609) -CPMV 3' UTR/NOS); FIG. 6O shows construct 4471 (2X 35S-5 'UTR nbH2A86-Dasher (FPB-27-609) -CPMV 3' UTR/NOS); FIG. 6P shows construct 4472 (2X 35S-5 'UTR at HSP69-Dasher (FPB-27-609) -CPMV 3' UTR/NOS); FIG. 6Q shows construct 4473 (2X 35S-5 'UTR at GRP62-Dasher (FPB-27-609) -CPMV 3' UTR/NOS); FIG. 6R shows construct 4474(PK65-Dasher (FPB-27-609) -2X 35S-5 'UTR at CPMV 3' UTR/NOS); FIG. 6S shows construct 4475(RP46-Dasher (FPB-27-609) -2X 35S-5 'UTR of CPMV 3' UTR/NOS);

FIG. 7 shows a construct encoding H1-A/California/7/09; FIG. 7A shows construct 4021 (2X 35S-5 'UTR CPMV 160-SpPDI-HA0H 1A-Cal-7-09-CPMV 3' UTR/NOS); FIG. 7B shows construct 4061 (2X 35S-5 'UTR nbGT61-SpPDI-HA 0H 1A-Cal-7-09-CPMV 3' UTR/NOS); FIG. 7C shows construct 4062 (2X 35S-5 'UTR nbATL75-SpPDI-HA 0H 1A-Cal-7-09-CPMV 3' UTR/NOS); FIG. 7D shows construct 4063 (2X 35S-5 'UTR nbDJ46-SpPDI-HA 0H 1A-Cal-7-09-CPMV 3' UTR/NOS); FIG. 7E shows construct 4064 (2X 35S-5 'UTR nbCHP79-SpPDI-HA 0H 1A-Cal-7-09-CPMV 3' UTR/NOS); FIG. 7F shows construct 4065 (2X 35S-5 'UTR nbEN42-SpPDI-HA 0H 1A-Cal-7-09-CPMV 3' UTR/NOS); FIG. 7G shows construct 4066 (2X 35S-5 'UTR nb30S72-SpPDI-HA 0H 1A-Cal-7-09-CPMV 3' UTR/NOS); FIG. 7H shows construct 4067 (2X 35S-5 'UTR nbMT78-SpPDI-HA 0H 1A-Cal-7-09-CPMV 3' UTR/NOS); FIG. 7I shows construct 4068 (2X 35S-5 'UTR nbPV55-SpPDI-HA 0H 1A-Cal-7-09-CPMV 3' UTR/NOS); FIG. 7J shows construct 4069 (2X 35S-5 'UTR nbPPI43-SpPDI-HA 0H 1A-Cal-7-09-CPMV 3' UTR/NOS); FIG. 7K shows construct 4070 (2X 35S-5 'UTR nbPM64-SpPDI-HA 0H 1A-Cal-7-09-CPMV 3' UTR/NOS); FIG. 7L shows construct 4071 (2X 35S-5 'UTR nbH2A86-SpPDI-HA 0H 1A-Cal-7-09-CPMV 3' UTR/NOS); FIG. 7M shows construct 4072 (2X 35S-5 'UTR athSP69-SpPDI-HA 0H 1A-Cal-7-09-CPMV 3' UTR/NOS); FIG. 7N shows construct 4073 (2X 35S-5 'UTR atGRP62-SpPDI-HA 0H 1A-Cal-7-09-CPMV 3' UTR/NOS); FIG. 7O shows construct 4074 (of 2X 35S-5 'UTR atPK65-SpPDI-HA 0H 1A-Cal-7-09-CPMV 3' UTR/NOS); FIG. 7P shows construct 4075 (2X 35S-5 'UTR atrP46-SpPDI-HA 0H 1A-Cal-7-09-CPMV 3' UTR/NOS); sp: a signal peptide.

FIG. 8 shows a construct encoding H1-A/Michigan/45/2015; FIG. 8A shows construct 4013 (2X 35S-5 'UTR CPMV 160-SpPDI-H1A-Mich-45-2015-CPMV 3' UTR/NOS); FIG. 8B shows construct 4701 (2X 35S-5 'UTR nbATL75-SpPDI-H1A-Mich-45-2015-CPMV 3' UTR/NOS); FIG. 8C shows construct 4702 (2X 35S-5 'UTR nbCHP79-SpPDI-H1A-Mich-45-2015-CPMV 3' UTR/NOS); FIG. 8D shows construct 4703 (2X 35S-5 'UTR nbMT78-SpPDI-H1A-Mich-45-2015-CPMV 3' UTR/NOS); FIG. 8E shows construct 4704(HSP69-SpPDI-H1A-Mich-45-2015-CPMV 3 'UTR/2X 35S-5' UTR at NOS); sp: a signal peptide.

FIG. 9 shows a construct encoding H3-A/Hong Kong/4801/14; FIG. 9A shows construct 4014 (2X 35S-5 'UTR CPMV 160-SpPDI-H3A-HK-4801-14-CPMV 3' UTR/NOS); FIG. 9B shows construct 4711 (2X 35S-5 'UTR nbATL 75-SpPDI-H3A-HK-4801-14-CPMV 3' UTR/NOS); FIG. 9C shows construct 4712 (2X 35S-5 'UTR nbCHP79-SpPDI-H3A-HK-4801-14-CPMV 3' UTR/NOS); FIG. 9D shows construct 4713 (2X 35S-5 'UTR nbMT 78-SpPDI-H3A-HK-4801-14-CPMV 3' UTR/NOS); FIG. 9E shows construct 4714 (2X 35S-5 'UTR atHSP 69-SpPDI-H3A-HK-4801-14-CPMV 3' UTR/NOS); sp: a signal peptide.

FIG. 10 shows a construct encoding HA-B/Brillishift/60/08; FIG. 10A shows construct 4015 (2X 35S-5 'UTR CPMV 160-SpPDI-HA B/Bri/60/08-CPMV 3' UTR/NOS); FIG. 10B shows construct 4721 (2X 35S-5 'UTR nbATL75-SpPDI-HA B/Bri/60/08-CPMV 3' UTR/NOS); FIG. 10C shows construct 4722 (2X 35S-5 'UTR nbCHP79-SpPDI-HA B/Bri/60/08-CPMV 3' UTR/NOS); FIG. 10D shows construct 4723 (2X 35S-5 'UTR nbMT78-SpPDI-HA B/Bri/60/08-CPMV 3' UTR/NOS); FIG. 10E shows construct 4724 (2X 35S-5 'UTR atHSP69-SpPDI-HA B/Bri/60/08-CPMV 3' UTR/NOS); sp: a signal peptide.

FIG. 11 shows a construct encoding HAB/Phu/3073/13; FIG. 11A shows construct 4016 (2X 35S-5 'UTR CPMV 160-SpPDI-HA0HA B/Phu/3073/13-CPMV 3' UTR/NOS); FIG. 11B shows construct 4731 (2X 35S-5 'UTR nbATL75-SpPDI-HA 0HA B/Phu/3073/13-CPMV 3' UTR/NOS); FIG. 11C shows construct 4732 (2X 35S-5 'UTR nbCHP79-SpPDI-HA 0HA B/Phu/3073/13-CPMV 3' UTR/NOS); FIG. 11D shows construct 4733 (2X 35S-5 'UTR nbMT78-SpPDI-HA 0HA B/Phu/3073/13-CPMV 3' UTR/NOS); FIG. 11E shows construct 4734(HSP69-SpPDI-HA 0HA B/Phu/3073/13-2X 35S-5 'UTR at CPMV 3' UTR/NOS); sp: a signal peptide.

FIG. 12 shows constructs encoding VP1-GII.4 Sydney 12; FIG. 12A shows construct 4133 (2X 35S-5 'UTR CPMV 160-VP1(GII.4Syd12) -CPMV 3' UTR/NOS); FIG. 12B shows construct 4161 (2X 35S-5 'UTR nbATL75-VP1(GII.4 Syd12) -CPMV 3' UTR/NOS); FIG. 12C shows construct 4162 (2X 35S-5 'UTR nbCHP79-VP1(GII.4 Syd12) -CPMV 3' UTR/NOS); FIG. 12D shows construct 4163 (2X 35S-5 'UTR nbMT78-VP1(GII.4 Syd12) -CPMV 3' UTR/NOS); FIG. 12E shows construct 4164 (2X 35S-5 'UTR in HSP69-VP1(GII.4 Syd12) -CPMV 3' UTR/NOS);

FIG. 13 shows a construct encoding HC IgG 1; FIG. 13A shows construct 3191 (2X 35S-5 'UTR CPMV 160-SpPDI-HC IgG1-CPMV 3' UTR/NOS); FIG. 13B shows construct 4643 (2X 35S-5 'UTR nbATL75-SpPDI-HC IgG1-CPMV 3' UTR/NOS); FIG. 13C shows construct 4644 (2X 35S-5 'UTR nbCHP79-SpPDI-HC IgG1-CPMV 3' UTR/NOS); FIG. 13D shows construct 4645 (2X 35S-5 'UTR nbMT78-SpPDI-HC IgG1-CPMV 3' UTR/NOS); FIG. 13E shows construct 4646 (2X 35S-5 'UTR atHSP69-SpPDI-HC IgG1-CPMV 3' UTR/NOS); sp: a signal peptide.

FIG. 14 shows a construct encoding LC IgG 1; FIG. 14A shows construct 3192 (2X 35S-5 'UTR CPMV 160-SpPDI-LC IgG1-CPMV 3' UTR/NOS); FIG. 14B shows construct 4653 (2X 35S-5 'UTR nbATL75-SpPDI-LC IgG1-CPMV 3' UTR/NOS); FIG. 14C shows construct 4654 (2X 35S-5 'UTR nbCHP79-SpPDI-LC IgG1-CPMV 3' UTR/NOS); FIG. 14D shows construct 4655 (2X 35S-5 'UTR nbMT78-SpPDI-LC IgG1-CPMV 3' UTR/NOS); FIG. 14E shows construct 4656 (2X 35S-5 'UTR atHSP69-SpPDI-LC IgG1-CPMV 3' UTR/NOS); sp: a signal peptide.

FIG. 15A shows the nucleic acid sequence of nbMT78(SEQ ID NO: 1); FIG. 15B shows the nucleic acid sequence of nbATL75(SEQ ID NO: 2); FIG. 15C shows the nucleic acid sequence of nbDJ46(SEQ ID NO: 3); FIG. 15D shows the nucleic acid sequence of nbCHP79(SEQ ID NO: 4); FIG. 15E shows the nucleic acid sequence of nbEN42(SEQ ID NO: 5); FIG. 15F shows the nucleic acid sequence of atHSP69(SEQ ID NO: 6); FIG. 15G shows the nucleic acid sequence of atGRP62(SEQ ID NO: 7); FIG. 15H shows the nucleic acid sequence of atPK65(SEQ ID NO: 8); FIG. 15I shows the nucleic acid sequence of atRP46(SEQ ID NO: 9); FIG. 15J shows the nucleic acid sequence of nb30S72(SEQ ID NO: 10); FIG. 15K shows the nucleic acid sequence of nbGT61(SEQ ID NO: 11); FIG. 15L shows the nucleic acid sequence of nbPV55(SEQ ID NO: 12); FIG. 15M shows the nucleic acid sequence of nbPPI43(SEQ ID NO: 13); FIG. 15N shows the nucleic acid sequence of nbPM64(SEQ ID NO: 14); FIG. 15O shows the nucleic acid sequence of nbH2A86(SEQ ID NO: 15); FIG. 15P shows the nucleic acid sequence of CPMV160 (SEQ ID NO: 16) (prior art).

Figure 16A shows the nucleic acid sequence of the primers used to make the Dasher construct. FIG. 16B shows the nucleic acid sequence of CPMV1605' UTR-Dasher (SEQ ID NO: 20); FIG. 16C shows the nucleic acid sequence of Dasher (SEQ ID NO: 78); FIG. 16D shows the amino acid sequence of Dasher (SEQ ID NO: 21); FIG. 16E shows the nucleic acid sequence (SEQ ID NO: 75) of construct 4467(Dasher) from the 2X35S promoter to the NOS terminator; FIG. 16F shows the nucleic acid sequence of the cloning vector for Dasher construct 1666 (SEQ ID NO: 22) from left to right on T-DNA.

FIG. 17A shows the nucleic acid sequences of the primers used to prepare the constructs H1A Cal-7-09, H1A-Mich-45-15 and H3HK-4801-14, HAB-Bris-60-08, HA B _ Phu-3073-13; FIG. 17B shows the nucleic acid sequence of CPMV1605' UTR-PDI + H1Cal (SEQ ID NO: 79); FIG. 17C shows the nucleic acid sequence of the CPMV1605' UTR-PDI + H1Cal nucleic acid sequence (SEQ ID NO: 80); FIG. 17D shows the amino acid sequence of PDI + H1Cal (SEQ ID NO: 81); FIG. 17E shows the nucleic acid sequence of construct 4160 from left to right on T-DNA, the cloning vector used to make the H3 and HA B constructs (SEQ ID NO: 76).

FIG. 18A shows the nucleic acid sequence of CPMV1605' UTR-PDI + H1Mich (SEQ ID NO: 82); FIG. 18B shows the nucleic acid sequence of PDI + H1Mich (SEQ ID NO: 83); FIG. 18C shows the amino acid sequence of PDI + H1Mich (SEQ ID NO: 84); FIG. 18D shows the nucleic acid sequence of construct 4170 on T-DNA from left to right, the cloning vector used to make the VP1 GII.4 construct (SEQ ID NO: 77).

FIG. 19A shows the nucleic acid sequence of CPMV1605' UTR-PDI + H3HK (SEQ ID NO: 85); FIG. 19B shows the nucleic acid sequence of PDI + H3HK (SEQ ID NO: 86); FIG. 19C shows the amino acid sequence of PDI + H3HK (SEQ ID NO: 87).

FIG. 20A shows the nucleic acid sequence of CPMV1605' UTR-PDI + HA B Bri (SEQ ID NO: 88); FIG. 20B shows the nucleic acid sequence of PDI + HA B Bri (SEQ ID NO: 89); FIG. 20C shows the amino acid sequence of PDI + HA B Bri (SEQ ID NO: 90).

FIG. 21A shows the nucleic acid sequence of CPMV1605' UTR-PDI + HA B Phu (SEQ ID NO: 91); FIG. 21B shows the nucleic acid sequence of PDI + HA B Phu (SEQ ID NO: 92); FIG. 21C shows the amino acid sequence of PDI + HA B Phu (SEQ ID NO: 93).

FIG. 22A shows the nucleic acid sequence of primers used to make the GII.4VP1 construct; FIG. 22B shows the nucleic acid sequence (SEQ ID NO: 94) of CPMV1605' UTR-VP1 (GII.4); FIG. 22C shows the nucleic acid sequence (SEQ ID NO: 95) of VP1 (GII.4); FIG. 22D shows the amino acid sequence (SEQ ID NO: 96) of VP1 (GII.4).

Figure 23A shows the nucleic acid sequence of primers used to make rituximab constructs. FIG. 23B shows the nucleic acid sequence of CPMV1605' UTR-PDI + rituximab HC (SEQ ID NO: 97); FIG. 23C shows the nucleic acid sequence of PDI + rituximab HC (SEQ ID NO: 98); FIG. 23D shows the amino acid sequence of PDI + rituximab HC (SEQ ID NO: 99); FIG. 23E shows the nucleic acid sequence of CPMV1605' UTR-PDI + rituximab LC (SEQ ID NO: 100); FIG. 23F shows the nucleic acid sequence of PDI + rituximab LC (SEQ ID NO: 101); FIG. 23G shows the amino acid sequence of PDI + rituximab LC (SEQ ID NO: 102).

Detailed Description

The following description is of the preferred embodiments.

As used herein, the terms "comprising," "having," "including," and "containing" and grammatical variations thereof are inclusive or open-ended and do not exclude additional, unrecited elements and/or method steps. The term "consisting essentially of", when used herein in connection with a use or method, means that additional elements and/or method steps may be present, but that such additions do not materially affect the functional manner of the recited method or use. The term "consisting of" when used herein in connection with a use or method excludes the presence of additional elements and/or method steps. In certain embodiments, a use or method described herein as comprising certain elements and/or steps may also consist essentially of those elements and/or steps, while in other embodiments, consist of those elements and/or steps, whether or not those embodiments are specifically mentioned. In addition, unless otherwise specified, the use of the singular includes the plural, and "or" means "and/or". As used herein, the term "plurality" refers to more than one, e.g., two or more, three or more, four or more, etc. Unless defined otherwise herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. As used herein, the term "about" refers to a variation of about +/-10% from a given value. It is to be understood that such a variation is always included in any given value provided herein, whether or not it is specifically referred to. The use of the words "a" or "an" when used herein in conjunction with the term "comprising" may mean "one," but it is also consistent with the meaning of "one or more," at least one, "and" one or more.

As used herein, the term "plant", "part of a plant", "plant part", "plant matter", "plant biomass", "plant material", "plant extract" or "plant leaf" may comprise the entire plant, tissue, cell or any part thereof, intracellular plant components, cell explant components, liquid or solid extracts of plants or combinations thereof capable of providing a transcriptional, translational and post-translational modification mechanism for expression of one or more nucleic acids described herein and/or from which expressed proteins or VLPs of interest may be extracted and purified. Plants may include, but are not limited to, crop plants including, for example, rapeseed, brassica, maize, Nicotiana, (tobacco) such as Nicotiana benthamiana (Nicotiana benthamiana), Nicotiana tabacum (Nicotiana rustica), Nicotiana tabacum (Nicotiana tabacum), Nicotiana tabacum (Nicotiana alata), arabidopsis thaliana, alfalfa, potato, pachyrhizus (Ipomoea batatas), ginseng, pea, oat, rice, soybean, wheat, barley, sunflower, cotton, maize, rye (Secale grain), Sorghum (Sorghum biocolor, Sorghum vulgare), safflower (Carthamus tinctorius).

As used herein, the term "plant part" refers to any part of a plant, including but not limited to, a leaf, stem, root, flower, fruit, callus or cell cultured plant tissue, a plant cell cluster, a plant cell obtained from a leaf, stem, root, flower, fruit, e.g., a plant cell, plant cell cluster or callus or cultured plant tissue, a plant extract obtained from a leaf, stem, root, flower, fruit, or a combination thereof. The term plant cell refers to a plant cell that is bounded by a plasma membrane and may or may not comprise a cell wall. Plant cells include protoplasts (or spheroplasts) comprising enzymatically digested cells and can be obtained using techniques well known in the art (e.g., Davey MR et al, 2005, Biotechnology Advances 23: 131-171; which is incorporated herein by reference). Callus plant tissue or cultured plant tissue may be produced using methods well known in the art (e.g., MK Razdan, second edition, Science Publishers, 2003; incorporated herein by reference). The term "plant extract" as used herein refers to a plant-derived product obtained after treating a plant, a part of a plant, plant cells, or a combination thereof, physically (e.g., freezing and then extracting in a suitable buffer), mechanically (e.g., by grinding or homogenizing the plant or a part of the plant and then extracting in a suitable buffer), enzymatically (e.g., using a cell wall degrading enzyme), chemically (e.g., using one or more chelating agents or buffers), or a combination thereof. The plant extract may be further treated to remove undesirable plant components, such as cell wall fragments. The plant extract may be obtained to aid in the recovery of one or more components, such as proteins (including protein complexes, protein superstructures, and/or VLPs), nucleic acids, lipids, carbohydrates, or combinations thereof from the plant, portion of the plant, or plant cell. If the plant extract contains proteins, it may be referred to as a protein extract. The protein extract may be a crude plant extract, a partially purified plant or protein extract or a purified product comprising one or more proteins, protein complexes, protein superstructures and/or VLPs from plant tissue. If desired, the protein extract or plant extract may be partially purified using techniques known to those skilled in the art, for example, the extract may be subjected to salt or pH precipitation, centrifugation, gradient density centrifugation, filtration, chromatography, such as size exclusion chromatography, ion exchange chromatography, affinity chromatography, or a combination thereof. Protein extracts may also be purified using techniques known to those skilled in the art.

"nucleotide (or nucleic acid) sequence of interest" or "coding region of interest" refers to any nucleotide sequence or coding region (these terms are used interchangeably) that is expressed in a plant, part of a plant, or plant cell to produce a protein of interest. Such nucleotide sequences of interest may encode, but are not limited to, natural or modified proteins, industrial or modified industrial enzymes, agricultural or modified agricultural proteins, accessory proteins, protein supplements, pharmaceutically active proteins, nutraceuticals, value-added products, or fragments thereof, for feed, food, or both.

The protein of interest may comprise a native or non-native signal peptide; the non-native signal peptide may be of plant origin. For example, non-native signal peptides are believed to be non-limiting and may be obtained from alfalfa protein disulfide isomerase (PDI SP; nucleotides 32-103 of accession number Z11499), potato glycoprotein (PatA SP; nucleotides of positions 1738-1806 of GenBank accession number A08215), actinidin (Act), tobacco cysteine protease 3 precursor (CP23), maize delta Zein (delta Zein), Papain I (Papain; Pap), and Arabidopsis thaliana (Thale Cress) cysteine protease RD21A (RD 21). The native signal peptide may correspond to the signal peptide of the expressed protein of interest.

The nucleotide sequence of interest or coding region of interest may also include nucleotide sequences encoding pharmaceutically active proteins such as growth factors, growth regulators, antibodies, antigens and fragments thereof, or derivatives thereof useful for immunization or vaccination, and the like. Such proteins include, but are not limited to, proteins that are human pathogens, viral proteins, such as, but not limited to, antigens that form virus-like particles (VLPs), one or more proteins from norovirus, Respiratory Syncytial Virus (RSV), rotavirus, influenza virus, Human Immunodeficiency Virus (HIV), rabies virus, Human Papilloma Virus (HPV), enterovirus 71(EV71), or interleukins, such as one or more of IL-1 through IL-24, IL-26, and IL 27, cytokines, Erythropoietin (EPO), insulin, G-CSF, GM-CSF, hPG-CSF, M-CSF, or combinations thereof, such as interferon alpha, interferon beta, interferon gamma, clotting factors, such as factor VIII, factor IX or tPA, receptors, receptor agonists, antibodies (such as, but not limited to, rituximab), A neural polypeptide, insulin, a vaccine, a growth factor (such as, but not limited to, epidermal growth factor, keratinocyte growth factor, transforming growth factor, growth regulator), an antigen, an autoantigen, a fragment thereof, or a combination thereof.

Proteins of interest may include influenza hemagglutinin (HA; see WO2009/009876, WO2009/076778, WO2010/003225, which are incorporated herein by reference). HA is a homotrimeric membrane type I glycoprotein and typically comprises a signal peptide, an HA1 domain and an HA2 domain, the HA2 domain having a transmembrane anchor site at the C-terminus and a small cytoplasmic tail. Nucleotide sequences encoding HA are well known and available (see, e.g., biodefenses and Public Health Database (flu Research Database Squires et al, 2008, Nucleic Acids Research 36: D497-D503) URL: biohealhase-org/GSearch/home. dococorator ═ infinunza or a Database maintained by the national center for biotechnology information (please see URL: ncbi. nlm. nih. gov), both of which are incorporated herein by reference).

The HA protein may be influenza a, influenza B, or a subtype of influenza a HA selected from H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, H15, H16, H17, and H18. In some aspects of the invention, the HA may be from influenza a selected from H1, H2, H3, H5, H6, H7, and H9. Fragments of HA listed above may also be considered target proteins. Furthermore, domains from the HA types or subtypes listed above may be combined to produce chimeric HA (see, e.g., WO2009/076778, which is incorporated herein by reference).

Examples of subtypes comprising HA protein include A/New Carlidonia/20/99 (H1N1), A/Indonesia/5/2006 (H5N1), A/Podocina/8/34 (H1N1), A/British Banaban/59/2007 (H1N1), A/Solomon Islands 3/2006(H1N1), A/California/04/2009 (H1N1), A/California/07/2009 (H1N1), A/chicken/New York/1995, A/New Gangpo/1/57 (H2N2), A/Lagota/DE/677/88 (H2N8), A/Texas/32/2003, A/mallard/MN/33/00, A/Duck/Shanghai/1/2000, A/anchovy/TX/828189/02, A/British bang 10/2007(H3N2), A/Wisconsin/67/2005 (H3N2), A/Victoria/361/2011 (H3N2), A/Texas/50/2012 (H3N2), A/Hawaii/22/2012 (H3N2), A/New York/39/2012 (H3N2), A/Perth/16/2009(H3N2), C/Johnnerburg/66, A/Anhui/1/2005 (H5N1), A/Vietnam/1194/2004 (H5N1), A/Teal/hong Kong/W312/97 (H6N1), A/Equise/Bragg 56(H7N7), A/Turkish/Angio/6118/68 (H8N4), H7A/Hangzhou/1/2013, A/Anhui/1/2013 (H7N9), A/Shanghai/2/2013 (H7N9), A/Taguzu duck/Iran/G54/03, A/hongkong/1073/99 (H9N2), A/chicken/Germany/N/1949 (H10N7), A/Duck/England/56 (H11N6), A/Duck/Eleberga/60/76 (H12N5), A/Duck/Maryland/704/77 (H13N6), A/Duck/Gurjev/263/82, A/Duck/Australia/341/83 (H15N8), A/Laiguo/Sweden/5/99 (H16N3), B/Malaysia/2506/2004, A/Ouibia/2506/2004, B/Florida/4/2006, B/Brilliant/60/08, B/Massachusetts/2/2012-like viruses (mountain descent), B/Wisconsin/1/2010 (mountain descent) or B/Li/40.

The HA may also be a modified or chimeric HA, for example, the native transmembrane domain of the HA may be replaced by a heterologous transmembrane domain (which is incorporated herein by reference WO2010/148511), the HA may comprise a chimeric extracellular domain (which is incorporated herein by reference WO2012/083445), or the HA may comprise a proteolytic loop deletion (which is incorporated herein by reference WO 2014/153647).

Proteins of interest may also include norovirus proteins or modified norovirus proteins as described in U.S. provisional application 62/475,660 (filed 3/23/2017; incorporated herein by reference) or U.S. provisional application 62/593,006 (filed 11/day; incorporated herein by reference). Norovirus is a non-enveloped virus strain of norovirus of the genus norovirus of the family caliciviridae, characterized by having a single-stranded, positive sense-strand RNA. The norovirus strain can include any known norovirus strain and can also include modifications to known norovirus strains that are generated periodically over time. For example, norovirus strains may include GI.1, GI.2, GI.3, GI.5, GI.7, GII.1, GII.2, GII.3, GII.4, GII.5, GII.6, GII.7, GII.12, GII.13, GII.14, GII.17, and GII.21, such as, but not limited to, Hu/GI.1/US/Norwalk/1968, Hu/GI.2/lu/2003/BEL, Hu/GI.3/S29/2008/Lilla Edet/Sweden, Hu/GI.5/Siklos/Hun/2013/HUN, Hu/GII.1/Ascenson 208/2010/US, Hu/GII.2/47/TW, Hu/GII.3/2013402/Hu/2011.1/American ginseng/75/11/57/W/02/55/W/55/57/W/55/W/75/W/3645/4, Hu/W/75/W/3645/4/W/III/W/III/W/III, Hnt 04: GII.4/Hunter-NSW504D/2004/AU _ DQ078814, 2006 b: GII.4/Shellharbour-NSW696T/2006/AU _ EF684915, NO 09: GII.4/Orange-NSW001P/2008/AU _ GQ845367, Hu/GII.5/AlbertaEI390/2013/CA, Hu/GII.6/Ohio/490/2012/USA, GII.7/Musa/2010/All73774, Hu/GII.12/HS 206/2010/USA, GII.13/VA173/2010/H9AWU4, GII.14_ Saga _2008_ JPN _ ADE28701 native VP1, Hu/GII.17/Kawasaki 323/2014/Japan, and Hu/GII.21/Salisbury 150/2011/USA. Norovirus strains also include strains that have any amino acid sequence identity with any of the above norovirus strains of about 30-100% or between VP1 protein, VP2 protein, or both VP1 and VP2 protein.

The terms "percent similarity," "sequence similarity," "percent identity," or "sequence identity" are used when referring to a particular sequence, such as set forth in the university of wisconsin GCG software program, or by manual alignment and visual inspection (see, e.g., Current Protocols in Molecular Biology, Ausubel et al, eds.1995 suppl.). Methods of sequence alignment for comparison are well known in the art. Optimal alignment of sequences for comparison can be performed by computerized implementation of algorithms such as the algorithm of Smith & Waterman (1981, adv. Appl. Math.2: 482), the alignment algorithm of Needleman & Wunsch (1970, J.mol.biol.48: 443), by similarity methods searching for Pearson & Lipman (1988, Proc. Natl.Acad.Sci.USA 85: 2444) (e.g., GAP, BESTFIT, FASTA and TFASTA in the Wisconsin genetics software package, genetic computer group 575 Science Dr. (GCG), Madison, Wis.).

Examples of algorithms suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms described in Altschul et al (1977, Nuc. acids Res.25: 3389-. BLAST and BLAST 2.0 with the parameters described herein were used to determine the percent sequence identity of the nucleic acids and proteins of the invention. For example, the BLASTN program (for nucleotide sequences) may default to a word length (W) of 11, an expectation (E) of 10, M-5, N-4, and a comparison of the two strands. For amino acid sequences, the BLASTP program can use default values, word length 3 and expectation (E)10, and the BLOSUM62 scoring matrix as default values (see Henikoff & Henikoff, 1989, proc. natl. acad. sci. usa 89: 10915) for an alignment (B) of 50, an expectation (E) of 10, M-5, N-4, and a comparison of the two strands. Software for BLAST analysis is publicly available through the national center for Biotechnology information (website: ncbi. nlm. nih. gov /).

The term "nucleic acid segment" as used herein refers to a nucleic acid sequence encoding a protein of interest. In addition to the nucleic acid sequence, the nucleic acid fragment comprises a regulatory region and a terminator operably linked to the nucleic acid sequence. The regulatory region may comprise a promoter and an enhancer element (expression enhancer) operably linked to the promoter.

The term "nucleic acid complex" as used herein refers to a combination of two or more nucleic acid segments. Two or more nucleic acid fragments may be present in a single nucleic acid, such that the nucleic acid complex comprises two or more nucleic acid fragments, each under the control of a regulatory region and a terminator. Alternatively, the nucleic acid complex may comprise two or more isolated nucleic acids, each nucleic acid comprising one or more nucleic acid fragments, wherein each nucleic acid fragment is under the control of a regulatory region and a terminator. For example, a nucleic acid complex may comprise one nucleic acid comprising two nucleic acid fragments, a nucleic acid complex may comprise two nucleic acids, each comprising one nucleic acid fragment, or a nucleic acid complex may comprise two or more nucleic acids, each comprising one or more nucleic acid fragments.

As used herein, the term "vector" or "expression vector" refers to a recombinant nucleic acid used to transfer an exogenous nucleic acid sequence into a host cell (e.g., a plant cell) and direct the expression of the exogenous nucleic acid sequence in the host cell. The vector may be introduced directly into the plant, part of the plant or plant cell, or may be introduced into the plant, part of the plant or plant cell as part of a plant expression system. The construct or expression construct comprises a nucleotide sequence comprising a nucleic acid of interest under the control of and operably linked to a suitable promoter, expression enhancer, or other element for regulating transcription of the nucleic acid of interest in a host cell. As will be understood by those skilled in the art, the construct or expression framework may comprise a termination sequence (terminator), which is any sequence that is active in a plant host. For example, the termination sequence may be derived from an RNA-2 genome segment of a duplex (bipartite) RNA virus, such as a cowpea yellow mosaic virus. The termination sequence may be a NOS terminator, which can be obtained from the 3' UTR of the alfalfa plastocyanin protein gene, or a combination thereof.

The constructs of the present disclosure may further comprise a 3' untranslated region (UTR). The 3' untranslated region contains a polyadenylation signal and any other regulatory signals capable of affecting mRNA processing or gene expression. Polyadenylation signals are typically characterized by the addition of polyadenylic acid tracks (tracks) at the 3' end of the mRNA precursor. Polyadenylation signals are usually recognized by homology to the canonical form of 5 'AATAAA-3', although variants are not uncommon. Non-limiting examples of suitable 3 'regions are untranslated regions comprising the 3' transcription of the polyadenylation signal of the Agrobacterium tumor inducing (Ti) plasmid gene, such as nopaline synthase (Nos gene) and plant genes such as soybean storage protein, the small subunit of the ribose 1, 5-bisphosphate carboxylase gene (ssRUBISCO; U.S. Pat. No. 4,962,028; incorporated herein by reference), promoters and/or terminators for regulating the expression of plastocyanin protein.

For example, and not to be considered limiting, a CPMV 3 ' UTR + NOS terminator may be used as a 3 ' UTR sequence operably linked to the 3 ' end of a nucleic acid sequence encoding a protein of interest.

"regulatory region," regulatory element "or" promoter "refers to a portion of a nucleic acid, typically, but not always, upstream of the protein-coding region of a gene, which may be composed of DNA or RNA, or both. When the regulatory region is active and is operatively associated or operatively linked to the nucleotide sequence of interest, this may result in expression of the nucleotide sequence of interest. The regulatory elements may be capable of mediating organ specificity, or controlling developmental or temporal gene activation. "regulatory region" includes promoter elements, core promoter elements which exhibit basal promoter activity, elements which are inducible in response to an external stimulus, elements which mediate promoter activity, such as negative regulatory elements or transcriptional enhancers. As used herein, "regulatory region" also includes elements that are active after transcription, such as regulatory elements that regulate gene expression, e.g., translational and transcriptional enhancers, translational and transcriptional repressors, upstream activating sequences, and mRNA instability determinants. Several of these latter elements may be located at the proximal end of the coding region.

In the context of the present disclosure, the term "regulatory element" or "regulatory region" generally refers to a DNA sequence, typically but not always upstream (5') to the coding sequence of a structural gene, to control the expression of the coding region by providing recognition by RNA polymerase and/or other factors required for transcription to start from a particular site. However, it will be appreciated that other nucleotide sequences located within introns or 3' of the sequence may also be useful in regulating expression of the coding region of interest. An example of a regulatory element that provides recognition for RNA polymerase or other transcription factor to ensure initiation at a particular site is a promoter element. Most, but not all, eukaryotic promoter elements contain a TATA box, which is a conserved nucleic acid sequence consisting of adenosine and thymidine nucleotide base pairs, typically located about 25 base pairs upstream of the transcription start site. Promoter elements may include the basic promoter elements responsible for transcription initiation, as well as other regulatory elements that modify gene expression.

There are several types of regulatory regions, including developmentally regulated, inducible, or constitutive. At specific times during certain development of an organ or tissue, regulatory regions are activated within the tissue of certain organs or organs that developmentally regulate or control the differential expression of genes under its control. However, some regulatory regions whose development is regulated may be preferentially active in certain organs or tissues at a particular developmental stage, they may also be active in a developmentally regulated manner or at a basal level in other organs or tissues in the plant. Examples of tissue-specific regulatory regions, such as seed-specific regulatory regions, include the napin promoter and the cruciferin promoter (Rask et al, 1998, J.plant Physiol.152: 595-599; Bilodeau et al, 1994, Plant Cell 14: 125-130). Examples of leaf-specific promoters include the plastocyanin protein promoter (see US7,125,978, incorporated herein by reference).

An inducible regulatory region is a region of transcription that is capable of directly or indirectly activating one or more DNA sequences or genes in response to an inducing agent. In the absence of an inducer, the DNA sequence or gene will not be transcribed. In general, a protein factor that specifically binds to an inducible regulatory region to activate transcription can exist in an inactive form and then be converted, directly or indirectly, to an active form by an inducing agent. However, protein factors may also be absent. Inducers may be chemical agents such as proteins, metabolites, growth regulators, herbicides or phenolic compounds, and also physiological stresses applied directly by heat, cold, salt or toxic elements or activated by pathogens or disease agents (e.g. viruses). Plant cells containing the inducible regulatory region can be exposed to an inducer by applying the inducer externally to the cells or plant, for example by spraying, watering, heating, or the like. Inducible regulatory elements can be derived from Plant or non-Plant genes (e.g., Gatz, C. and Lenk, I.R.P., 1998, Trends Plant Sci.3, 352-358). Examples of potential inducible promoters include, but are not limited to, the tetracycline-inducible promoter (Gatz, C., 1997, Ann. Rev. Plant physiol. Plant mol. biol.48, 89-108), the steroid-inducible promoter (Aoyama, T.and Chua, NH, 1997, Plant J.2, 397-) 404) and the ethanol-inducible promoter (salt, M.G. et al, 1998, Plant Journal 16, 127-.

Constitutive regulatory region regulatory genes are expressed in various parts of the plant and are expressed continuously throughout plant development. Examples of known constitutive regulatory elements include promoters associated with the CaMV 35S transcript (p 35S; Odell et al, 1985, Nature, 313: 810-,

arabidopsis ubiquitin

1 and 6 genes (Holtorf et al, 1995, Plant mol.biol.29: 637-646), the tobacco translation initiation factor 4A gene (Mandel et al, 1995 Plant mol.biol.29: 995-1004), the cassava mosaic virus promoter pCAS (Verdaguer et al, 1996), the promoter of the small subunit of ribodiphospho carboxylase pRbcS: (Outchkourov et al, 2003), pUbi (for both monocots and dicots).

The term "constitutive" as used herein does not necessarily indicate that the nucleotide sequence under the control of the constitutive regulatory region is expressed at the same level in all cell types, but that the sequence is expressed in a variety of cell types, although variations in abundance are often observed.

The construct or expression construct as described above may be present in a vector (or expression vector). The vector may comprise border sequences which allow the transfer and integration of the expression cassette into the genome of the organism or host. The construct may be a plant binary vector, such as a pPZP-based binary transformation vector (Hajdukiewicz et al, 1994). Other examples of constructs include pBin19 (see Frisch, D.A., L.W.Harris-Haller et al, 1995, Plant Molecular Biology 27: 405-409).

The nucleotide sequence of interest encoding a protein requires the presence of a "translation initiation site" or "start codon" upstream of the gene to be expressed. Such initiation sites may be part of an enhancer sequence or part of a nucleotide sequence encoding a protein of interest.

As used herein, the term "native", "native protein" or "native domain" refers to a protein or domain having the same primary amino acid sequence as the wild type. A native protein or domain may be encoded by a nucleotide sequence that has 100% sequence similarity to the wild-type sequence. The native amino acid sequence may also be encoded by a human codon (hCod) optimized nucleotide sequence or a nucleotide sequence comprising increased GC content as compared to the wild-type nucleotide sequence, provided that the amino acid sequence encoded by the hCod nucleotide sequence has 100% sequence identity with the native amino acid sequence.

By nucleotide sequence of a "human codon optimized" or "hCod" nucleotide sequence is meant the selection of appropriate DNA nucleotides to synthesize an oligonucleotide sequence or fragment thereof adjacent to the codons normally found in oligonucleotide sequences of human nucleotide sequences. By "increased GC content" is meant that suitable DNA nucleotides are selected for use in synthesizing an oligonucleotide sequence or fragment thereof so as to approximate the codon usage, including an increase in GC content when compared to the corresponding native oligonucleotide sequence, e.g., from about 1% to about 30% over the length of the coding portion of the oligonucleotide sequence, or any amount therebetween. For example, the sequence of the oligonucleotide sequence is initiated from about 1, 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30% or any number therebetween over the length of the coding portion of the oligonucleotide sequence. As described below, a human codon-optimized nucleotide sequence or a nucleotide sequence comprising increased GC content (when compared to the wild-type nucleotide sequence) exhibits increased expression in a plant, part of a plant or plant cell compared to the expression of a non-human optimized (or lower GC content) nucleotide sequence.

As used herein, the term "single construct" or "single construct" refers to a nucleic acid comprising a single nucleic acid sequence. As used herein, the term "double construct" or "double construct" refers to a nucleic acid comprising two nucleic acid sequences.

Co-expression refers to the introduction and expression of two or more nucleotide sequences, each of which encodes a protein of interest or a fragment of a protein of interest in a plant, a part of a plant, or a plant cell. Two or more nucleotide sequences can be introduced into a plant, a part of a plant, or a plant cell within one vector such that each of the two or more nucleotide sequences is under the control of a separate regulatory region (e.g., comprising a dual construct). Alternatively, two or more nucleotide sequences may be introduced into a plant, a part of a plant, or a plant cell within separate vectors (e.g., comprising a single construct), and each vector comprises suitable regulatory regions for expression of the respective nucleic acid. For example, prior to vacuum infiltration, two nucleotide sequences can be co-expressed by mixing suspensions of each Agrobacterium tumefaciens host in a desired volume (e.g., equal volume or ratio), each nucleotide sequence being on a separate vector and introduced into a separate Agrobacterium tumefaciens host. In this manner, co-infiltration of multiple Agrobacterium tumefaciens suspensions allows for co-expression of multiple transgenes.

As described herein, a nucleic acid encoding a protein of interest can further comprise a sequence that enhances expression of the protein of interest in a plant, a part of a plant, or a plant cell. Expression enhancing sequences are described herein and can, for example, include one or more expression enhancing elements obtained from a nucleic acid encoding a Secreted Protein (SPEE) or expression enhancing elements obtained from a nucleic acid encoding a Cytoplasmic Protein (CPEE) in operative association with a nucleic acid encoding a protein of interest. Non-limiting examples of expression of secreted proteins using expression enhancers as described herein include any protein of interest, including signal peptides or signal sequences that target the protein of interest to an extracellular compartment, such as antibodies (see fig. 5), or virus-like particles (VLPs) known to germinate from the plasma membrane, such as HA influenza (see fig. 3A and 3B). Non-limiting examples of cytosolically produced proteins include any protein of interest that does not include a secretory peptide or signal sequence (see, e.g., fig. 2), or VLPs, such as norovirus, that are known to be produced in the cytosol and retained therein (see, e.g., fig. 4).

The sequence encoding the protein of interest may also be optimized for human codon usage, increased GC content, or a combination thereof. Co-expression of a nucleic acid encoding a second protein of interest can result in a functional multimeric protein, such as an antibody comprising heavy and light chain components, or increased production of the protein. If the protein of interest results in the production of VLPs, co-expression of two or more proteins may result in increased yield, increased density, increased integrity, or a combination thereof of VLPs comprising the protein of interest. The increase in yield, density, integrity, or a combination thereof, can be determined by comparing the yield, density, integrity, or a combination thereof, obtained using the expression enhancer described herein, to the yield, density, integrity, or a combination thereof, of the same nucleotide sequence encoding the heterologous open reading frame but not operably linked to the expression enhancer, or, for example, when operably linked to the prior art expression enhancer, CPMV160 (SEQ ID NO: 16).

Also provided is a plant expression system comprising a nucleic acid comprising a regulatory region operably linked to one or more expression enhancers described herein and a nucleotide sequence of interest. The plant expression system may comprise one or more vectors, one or more constructs or one or more nucleic acids comprising a regulatory region operably linked to one or more expression enhancers and nucleotide sequences described herein or a nucleic acid of interest, and other components that may be introduced into a plant, a portion of a plant or a plant cell. A nucleic acid of interest or a target nucleic acid. For example, the plant expression system may further comprise other vectors, constructs, or nucleic acids, other agrobacteria comprising vectors, constructs, or nucleic acids for co-expression, one or more compounds that alter transformation efficiency, other components, or combinations thereof.

Furthermore, nucleic acids comprising a promoter (regulatory region) sequence operably linked to an expression enhancer including an expression enhancer as described herein are described, as well as nucleotide sequences of interest. The nucleic acid may further comprise a sequence encoding a 3 'UTR (e.g. a cowpea mosaic virus 3' UTR or a plastocyanin protein 3 'UTR) and a terminator sequence (e.g. a NOS terminator) such that the nucleotide sequence of interest is inserted upstream from the 3' UTR.

When referred to herein as an "expression enhancer", "enhancer sequence" or "enhancer element" is operatively linked to a nucleic acid of interest, e.g., a heterologous nucleic acid of interest, it results in the expression of the nucleic acid of interest. Expression enhancers can also enhance or increase the expression of the downstream heterologous Open Reading Frame (ORF) to which they are linked. An expression enhancer may be operatively linked to a regulatory region active in a plant at the 5 'end of the enhancer sequence and to a nucleotide sequence of interest at the 3' end of the expression enhancer to drive expression of the nucleotide sequence of interest in a host, e.g., a plant, a part of a plant, or a plant cell. The expression enhancers described herein include sequences derived from, having sequence similarity to, and nucleotide sequences selected from: nbMT78(SEQ ID NO: 1), nbATL75(SEQ ID NO: 2), nbDJ46(SEQ ID NO: 3), nbCHP79(SEQ ID NO: 4), nbEN42(SEQ ID NO: 5), atHSP69(SEQ ID NO: 6), atGRP62(SEQ ID NO: 7), atPK65(SEQ ID NO: 8), atRP46(SEQ ID NO: 9), nb30S72(SEQ ID NO: 10), nbGT61(SEQ ID NO: 11), nbPV55(SEQ ID NO: 12), nbPPI43(SEQ ID NO: 13), nbPM64(SEQ ID NO: 14), and nbH2A86(SEQ ID NO: 15).

"operably linked" refers to the direct or indirect interaction of particular sequences to achieve a desired function, such as mediating or regulating expression of a nucleic acid sequence. The interaction of the operably linked sequences may be mediated, for example, by a protein that interacts with the operably linked sequences.

The term "5 ' UTR" or "5 ' untranslated region" or "5 ' leader sequence" refers to an untranslated region of an mRNA. The 5' UTR usually starts at the start site of transcription and ends before the translation start site or start codon of the coding region (usually AUG in mRNA, ATG in DNA sequence). The 5' UTR may regulate the stability and/or translation of mRNA transcripts. If desired, the length of the 5'UTR can be altered by mutation (e.g., substitution, deletion, or insertion of the 5' UTR).

The expression enhancer may further comprise one or more "one or more restriction sites" or "one or more restriction recognition sites", "multiple cloning sites", "MCS", "one or more cloning sites", "polylinker sequences" or "polylinkers" to facilitate insertion of the nucleotide of interest into the plant expression system. Restriction sites are specific sequence motifs recognized by restriction enzymes and are well known in the art. An expression enhancer may comprise one or more restriction or cloning sites located downstream (3 ') of the 5' UTR. The polylinker sequence(s) can comprise any nucleic acid sequence useful for adding and removing nucleic acid sequences to the 3 'end of the 5' UTR, including nucleotide sequences encoding proteins of interest. The polylinker sequence can comprise from 4 to about 100 nucleic acids or any number therebetween. Any Multiple Cloning Site (MCS) or MCS of different lengths (shorter or longer) may be used as will be apparent to those skilled in the art.

Also provided are expression systems or vectors for producing one or more proteins of interest in plants using one or more of the expression enhancers described herein. The expression systems described herein include an expression cassette comprising one or more expression enhancers, or a sequence having 80-100% sequence similarity to one or more expression enhancers, or any amount therebetween. The expression cassette comprising the expression enhancer may further comprise a regulatory region active in plants, which regulatory region is operatively linked to the 5' end of the expression enhancer. The nucleotide sequence of interest may be operably linked to the 3' end of the expression framework such that when introduced into a plant, a part of a plant, or a plant cell, expression of the nucleotide sequence of interest in the plant may be achieved.

The invention also provides plants, parts of plants, plant cells, plant tissues, whole plants, inoculants, nucleic acids, constructs comprising a nucleotide sequence of interest encoding a protein of interest, expression frameworks or expression systems comprising one or more expression enhancers as described above, methods of expressing a protein of interest in a plant, part of a plant or plant cell.

The constructs of the invention can be introduced into plant cells in a stable or transient manner using Ti plasmids, Ri plasmids, plant viral vectors, direct DNA transformation, microinjection, electroporation, infiltration, and the like. For a review of this technology, see, e.g., Weissbach and Weissbach, Methods for Plant Molecular Biology, academic Press, New York VIII, pp.421-463 (1988); geierson and Corey, Plant Molecular Biology, second edition (1988); and Miki and Iyer, fundametals of Gene Transfer in Plants; in Plant Metabolism, second edition, DT. Dennis, DH Turpin, DD Lefebrve, DB Layzell (eds), Addison-Wesley, Langmans Ltd. London, pages 561-579 (1997). Other methods include direct uptake of DNA, use of liposomes, electroporation (e.g., using protoplasts), microinjection, microparticles or whiskers, and vacuum infiltration. See, e.g., Bilang et al, (Gene 100: 247- & 250(1991), Scheid et al (mol. Gen. Genet.228: 104- & 112, 1991), Guerche et al (Plant Science 52: 111- & 116, 1987), Neuhause et al, (door. appl. Genet.75: 30-36, 1987), Klein et al, Nature 327: 70-73(1987), Howell et al (Science 208: 1265, 1980), Horsch et al (Science 227: 1229- & 1231, 1985), DeBlock et al, Plant Physiology, 91: 694- & 701, 1989), Methods for Plant Molecular Biology (Weissh and Weissbach, editors, Academic Press Inc., 1988); methods in Plant Molecular Biology (Schuler and Zielinski eds, Academic Press Inc., 1989), Liu and Lomonosoff (J.Virol Meth, 105: 343-; U.S. Pat. nos. 4,945,050; 5,036,006, 5,100,792, 6,403,865, 5,625,136 (all incorporated herein by reference).

Transient expression Methods can be used to express the constructs of the invention (see Liu and Lomonosoff, 2002, Journal of viral Methods, 105: 343-348; incorporated herein by reference). Alternatively, vacuum-based transient expression methods can be used (as described by Kapila et al, 1997, incorporated herein by reference). These methods may include, for example, but are not limited to, methods of agrobacterium inoculation or agrobacterium infiltration, although other transient methods may also be used, as described above. By Agrobacterium inoculation or Agrobacterium infiltration, the Agrobacterium mixture comprising the desired nucleic acid enters the intercellular spaces of the tissue, e.g.the leaves, aerial parts of the plant (including stems, leaves and flowers), other parts of the plant (stems, roots, flowers) or the whole plant. After crossing the epidermis, Agrobacterium infects and transfers the t-DNA copies into the cells. the t-DNA is transcribed episomally and the mRNA is translated to produce the protein of interest in the infected cell, but the transfer of t-DNA within the nucleus is transient.

If the nucleotide sequence of interest encodes a product that is directly or indirectly toxic to a plant, then by using the methods of the invention, such toxicity throughout the plant can be reduced in a desired tissue or at a desired stage of plant development by selectively expressing the nucleotide sequence of interest in the plant. In addition, the limited expression time resulting from transient expression may reduce the effect when toxic products are produced in plants. Inducible promoters, tissue-specific promoters or cell-specific promoters may be used to selectively direct (direct) expression of the sequence of interest.

Various methods can be used to fuse (operatively link) the nucleotide sequence of interest to an enhancer sequence comprising a plant regulatory region. For example, and not to be considered limiting, a nucleotide sequence of interest encoding a protein of interest can be fused to the 3 'end of an expression enhancer immediately following the 5' UTR sequence.

Examples of expression enhancers described herein include:

nbMT78(SEQ ID NO：1)；

nbATL75(SEQ ID NO：2)；

nbDJ46(SEQ ID NO：3)；

nbCHP79(SEQ ID NO：4)；

nbEN42(SEQ ID NO：5)；

atHSP69(SEQ ID NO：6)；

atGRP62(SEQ ID NO：7)；

atPK65(SEQ ID NO：8)；

atRP46(SEQ ID NO：9)；

nb30S72(SEQ ID NO：10)；

nbGT61(SEQ ID NO：11)；

nbPV55(SEQ ID NO：12)；

nbPPI43(SEQ ID NO：13)；

nbPM64(SEQ ID NO：14)；

AGAAAGATTTGTTTCCTCTGAAATAGTTTTACAGAGCCAGAAGAAGAAAAAGAAGAAGAGAGCA, respectively; and

nbH2A86(SEQ ID NO：15)；

the enhancer sequence may be selected from SEQ ID NO: 1-15, or exhibits a sequence having an amino acid sequence substantially identical to SEQ ID NO: 1 to 15, or any amount therebetween, wherein when operably linked to a nucleic acid of interest, the expression enhancer results in an increased level of expression of the nucleic acid of interest when operably linked to the same nucleic acid of interest to which it is not operably linked or, for example, operably linked to the prior art expression enhancer CPMV160 (SEQ ID NO: 16). The SEQ ID NO: 1-15, including deletion, insertion, and/or substitution of one or more nucleotides of the enhancer sequence, to produce an expression enhancer that results in similar or increased enhancer activity, or to result in another beneficial property of the expression enhancer (see, e.g., Diamos et al, Frontiers in Plant science.2016, Vol.7, pages 1-15; Dvir S. et al, 2013, PNAS, published on line at 7/15.2013; Leppek K et al, 2018, Nature Reviews mol. cell biol.19: 158-174; incorporated herein by reference). For example, the beneficial properties can include improved transcription initiation, improved mRNA stability, improved mRNA translation, or a combination thereof.

It was observed that the use of one or more than one of the above SEQ ID NOs: 1-15 of an expression enhancer results in expression of a nucleic acid of interest, or results in increased expression of a nucleic acid of interest, or a protein of interest as shown with reference to FIGS. 2-5.

With reference to FIGS. 2, 3A and 3B, when each of the expression enhancers nbMT78(SEQ ID NO: 1), nbATL75(SEQ ID NO: 2), nbDJ46(SEQ ID NO: 3), nbCHP79(SEQ ID NO: 4), nbEN42(SEQ ID NO: 5), atHSP69(SEQ ID NO: 6), atGRP62(SEQ ID NO: 7), atPK65(SEQ ID NO: 8), atRP46(SEQ ID NO: 9), nb30S72(SEQ ID NO: 10), nbGT61(SEQ ID NO: 11), nbPV55(SEQ ID NO: 12), nbPPI43(SEQ ID NO: 13), nbPM64(SEQ ID NO: 14) and nbH A86(SEQ ID NO: 86) is operably linked to a nucleic acid sequence encoding a protein of interest, similar or increased expression of a protein, Dabiol 27, Dabiol A-38, influenza A-39269, GFP, SEQ ID NO: 38, GFP, H1 Mich/45/15, H3 HK/4801/14+ CysTm, HA B Bris/60/08, or HA B Phu/3073/13 (FIG. 3B), when compared to the activity of the prior art expression enhancer sequence CMPV 160(SEQ ID NO: 16; WO2015/103704), the same nucleic acid sequence operatively linked to the same protein of interest is expressed under similar conditions or at a designated position, as compared to the activity of the prior art expression enhancer sequence atPK41 operatively linked to the same nucleic acid sequence encoding the protein of interest and expressed under similar conditions (known as AtPsaK 3', Diamos et al, Frontiers in Plant science.2016, Vol.7, pp.1-15).

FIGS. 1A and 1B show the activity of the prior art expression enhancer CPMV160 (SEQ ID NO: 16) operably linked to a nucleic acid sequence encoding a protein of interest relative to the prior art expression enhancer CPMV-HT. CPMV HT enhancer element refers to a nucleotide sequence encoding the 5' UTR that modulates cowpea mosaic virus (CPMV) RNA2 polypeptide or modified CPMV sequence, as described in WO 2009/087391; sainsbury F. and Lomonossoff G.P (Plant Physiol.148: 1212-. By CPMV160 expression enhancer is meant a nucleotide sequence comprising a truncated 5' UTR from CPMV RNA2, as described in WO 2015/103704. Both CPMV160 + and CPMV160 + expression enhancers comprise the first 160 nucleic acids of the 5'UTR of CMPV RNA2, but the CPMV160 + expression enhancer also comprises a multiple cloning site and plant kozak sequences at the 3' end.

Thus, the expression enhancers described herein may be used in a plant expression system that includes a regulatory region operably linked to an expression enhancer sequence and a nucleotide sequence of interest.

For example, the present invention provides methods of producing or increasing the yield of a protein of interest, such as but not limited to an influenza HA protein, a modified influenza HA protein, a norovirus protein or a modified norovirus protein in a plant. The method comprises introducing into a plant, a portion of a plant, or a plant cell, a nucleic acid comprising an expression enhancer described herein operably linked to a nucleotide sequence encoding a protein of interest, e.g., an influenza HA protein, a modified influenza HA protein, a norovirus protein, or a modified norovirus protein, and expressing the protein in the plant, the portion of the plant, or the plant cell in a transient or stable manner. Wherein an increase in expression can be determined by comparing the level of expression of a nucleotide sequence that is operably linked to an expression enhancer with the level of expression of the same nucleotide sequence that is not operably linked to an expression enhancer or, for example, when operably linked to the prior art expression enhancer CPMV160 (SEQ ID NO: 6). Alternatively, the method can comprise providing a plant, a portion of the plant, or a plant cell comprising an expression enhancer as described herein operably linked to a nucleotide sequence encoding a protein of interest, e.g., an influenza HA protein, a modified influenza HA protein, a norovirus protein, a modified norovirus protein, or a multimeric protein, and expressing a nucleic acid encoding the protein in the plant, the portion of the plant, or the plant cell in a transient or stable manner.

Furthermore, the present invention provides a plant matter, plant extract or protein extract comprising a protein of interest, such as an influenza HA protein, a modified influenza HA protein, a norovirus protein or a modified norovirus protein. The plant matter, plant extract or protein extract may be used to induce immunity, for example, against influenza or norovirus infection in a subject. Alternatively, a protein of interest, e.g., an influenza HA protein, a modified influenza HA protein, a norovirus protein, or a modified norovirus protein, may be purified or partially purified, and the purified or partially purified preparation may be used to induce immunity, e.g., against influenza or norovirus infection in a subject, or a protein of interest, e.g., an influenza HA protein, a modified influenza HA protein, a norovirus protein, or a modified norovirus protein, may be used in a composition for inducing an immune response and a pharmaceutically acceptable carrier, adjuvant, carrier, or excipient.

The expression enhancers described herein may be used to produce any protein of interest or to produce virus-like particles (VLPs). For example, with reference to fig. 4, it is shown that several expression enhancers described herein are effective for the production of norovirus VLPs.

Accordingly, the present invention also provides a method of producing or increasing VLPs comprising influenza HA protein, modified influenza HA protein, norovirus protein or modified norovirus protein in a plant. For example, the method can include introducing a nucleic acid comprising an expression enhancer described herein operably linked to a nucleotide sequence encoding an influenza HA protein, a modified influenza HA protein, a norovirus protein, or a modified norovirus protein into a plant, a portion of a plant, or a plant cell in a transient or stable manner and expressing the protein in the plant, the portion of a plant, or the plant cell to produce a VLP comprising an influenza HA protein, a modified influenza HA protein, a norovirus protein, or a modified norovirus protein. The increase in expression can be determined by comparing the level of expression of a nucleotide sequence operatively linked to an expression enhancer with the level of expression of the same nucleotide sequence not operatively linked to an expression enhancer or, for example, operatively linked to the prior art expression enhancer CPMV160 (SEQ ID NO: 16). Alternatively, the method can include providing a plant, a portion of the plant, or a plant cell comprising an expression enhancer described herein operably linked to a nucleotide sequence encoding an influenza HA protein, a modified influenza HA protein, a norovirus protein, or a modified norovirus protein, and expressing a nucleic acid encoding the protein to produce a VLP comprising an influenza HA protein, a modified influenza HA protein, a norovirus protein, or a modified norovirus protein.

Furthermore, the present invention provides a plant matter, plant extract or protein extract comprising a VLP comprising an influenza HA protein, a modified influenza HA protein, a norovirus protein or a modified norovirus protein. The plant matter, plant extract or protein extract may be used to induce immunity to norovirus infection in a subject. Alternatively, VLPs comprising influenza HA protein, modified influenza HA protein, norovirus protein, or modified norovirus protein may be purified or partially purified, and the purified or partially purified preparations may be used to induce immunity to norovirus infection in a subject, or VLPs comprising influenza HA protein, modified influenza HA protein, norovirus protein, or modified norovirus protein may be in a composition for inducing an immune response and in a pharmaceutically acceptable carrier, adjuvant, carrier, or excipient.

The expression enhancers described herein can also be used to produce multimers of the protein of interest, such as antibodies. As shown with reference to fig. 5, two nucleic acids encoding the Light Chain (LC) and Heavy Chain (HC) of an antibody, e.g., rituximab, may be co-expressed in plants when each nucleic acid sequence is operably linked to the same or different expression enhancers described herein. For example, co-expression of a first nucleic acid encoding rituximab operably linked to the expression enhancer nbATLK75 and a second nucleic acid encoding rituximab LC operably linked to the same expression enhancer nbATLK75, or a different expression enhancer nbCHP79, nbMT78, or atHSP69, results in increased multimeric or multimeric protein expression as compared to co-expression of the first and second nucleic acids encoding the same HC and LC sequences, each of which is operably linked to the prior art expression enhancer CPMV160 (SEQ ID NO: 16). Similar results were observed when co-expressing the first and second nucleic acids using other combinations of expression enhancers described herein, as shown in fig. 5.

Thus, the invention also provides methods of producing or increasing the production of multimeric proteins in plants. For example, the method can involve introducing into a plant, a portion of a plant, or a plant cell, in a transient or stable manner, a first nucleic acid comprising an expression enhancer described herein operably linked to a nucleotide sequence encoding a first protein component and a second nucleic acid comprising an expression enhancer described herein operably linked to a nucleotide sequence encoding a second protein component, and co-expressing the first nucleic acid and the second nucleic acid in the plant, the portion of the plant, or the plant cell, thereby producing the multimeric protein. An increase in expression may be determined by comparing the expression level of a first nucleic acid and a second nucleic acid, each operatively linked to an expression enhancer, to the expression level of the same first and second nucleic acids, each of which is not operatively linked to an expression enhancer, or, for example, when operatively linked to a prior art expression enhancer, CPMV160 (SEQ ID NO: 16). Alternatively, the method can comprise providing a plant, a portion of a plant, or a plant cell comprising a first nucleic acid comprising an expression enhancer as described herein operably linked to a nucleotide sequence encoding a first protein component and a second nucleic acid comprising an expression enhancer as described herein operably linked to a nucleotide sequence encoding a second protein component and co-expressing the first nucleic acid and the second nucleic acid sequence to produce the multimeric protein.

Furthermore, the invention provides plant matter, plant extracts or protein extracts comprising the multimeric protein, or the multimeric protein may be purified or partially purified.

As described herein, a nucleic acid construct is provided comprising an expression enhancer sequence operably linked to a nucleotide sequence of interest encoding a protein of interest. Also provided are plant expression systems and vectors comprising the constructs or one or more nucleic acids comprising the enhancer sequences described herein. Also provided is a plant expression system, vector, construct or nucleic acid comprising a plant regulatory region operably linked to an enhancer sequence operably linked to a nucleotide sequence of interest that encodes a protein of interest. The enhancer sequence may be selected from SEQ ID NO: 1-15, or exhibits a sequence identity to SEQ ID NO: 1 to 15, or any amount therebetween, wherein the expression enhancer, when operatively linked to a nucleic acid of interest, results in increased expression of the nucleic acid of interest or expression level of the nucleic acid of interest as compared to the same expression level of the nucleic acid of interest without operatively linked expression enhancer or operatively linked, for example, to prior art expression enhancer CPMV160 (SEQ ID NO: 16).

The SEQ ID NO: 1-15, including deletions, insertions, and/or substitutions of one or more nucleotide sequences of an enhancer sequence, to produce an expression enhancer that results in similar or increased enhancer activity, or results in another beneficial property of the expression enhancer. For example, beneficial properties may include improved transcription initiation, improved mRNA stability, improved mRNA translation, or a combination thereof.

The enhancer sequences of the invention can be used for expressing a protein of interest in a host organism, such as a plant. In this case, the protein of interest may also be heterologous to the host organism in question and introduced into the plant cells using transformation techniques known in the art. A heterologous gene in an organism may replace an endogenous equivalent gene, i.e., a gene that normally performs the same or similar function, or the inserted sequence may be a complement of an endogenous gene or other sequence.

The present invention also provides an expression cassette comprising a tandem linkage of a promoter or plant regulatory region operably linked to an expression enhancer sequence as described herein fused to a nucleotide sequence of interest, a 3' UTR sequence and a terminator sequence. The enhancer sequence may be defined as SEQ ID NO: 1-15 or any one that exhibits a sequence identity to SEQ ID NO: 1-15 or any number therebetween, or sequence identity therebetween, in a sequence of 100%, 99%, 98%, 97%, 96%, 95%, or 90%. Enhancer sequences can also be modified using techniques known to those skilled in the art, provided that the enhancer sequence results in expression of the nucleic acid of interest or increases the level of expression of the nucleotide sequence of interest, for example, by comparing the level of expression of a nucleotide sequence operatively linked to the expression enhancer with the level of expression of the same nucleotide sequence not operatively linked to the expression enhancer or, for example, when operatively linked to the prior art expression enhancer CPMV160 (SEQ ID NO: 16).

Table 1 lists the sequences described herein.

Table 1: list of nucleic acid and amino acid sequences:

the invention will be further illustrated in the following examples.

Example 1: selection of plant 5' UTR sequences Using Polycosome/CAGE analysis

mRNA was extracted from biomass or cell cultures that were not infiltrated and permeated under different stresses using standard phenol-chloroform protocols and mRNA in low and high translation states was isolated by standard centrifugation through sucrose gradients. The mRNA of each non-polymorphic and polymorphic fraction was extracted using standard phenol-chloroform extraction protocols. The start of the 5' UTR of each mRNA in each multimeric and non-multimeric ribosome was sequenced using the Cap Analysis of Gene Expression (CAGE) method. After removal of the unwanted sequence tags (ribosomal RNA, chloroplast RNA and uncovered tags), the sequenced tags are compared to a reference genomic database, such as the TAIR of Arabidopsis (see URL: Arabidopsis. org /) or the genomic network of Nicotiana benthamiana (see URL: solgenomics. net /) for gene identification. The number of sequencing tags per given gene was analyzed and normalized. The translational state was assessed by dividing the normalized number of tags found in the polysome fraction by the total number of tags per given gene, establishing the polysome ratio (PR ratio). Gene mRNAs with high translational status under invasive conditions were used to identify potential 5' UTR candidate genes.

As a result of this analysis, 15 candidate 5' UTRs were identified and further characterized:

nbMT78(SEQ ID NO: 1): the 78bp 5' UTR is part of a gene located at the Niben101Scf38767g00006.1 locus, which encodes the metallothionein-like protein 1.

nbATL75(SEQ ID NO: 2): the 75bp 5' UTR is part of a gene located in the gene site Niben101Scf08015g04003.1, which encodes an At4g 36060-like protein (basic helix-loop-helix (bHLH) DNA binding superfamily protein; TAIR: AT3G19860.1).

nbDJ46(SEQ ID NO: 3): the 46bp 5' UTR is part of a gene located in the gene Niben101Scf16258g02004.1 which encodes the defensin J1-2 protein.

nbCHP79(SEQ ID NO: 4): the 79bp 5' UTR is part of a gene located at the site of the gene Niben101Scf02509g07005.1, which encodes a conserved hypothetical protein (ricin, GenBank, EEF49157.1, 68AA) of unknown function.

nbEN42(SEQ ID NO: 5): the 42bp 5' UTR is part of a gene located in the gene locus Niben101Scf06633g02009.1, which encodes the early regulatory protein-like protein 2. In Arabidopsis (AT3G20570.1), the protein may have electron carrier activity and copper ion binding membrane proteins.

atHSP69(SEQ ID NO: 6): the 69bp 5' UTR was obtained from a nucleotide sequence (AT2G40000.1-00069) encoding the nematode resistance protein like HSPRO2, which plays a positive regulatory role in basal resistance in response to oxidative stress and salicylic acid in plant defense against pathogens.

atGRP62(SEQ ID NO: 7): the 62bp 5' UTR was obtained from a nucleotide sequence encoding a glycine-rich protein of unknown function (AT5G61660.1-00062).

atPK65(SEQ ID NO: 8): the 65bp 5' UTR was obtained from a nucleotide sequence encoding a chloroplast multipass membrane protein member of the plant photosystem I supercomplex (psi) family (AT1G30380.1-00065). This protein is involved in chlorophyll binding and photosynthesis.

atRP46(SEQ ID NO: 9); the 46bp 5' UTR was obtained from the nucleotide sequence (AT4G21210.1_00046) encoding chloroplast ATRP1, PPDK regulatory protein RP 1.

Nb30S72(SEQ ID NO: 10): the 72bp 5' UTR is part of a gene located at the Niben101Scf04081g02005.1 locus, which encodes the 30S ribosomal protein S19. The small S19 protein (92AA) located in the chloroplast forms a complex with S13, which binds strongly to 16S ribosomal RNA.

nbGT61(SEQ ID NO: 11): the 61bp 5' UTR is part of a gene located in the locus Niben101Scf17164g00027.1 which encodes glutathione toxin (GRX), a family of small oxidoreductases that use glutathione as a cofactor.

nbPV55(SEQ ID NO: 12): the 55bp 5' UTR is part of a gene located at the locus Niben101Scf03733g03018.1 which encodes a photosystem I reaction center subunit V chloroplast protein of unknown function.

nbPPI43(SEQ ID NO: 13): the 143bp 5' UTR is part of a gene located in the locus niben101scf01847g03004.1 encoding a peptidyl-prolyl cis-trans isomerase a (ppi).

nbPM64(SEQ ID NO: 14): the 64bp 5' UTR is part of a gene located in the locus Niben101Scf05678g02004.1, which encodes a proteasome maturation protein homologue.

15, nbH2A86(SEQ ID NO: 15): the 86bp 5' UTR is part of a gene located at the locus Niben101Scf00369g03018.1 which encodes the histone 2A protein.

The following constructs comprising the above identified enhancers were prepared as follows:

2X 35S/nbMT 785 'UTR/Dasher/CPMV 3' UTR/NOS terminology (construct No. 4467; SEQ ID) NO：75)

The following PCR-based method was used to clone sequences encoding the fluorescent protein Dasher (Atum, cat # FPB-27-609) fused to the nbMT 785 'UTR into the 2X35S promoter + CPMV 3' UTR/NOS expression system. In the first round of PCR, fragments containing Dasher fluorescent protein were amplified using the Dasher gene sequence (SEQ ID NO: 20; FIG. 16B) as template and primers nbMT78_ Dasher.c (SEQ ID NO: 17) and IF-Dasher (27-609). r (SEQ ID NO: 18). The PCR product of the first round of amplification (F1 in Table 2) was used as a template, and ATMT 785' UTR sequence was added as a primer using IF-nbMT78.c (SEQ ID NO: 19) and IF-Dasher (27-609). r (SEQ ID NO: 18). The final PCR product (F2 In Table 2) was cloned into the 2X35S promoter + CPMV 3' UTR/NOS expression system using the In-Fusion cloning system (Clontech, Mountain View, Calif.). Construct No. 1666 (fig. 6A) was digested with AatII and StuI restriction enzymes, and the linearized plasmid was used for the fusion assembly reaction. 1666 is a recipient plasmid designed to "fuse" the cloned gene of interest in the 2X35S promoter + CPMV 3' UTR/NOS gene expression cassette. It also incorporates a gene construct for co-expression of the silenced TBSV P19 repressor under the alfalfa plastocyanin gene promoter and terminator. The backbone is a pCAMBIA binary plasmid, and the sequence from the left to the right border of the t-DNA is as set forth in SEQ ID NO: 22, respectively. The resulting construct is numbered 4467(SEQ ID NO: 75; SEQ ID NO: FIG. 16E). The amino acid sequence of the Dasher fluorescent protein is shown in SEQ ID NO: 21. construct 4467 is shown in figure 6B.

The primer, template and nucleic acid and protein sequences for all constructs described herein are given in table 2.

For the influenza H3 and HA B constructs, in addition to the 2x35S promoter + CPMV 3' UTR/NOS based expression kit, the cloning vector used also integrated the alfalfa plastocyanin promoter and the influenza M2 ion channel gene under the control of a terminator. Plasmid No. 4160 (SEQ ID NO: 76; FIG. 6C; 17E) was digested with AatII and StuI restriction enzymes and used for the fusion reaction.

For the norovirus VP1 construct, a cloning vector was used that, in addition to the 2x35S promoter + CPMV 3' UTR/NOS based expression kit, also incorporates Matrix Attachment Region (MAR) regulatory elements following the NOS terminator from the tobacco RB7 gene. Plasmid number 4170(SEQ ID NO: 77; FIG. 6D; 18D) was digested with AatII and StuI restriction enzymes and used for the fusion reaction.

Table 2: primers, templates and target sequences required for construct preparation

SOA: a target sequence; primer 1: primer 1 (for fusion cloning); primer 2: primer 2 (construct fragment 1 to amplify the GOI with primer 3); primer 3: primer 3 (for fusion cloning)

Example 2: method of producing a composite material

Agrobacterium tumefaciens transfection

Agrobacterium tumefaciens strain AGL1 was transfected (transformed) with different expression vectors by electroporation using the method described by D' Aoust et al, 2008(Plant Biotech.J.6: 930-40). The transfected Agrobacterium were grown in LB medium supplemented with 10mM 2- (N-morpholino) ethanesulfonic acid (MES) and 50. mu.g/ml kanamycin pH 5.6 to an OD600 between 0.6 and 1.6 and frozen in 100. mu.l aliquots.

Preparation of plant biomass, inoculum and soil infiltration

Benthic tobacco was grown on flat flats filled with commercial peat moss substrate. Plants were grown in a greenhouse under conditions of 16/8 photoperiod and a temperature of 25 ℃ day/night 20 ℃. Three weeks after sowing, individual plantlets were picked, transplanted into pots, and grown in the greenhouse for three weeks under the same environmental conditions.

Agrobacterium transfected (transformed) with each expression vector was grown in LB medium supplemented with 10mM 2- (N-morpholino) ethanesulfonic acid (MES) and 50. mu.g/ml kanamycin pH 5.6 until they reached an OD600 between 0.6 and 1.6. The Agrobacterium suspension was centrifuged before use and then resuspended in osmotic medium (10mM MgCl2 and 10mM MES pH 5.6) and stored overnight at4 ℃. On the day of infiltration, culture batches were diluted to 2.5 culture volumes and heated prior to use. The whole plant of Nicotiana benthamiana was inverted in a bacterial suspension in an airtight stainless steel jar at a vacuum of 20-40 torr for 2 minutes. The plants were returned to the greenhouse for 6 or 9 days of incubation until harvest.

Harvesting leaves and extracting total proteins

After incubation, the aerial parts of the plants were harvested, frozen at-80 ℃ and crushed into pieces. Total soluble proteins were extracted by homogenizing (Polytron) each sample of the crushed plant material in 2 volumes of cold 50mM Tris buffer pH 8.0+500mM NaCl, 0.4. mu.g/ml metabisulphite and 1mM phenylmethanesulphonyl fluoride. After homogenization, the slurry was centrifuged at 10,000g for 10 minutes at4 ℃ and these clarified crude extracts (supernatants) were retained for analysis.

The total protein content of the clarified crude extract was determined by Bradford assay (Bio-Rad, Heracleus, Calif.) using bovine serum albumin as a reference standard. Use of Criterion^TMTGX Stain-Free^TMPre-formed gels (Bio-Rad Laboratories, Heracleus, Calif.) separate proteins by SDS-PAGE under reducing conditions. Proteins were visualized by staining the gel with Coomassie Brilliant blue. Or may use Gel Doc^TMThe proteins were visualized by an EZ imaging system (Bio-Rad laboratories, Hercules, Calif.) and then electroporated onto a polyvinylidene fluoride (PVDF) membrane (Indianapolis, Ind., Roche Diagnostics Corporation) for immunodetection. Prior to immunoblotting, membranes were blocked in Tris buffered saline (TBS-T) with 5% skimmed milk powder and 0.1% Tween-20 at4 ℃ for 16-18 hours.

Determination of Dasher expression in crude extracts by direct fluorescence

The dash expression was quantified by direct measurement of fluorescence in the crude extract. The frozen biomass was extracted by mechanical extraction using 50mM Tris +150mM NaCl pH 7.4 extraction buffer and centrifuged at 10000g for 10 min at4 ℃ to remove insoluble debris. The clarified crude extract was diluted 1/16, 1/48 and 1/144 in PBS and fluorescence was measured using a fluoroskan (ascent) instrument using 485nm as the excitation filter and 518nm as the emission filter.

HA expression determined using hemagglutination assay (HA Titers)

The hemagglutination assay is based on the method described by Nayak and Reichl (2004, J.Virol. methods 122: 9-15). Test samples were serially double diluted (100 μ L) in V-bottomed 96-well microtiter plates containing 100 μ L PBS, retaining 100 μ L of diluted sample per well. 100 microliters of a 0.25% turkey red blood cell suspension (Bio Link Inc. in snow City, New York; H1, H5, and H7 for all B strains) or a 0.5% guinea pig red blood cell suspension (for H3) were added to the well plates and incubated at room temperature for 2 hours. The reciprocal of the highest dilution showing complete hemagglutination was recorded as HA activity.

Rituximab expression determined by gel density method

For rituximab expression analysis, a crude protein extract (2g biomass/EU) was produced from the leaves by mechanical extraction in 150mM Tris, pH 7.4 buffer with 150mM NaCl, and the extract was electrophoresed on SDS-PAGE under non-reducing conditions for in-gel densitometry quantification of the band corresponding to the fully assembled H2L2 form of the antibody. Protein electrophoresis was performed in Bio-Rad non-fouling gels and a Gel imaging system was performed using a Gel Doc XR + system (including Image Lab software for Image analysis and quantification in gels).

Analysis of VLP formation/iodixanol gradient

Proteins were extracted from the frozen biomass by mechanical extraction in a mixer with 2 volumes of extraction buffer (100mM phosphate buffer pH 7.2+150mM NaCl). The slurry was filtered through a macroporous nylon filter to remove large debris and centrifuged at 5000g for 5 minutes at4 ℃. The supernatant was collected and centrifuged again at 5000g for 30 minutes (4 ℃) to remove other debris. The supernatant was then loaded on a discontinuous iodixanol density gradient. Analytical density gradient centrifugation was performed as follows: 38ml tubes were prepared containing a discontinuous iodixanol density gradient (1ml 45% in 2ml 35% in 2ml 33% in 2ml 31% in 2ml 29% in 2ml and 5ml 25% in acetate buffer) and covered with 25ml of extract containing virus-like particles. The gradient was centrifuged at 175000g for 4 hours (4 ℃). After centrifugation, 1ml fractions were collected from bottom to top and analyzed by SDS-PAGE in conjunction with protein staining or Western blotting.

Example 3: production of proteins in plants

As described in example 2, leaves of nicotiana benthamiana were vacuum infiltrated with agrobacterium tumefaciens comprising an expression vector encoding a protein of interest operably linked to a defined expression enhancer such that the protein of interest was expressed, and the leaves were examined for production of the protein of interest. After 9 days post-infiltration (DPI), total crude protein extracts were prepared from the leaf homogenates and the hemagglutinin titers were determined as described above.

With reference to FIG. 2, it was observed that each of the expression enhancers nbMT78(SEQ ID NO: 1), nbATL75(SEQ ID NO: 2), nbDJ46(SEQ ID NO: 3), nbbCHP 79(SEQ ID NO: 4), nbEN42(SEQ ID NO: 5), atHSP69(SEQ ID NO: 6), atGRP62(SEQ ID NO: 7), atPK65(SEQ ID NO: 8), atRP46(SEQ ID NO: 9), nb30S72(SEQ ID NO: 10), nbGT61(SEQ ID NO: 11), nbPV55(SEQ ID NO: 12), nbPPI43(SEQ ID NO: 13), nbPM64(SEQ ID NO: 14) and nbPPI 2A86(SEQ ID NO: 15) operably linked to the nucleic acid sequence encoding Dasher (SEQ ID NO: 15) or the nucleic acid sequence encoding the same human protein enhancer of interest operably linked to the prior art enhancer sequence PsaPK 3(SEQ ID NO: 596) was operably linked to the prior art enhancer sequence, frontiers in Plant Science.2016, volume 7, pages 1-15), and expresses increased protein expression as compared to activity expressed under similar conditions.

As shown in FIG. 3A, it was observed that each of the expression enhancers nbMT78(SEQ ID NO: 1), nbATL75(SEQ ID NO: 2), nbDJ46(SEQ ID NO: 3), nbBCHP 79(SEQ ID NO: 4), nbEN42(SEQ ID NO: 5), atHSP69(SEQ ID NO: 6), atGRP62(SEQ ID NO: 7), atPK65(SEQ ID NO: 8), atRP46(SEQ ID NO: 9), nb30S72(SEQ ID NO: 10), nbGT61(SEQ ID NO: 11), nbPV55(SEQ ID NO: 12), nbPPI43(SEQ ID NO: 13), nbPM64(SEQ ID NO: 14) and SEQ 6A 86(SEQ ID NO: 86) operably linked to the nucleic acid sequence encoding the same as the prior art protein enhancer sequence (WO 15) or the nucleic acid sequence encoding the same as the prior art protein enhancer 103704 (SEQ ID NO: 103704) is operably linked to the nucleic acid sequence encoding the human AMAGP 27 (SEQ ID enhancer) AtPsaK 3', Frontiers in Plant Science.2016, volume 7, pages 1-15), and expresses activity that results in similar or slightly increased protein expression when compared to expression under similar conditions.

Referring to FIG. 3B, it was observed that each of the expression enhancers nbMT78(SEQ ID NO: 1), nbATL75(SEQ ID NO: 2), nbCHP79(SEQ ID NO: 4), atHSP69(SEQ ID NO: 6) operatively linked to the same nucleic acid sequence encoding the same protein of interest, and CMPV 160(WO2015/103704) encoding the modified H1 Michigan/45/15, modified H3 hongkong/4801/14 and modified HA B/Phuket/60/08 or modified HA B/Phuket/3073/13, was similarly or slightly increased in expression of the protein as compared to expression under similar conditions.

These results demonstrate that the expression enhancer sequences described herein can be used to express a protein of interest in a plant, a portion of a plant, or a plant cell operably linked to an expression enhancer.

Example 4: production of norovirus VP1 proteins and VLPs in plants

Leaves of Nicotiana benthamiana were vacuum infiltrated with Agrobacterium tumefaciens containing an expression vector encoding norovirus VP1 from the GII.4 genotype, as described in example 2, and examined for VLP production from the leaves. After 9 days post-osmosis (DPI), the total crude protein extract was separated by SDS-PAGE and stained with coomassie stain (produced by VP1), or separated using a discontinuous iodixanol density gradient as described in example 2 above (VLP production). Fractions of the density gradient were examined using coomassie stained SDS-PAGE. Norovirus VP1 protein appears in a band of approximately 55-60 kDa. The appearance of VP1 protein in the partial density gradient indicates the fraction of VLPs that equilibrate during density gradient centrifugation. The yield of VLPs obtained from the peak fractions after density gradient centrifugation was also determined.

It was observed that each of the expression enhancers nbMT78(SEQ ID NO: 1), nbATL75(SEQ ID NO: 2), nbCHP79(SEQ ID NO: 4) and atHSP69(SEQ ID NO: 6), operably linked to a nucleic acid sequence encoding the modified norovirus GII.4/Sydney/2012 VP1, resulted in norovirus protein expression. Furthermore, the production of norovirus GII.4VP1 VLPs using the above expression enhancer was similar to that obtained using either the prior art CPMV160 expression enhancer (WO2015/103704) or the prior art expression enhancer nbPK74 (named NbPsaK 23', Diamos et al, Frontiers in Plant science.2016, Vol.7, pp.1-15). These results demonstrate that the expression enhancers described herein can be used to generate virus-like particles (VLPs).

Example 5: production of multimeric proteins in plants

The expression enhancers described herein can also be used to produce a multimeric protein of interest, such as an antibody. As described in example 2, leaves of Nicotiana benthamiana were vacuum infiltrated with Agrobacterium tumefaciens containing an expression vector encoding a protein of interest operably linked to a defined expression enhancer to allow expression of the protein of interest and to check whether the protein of interest was produced in the leaves. After 9 days post-infiltration (DPI), total crude protein extracts were prepared from the leaf homogenates and separated by SDS-PAGE as described above, and the expression level of intact IgG was then determined by in-gel densitometry.

As shown in fig. 5, co-expression of two nucleic acids, a first nucleic acid encoding a rituximab Light Chain (LC) is operably linked to one of the following expression enhancers: nbMT78(SEQ ID NO: 1), nbATL75(SEQ ID NO: 2), nbCHP79(SEQ ID NO: 4) and atHSP69(SEQ ID NO: 6), and a second nucleic acid encoding rituximab Heavy Chain (HC) is operably linked to one of the following expression enhancers: nbMT78(SEQ ID NO: 1), nbATL75(SEQ ID NO: 2), nbCHP79(SEQ ID NO: 4) and atHSP69(SEQ ID NO: 6) resulted in the same or slightly increased production of multimeric protein in plants as compared to co-expression of first and second nucleic acids encoding the same HC and LC rituximab sequences, wherein the first and second nucleic acids were each operatively linked to a prior art expression enhancer, CPMV 160.

These results demonstrate that the expression enhancers described herein can be used to produce multimeric proteins, such as antibodies, and that the same or different expression enhancers described herein are operably linked to each nucleic acid sequence used to encode a component of the multimeric protein.

All citations are herein incorporated by reference.

The present invention has been described with reference to one or more embodiments. However, it will be apparent to those skilled in the art that various changes and modifications may be made without departing from the scope of the invention as defined in the following claims.

The claims (modification according to treaty clause 19)

1. An isolated expression enhancer active in a plant, a part of a plant, or a plant cell, selected from the group consisting of:

nbMT78(SEQ ID NO：1)、

nbATL75(SEQ ID NO：2)、

nbDJ46(SEQ ID NO：3)、

nbCHP79(SEQ ID NO：4)、

nbEN42(SEQ ID NO：5)、

atHSP69(SEQ ID NO：6)、

atGRP62(SEQ ID NO：7)、

atRP46(SEQ ID NO：9)、

nb30S72(SEQ ID NO：10)、

nbGT61(SEQ ID NO：11)、

nbPV55(SEQ ID NO：12)、

nbPPI43(SEQ ID NO：13)、

nbPM64(SEQ ID NO：14)、

nbH2A86(SEQ ID NO: 15), and

and SEQ ID NO: 1 to 7 and 9 to 15, and a nucleic acid having 90 to 100% sequence identity in the nucleotide sequence,

wherein the expression enhancer, when operatively linked to a nucleic acid of interest, results in increased expression of the nucleic acid of interest when compared to the expression level of the same nucleic acid of interest not operatively linked to the expression enhancer.

2. A nucleic acid sequence comprising the isolated expression enhancer of claim 1 operably linked to a heterologous nucleotide sequence encoding a protein of interest.

3. The nucleic acid sequence of claim 2, wherein the heterologous nucleotide sequence encodes a viral protein or an antibody.

4. The nucleic acid of claim 3, wherein the viral protein is an influenza protein or a norovirus protein.

5. The nucleic acid of claim 4, wherein the influenza protein is a hemagglutinin protein selected from the group consisting of: h1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, H15, H16 and influenza B hemagglutinin.

6. The nucleic acid of claim 4, wherein the norovirus protein is VP1, VP2, or a combination thereof, selected from GI.1, GI.2, GI.3, GI.5, GI.7, GII.1, GII.2, GII.3, GII.4, GII.5, GII.6, GII.7, GII.12, GII.13, GII.14, GII.17, and GII.21.

7.A plant expression system comprising one or more nucleic acid sequences of claim 2.

8.A plant expression system comprising one or more nucleic acid sequences of claim 3.

9.A plant expression system comprising one or more nucleic acid sequences of claim 4.

10. A plant expression system comprising one or more nucleic acid sequences of claim 5.

11. A plant expression system comprising one or more nucleic acid sequences of claim 6.

12. The plant expression system of claim 7, further comprising a cowpea mosaic virus 3' UTR.

13. A method of producing a protein of interest in a plant, a part of a plant, or a plant cell, the method comprising:

introducing the plant expression system of claim 8 into the plant, part of a plant or plant cell in a steady-state or transient manner, the vector comprising one or more nucleic acid sequences, and

cultivating said plant or a part of said plant under conditions which allow expression of each heterologous nucleotide sequence encoding a protein of interest.

14. The method of claim 13, wherein the protein of interest is a viral protein.

15. The method of claim 14, wherein the viral protein is an influenza protein or a norovirus protein.

16. The method of claim 15, wherein the influenza protein is a hemagglutinin protein selected from the group consisting of: h1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, H15, H16 and influenza B hemagglutinin.

17. The method of claim 15, wherein the norovirus protein is VP1, VP2, or a combination thereof, selected from gi.1, gi.2, gi.3, gi.5, gi.7, gii.1, gii.2, gii.3, gii.4, gii.5, gii.6, gii.7, gii.12, gii.13, gii.14, gii.17, and gii.21.

18. The method of claim 13, wherein the protein of interest is a multimeric protein and the step of introducing involves co-expressing two or more of the nucleic acid sequences, each of the two or more of the nucleic acid sequences encoding a component of the multimeric protein.

19. A plant, a part of a plant or a plant cell transiently transformed or stably transformed with the plant expression system of claim 8.

Claims

nbMT78(SEQ ID NO：1)、

nbATL75(SEQ ID NO：2)、

nbDJ46(SEQ ID NO：3)、

nbCHP79(SEQ ID NO：4)、

nbEN42(SEQ ID NO：5)、

atHSP69(SEQ ID NO：6)、

atGRP62(SEQ ID NO：7)、

atPK65(SEQ ID NO：8)、

atRP46(SEQ ID NO：9)、

nb30S72(SEQ ID NO：10)、

nbGT61(SEQ ID NO：11)、

nbPV55(SEQ ID NO：12)、

nbPPI43(SEQ ID NO：13)、

nbPM64(SEQ ID NO：14)、

nbH2A86(SEQ ID NO: 15), and

and SEQ ID NO: 1 to 15, wherein the nucleotide sequence has 90 to 100% sequence identity,

wherein the expression enhancer, when operatively linked to a nucleic acid of interest, causes expression of the nucleic acid of interest.

introducing the vector of claim 8 comprising one or more nucleic acid sequences into the plant, part of a plant, or plant cell in a steady-state or transient manner, and

14. The method of claim 13, wherein the protein of interest is a viral protein.

19. A plant, a part of a plant or a plant cell transiently transformed or stably transformed with the vector of claim 8.