CN112391442B - Nucleic acid sample processing method, sequencing method and kit - Google Patents
Nucleic acid sample processing method, sequencing method and kit Download PDFInfo
- Publication number
- CN112391442B CN112391442B CN201910868866.7A CN201910868866A CN112391442B CN 112391442 B CN112391442 B CN 112391442B CN 201910868866 A CN201910868866 A CN 201910868866A CN 112391442 B CN112391442 B CN 112391442B
- Authority
- CN
- China
- Prior art keywords
- dna
- product
- strand
- probe
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a DNA sample processing method, a sequencing method and a kit. The method for processing the DNA sample comprises the steps of fragmenting, repairing the tail end and adding dA tail to the DNA in a first premixing system to obtain a first product; the first pre-mix system is said to comprise pre-mixed enzymes, which are said to comprise DNA-fragmenting enzymes, polynucleotide kinases and DNA polymerases. Based on a test and an optimized mixed enzyme system, a plurality of enzymes are mixed in the same reaction system, DNA breakage, terminal repair and dA tail addition are realized in one step, the method is simple, convenient and quick, the operation time of pre-machine sample treatment is saved, and the industrialization is facilitated.
Description
Technical Field
The invention belongs to the field of biomacromolecule detection and analysis, and particularly relates to a nucleic acid sample processing method, a sequencing method and a kit.
Background
High-throughput sequencing includes, among others, next generation sequencing and single molecule sequencing, involving the processing of nucleic acid samples prior to on-line detection. In particular, nucleic acid sequencing based on chip detection requires the processing of the nucleic acid to be detected (template) to attach it to the chip for sequencing.
Currently available chip-based detection sequencing platforms are generally sold as a kit with a specific sequence (probe) on the kit, and the template generally needs to be processed by various methods to contain the specific sequence or at least a part of the sequence matching the specific sequence so that the template can be bound to the chip; the various treatments referred to generally involve, for long nucleic acid fragments, such as genomic DNA, in particular, mechanical or enzymatic cleavage of nucleic acids to obtain nucleic acid fragments, repair of the nucleic acid fragments such as filling in their ends and/or making them have specific cohesive ends so that the nucleic acid fragments can be ligated with specific sequences (linkers) to obtain a sequencing library.
At present, there are various commercially available kits for each step of the above-mentioned pre-processing of nucleic acids, for example, a fragmentation kit, an end-repair optional dA-tailed kit, a linker ligation kit, and a kit for each step of purification, including a kit for detecting and/or removing a specific reagent interfering with a subsequent reaction in a previous reaction system, and the like. Generally, no commercially available kit discloses a specific formulation thereof, including the kind, characteristics, concentration, specific reaction solution configuration, etc. of the enzyme.
The rapid and simple treatment method of pre-nucleic acid, including the related solution system, is in need of further development and improvement.
Disclosure of Invention
The invention provides a method for processing a DNA sample, which mixes a plurality of enzymes in the same reaction system to realize DNA breakage, end repair and dA tail addition in one step, is simple, convenient and quick, saves the operation time of sample processing before loading and is beneficial to industrialization; the invention also provides a sample sequencing method, which comprises the steps of capturing the DNA sample processed by the DNA sample processing method provided by the invention through a probe, and sequencing by the second generation technology and the third generation technology; in addition, the invention provides a kit, wherein the End Prep Mix in the kit is formed by mixing a plurality of enzymes and a buffer solution, and the kit can be used for processing a DNA sample and sequencing the sample, can simplify the operation, and is simple, convenient and quick.
The invention provides a method for processing a DNA sample, which comprises the steps of fragmenting, repairing and adding dA tail to the DNA in a first premixing system to obtain a first product; the first pre-mix system includes a pre-mixed enzyme that includes a DNA-fragmenting enzyme, a polynucleotide kinase, and a DNA polymerase.
It will be appreciated that the action of the DNA-fragmenting enzyme in the above-described method fragments the DNA sample to the size of the desired fragments, and in embodiments of the invention, the DNA-fragmenting enzyme may be selected from T7 DNO I, phyI 1122 endonuclease from Bacillus pestis, phyI 03-12 endonuclease from bacteriophage, T3 DNO endonuclease from bacteriophage, H-1 endonuclease from Pseudomonas putida, KT2440 DNO I from Pseudomonas putida, and S101RP endonuclease I from Rose phage, and the like, and the selected kits are Tiangen DNA-fragmenting kit 305-02, qiagen CM0162 fragmenting enzyme kit, NEB NG fragmenting enzyme, and the like.
In one example, the DNA in the above method is not less than 5Kb, and the fragmented first product is 100 to 400bp. Based on the restriction of the sequencing length of the sequencing instrument, in one example, the size of the selected first product is 100-300bp.
In one example, the amount of DNA in the above method is 10ng to 60ng; preferably, the content of DNA in the above method is 15ng-50ng, the content of DNA is directly related to the size of the reaction system, the amount of enzyme used and the amount of library required, the amount of library constructed with too small amount of DNA is too small, the sequencing obtained data can not meet the requirement, and meanwhile, if the content of DNA is too large, the DNA can not be sufficiently fragmented and subjected to linker addition reaction in a certain system, and a lot of invalid fragments can appear in the constructed library. The DNA content of 15ng-50ng is selected, multiple tests show that the reaction can be effectively carried out at the fragmentation reaction temperature of 32 ℃, and meanwhile, the library constructed by utilizing the DNA content meets the requirement of on-machine sequencing.
In one example, the first pre-mix system further comprises Mg 2+ Said Mg 2+ Preferably, the concentration of Mg in the first premix is 60mM to 100mM, and 2+ the concentration of (B) is 60 mM-75 mM. Different enzymes for Mg 2+ In one embodiment of the present invention, the volume ratio of the first pre-mixed system to the total system of genomic DNA fragmentation, end repair and dA-tail addition reaction is 1:5, i.e. mixing Mg selected for the enzyme reaction in the total reaction system 2+ The concentration of (2) is 12 mM-15 mM, and Mg is selected 2+ The concentration of (A) is 6mM higher than that selected for the conventional enzyme reaction.
In one example, in the first pre-mixing system of the above method, the DNA-fragmenting enzyme is present in an amount of at least 2 times the polynucleotide kinase in total activity units U, and the DNA polymerase is selected from at least one of DNA polymerase I and Taq DNA polymerase, and preferably, the DNA polymerase consists of Klenow fragment of DNA polymerase I and Taq DNA polymerase. The polynucleotide kinase is a T4 polynucleotide kinase.
In one example, the amounts of the DNA fragmenting enzyme, the polynucleotide kinase, the Klenow fragment of DNA polymerase I and the Taq DNA polymerase in the first pre-mix system are in a ratio of [25,35]: [6,10]: [1,3]: [3,5], the total enzyme activity units U, which is optimized over a plurality of experiments and can simultaneously satisfy the requirements of the sample for different enzymes. In one embodiment of the invention, the total enzyme activity unit ratio of the DNA-fragmenting enzyme, the polynucleotide kinase, the Klenow fragment of DNA polymerase I, and the Taq DNA polymerase is 18:6:1:1,taq enzyme concentration in the first premix system was (1/3. About.2/3) U/ul. Wherein Taq enzyme activity unit is defined as the amount of enzyme required to incorporate 10nmol of dNTP into the acid-insoluble precipitate within 30 minutes at 37 ℃ and is defined as 1 activity unit (U); the Klenow fragment enzyme activity unit is defined as the amount of enzyme required to incorporate 10nmol dNTP into the acid-insoluble precipitate within 30 minutes at 37 ℃ and is defined as 1 activity unit (U); the activity unit of nucleotide kinase is defined as the amount of enzyme required to incorporate 1nmol of [ gamma-32P ] ATP into the acid-insoluble precipitate at 37 ℃ for 30 minutes as 1 activity unit (U); the unit of activity of DNA-fragmenting enzyme is defined as the amount of enzyme required to convert 1. Mu.g of supercoiled pUC (AT) into a linear form (double-strand-cut) or a nicked form (single-strand-cut) in a reaction of 20ml AT 37 ℃ for 30 minutes, and is defined as 1 unit of activity (U).
Any one of the DNA sample processing methods is based on a test and an optimized mixed enzyme system, so that a plurality of sample processing modules are efficiently realized in one step in the same reaction system, including DNA breakage, terminal repair and dA tail addition, the obtained processed nucleic acid is suitable for being placed on various sequencing platforms for detection, the operation is simple, convenient and quick, the time required by sample processing before loading is saved, and the industrialization is facilitated; further, the product obtained through the treatment can be directly subjected to the next treatment process without being separated or purified from the reaction system.
In one example, the above method further comprises providing at least one end of the first product with a predetermined sequence in a second pre-mix system to obtain a second product, the second pre-mix system comprising the first pre-mix system and the predetermined sequence.
Further, the second pre-mix system may further comprise a ligase, such as T4 DNA ligase.
Further, the predetermined sequence is a double-stranded DNA, and is composed of a first strand and a second strand that are complementary, and the predetermined sequence has at least one single-stranded end.
In one example, the 5' end of the first strand has a phosphate group, the 3' end of the second strand does not have a hydroxyl group, the 5' end of the first strand is linked to the first product, the ligation reaction is performed by using the predetermined sequence, only the first strand is linked to the first product, and the library constructed by the method can be directly used for sequence capture in the library construction process without PCR.
Further, tm1 is the dissolution temperature of the first chain, tm2 is the dissolution temperature of the second chain, 80 ℃ is not less than (Tm 1-Tm 2) not less than 10 ℃, and 90 ℃ is not less than Tm1 not less than 50 ℃. Specifically, tm1 is 71 ℃ and Tm2 is 45.6 ℃, and the difference between the melting temperatures of the two strands is used to reduce the influence of the second strand on the capture efficiency during sequence capture.
In one example, the predetermined sequence is selected from SEQ ID NOs: 1 and SEQ ID NO: 2. the amino acid sequence of SEQ ID NO:1 and SEQ ID NO:3 and/or SEQ ID NO:4 and SEQ ID NO:5.
any of the above methods, based on the method of any one of 1 to 12, can make the nucleic acid to be tested have a predetermined sequence (also referred to herein as a linker) by ligation and/or polymerization, and can rapidly and efficiently prepare a nucleic acid to be tested (sequencing library) containing a specific sequence by using the reaction system and the designed linker involved in any one of the methods, so as to meet the requirements of the subsequent computer reaction.
In a second aspect, the present invention provides a method for determining a DNA sequence, comprising:
processing the DNA by using the method for processing the DNA sample to obtain a first product and a second product;
the second product is attached to the surface of the solid substrate and the second product is sequenced to determine the sequence of at least a portion of the DNA.
In one example, the second product carries an optically detectable label, such as a fluorescent molecule.
In one example, the solid substrate has a probe on its surface, and the second product is attached to the surface of the solid substrate through the probe, wherein the probe has a length of 20-80nt. The solid matrix is selected from at least one of glass, plastic and magnetic beads.
In one example, the predetermined sequence is double-stranded DNA consisting of a first strand and a second strand that are complementary, and the first strand of the predetermined sequence has a single-stranded end. Further, a first strand is fully complementary to the probe, the first strand being no longer than the probe. Furthermore, tm2-5 ℃ and T are more than or equal to Tm1-5 ℃, T is the reaction temperature for connecting the second product to the surface of the solid phase substrate, the temperature for performing sequence capture by the probe is T, tm1 is the dissolution temperature of the first chain, tm2 is the dissolution temperature of the second chain, and the reaction temperature can be used for effectively reducing the influence of the second chain on the sequence capture of the probe.
In one example, the method for determining a DNA sequence further comprises denaturing the second product before the second product is attached to the surface of the solid substrate.
In the method for determining the DNA sequence, the probe and/or the reaction condition meeting the specific requirements are selected by design, so that the sequencing library can be efficiently connected to the surface of the solid-phase matrix and stably connected, and the template information can be obtained by stably and efficiently sequencing; meanwhile, any one of the methods has the advantages and technical features of any one of the previous example methods, and is not described in detail herein.
In a third aspect, the present invention provides a kit comprising a first pre-mixing system for performing the method for treating a DNA sample and the method for determining a DNA sequence as described above. When the kit containing a premixing system is used for treating the DNA of a sample, DNA breaking, end repairing and dA tail adding can be realized in one step, the method is simple, convenient and quick, and the DNA treatment time is saved.
In one example, the kit further comprises the second pre-mix system.
In one example, the kit further comprises a probe for performing the above-described DNA sequence determination method, the second product being attached to the surface of the solid substrate via the probe, the probe having a length of 20 to 80nt of DNA sequence.
Further, the probe is complementary to the first strand, the probe is not shorter than the first strand, the predetermined sequence is a double-stranded DNA composed of the complementary first strand and second strand, the predetermined sequence has a single-stranded end, and the single-stranded end is located on the first strand.
The kit of any one of the above methods can be used to carry out any one of the above methods, so that any one of the methods has the aforementioned advantages and is industrially advantageous. Any kit can be used for pre-processing nucleic acid; optionally, and for nucleic acid sequence determination.
Drawings
FIG. 1: detection of the products labchip after completion of linker addition for F4, F5, F6 and F7 samples in example 2;
FIG. 2: labchip detection maps of F4, F5, F6, and F7 sample PCR products in example 2;
FIG. 3: detection map of labchip, a product of N5, N6, N13, N14, N21, N22, N23, N24, O5, O6, O11 and O12 samples in example 3, which were subjected to interruption, end-point repair and A-addition post-treatment.
Detailed Description
Unless otherwise defined, the terms used herein have the ordinary meaning as is known in the art to which this invention pertains.
The present invention is described below with reference to specific examples, which are intended to be illustrative only and are not to be construed as limiting the invention.
Description of materials and reagents
Linker 1 (D9-T): a double-stranded nucleic acid formed by two single-stranded nucleic acids (a first strand and a second strand), that is, a double-stranded nucleic acid formed by SEQ ID NO:1 and SEQ ID NO:2, or a double-stranded nucleic acid formed by SEQ ID NO:1 and SEQ ID NO: 3:
first strand: 5 'AGATGTATAAGAGAGACAGT-3' (SEQ ID NO: 1)
The second strand is 5 'ACTGTCTCTTATACACACATCTTGAGTGGAACTGGATGGTCGCAGGTATCAAGGATATT-3' (SEQ ID NO: 2) or 5 'CTGTCTCTTATACATCTTGAGTGGAACTGGATGGTCGCAGGTATCAAGGA-3' (SEQ ID NO: 3)
And (3) joint 2: a double-stranded nucleic acid formed from two single-stranded nucleic acids (a first strand and a second strand), e.g., a P5 and/or P7 linker that matches a portion of the ILLUMINA sequencing platform; commercially available kits, such as nuozin:
the first chain: 5 '-ACACTTTCCCTACACGACGCTCTCGAC-s-T-3' (SEQ ID NO: 4)
A second chain: 5 '-p-GATCGGAAGAGCAACGTCTGAACTCCAGTC-3' (SEQ ID NO: 5)
(-s-for thio, -p for phosphorylating)
The examples, where specific techniques or conditions are not indicated, are in accordance with routine experimental conditions, or conditions as suggested by the manufacturer's instructions. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.
Example 1
The following illustrates the method of making the kit.
The kit comprises a tube 1, wherein the tube 1 is a mixed system with a terminal repair function (also called End Prep Mix). In one instance, tube 1 is a solution comprising a polynucleotide kinase and a plurality of DNA polymerases. In another case, tube 1 is a solution comprising a DNA-fragmenting enzyme, a polynucleotide kinase, and a plurality of DNA polymerases.
The DNA polymerase can fill in the ends of the fragmented nucleic acid fragments, and preferably, the selected DNA polymerase has an amplification function and a repair and proofreading function, and is selected from one or two of Taq DNA polymerase (abbreviated as Taq enzyme) and Klenow fragment; the Polynucleotide Kinase can be selected from T4 Polynucleotide Kinase (T4 Polynucleotide Kinase).
In one case, the DNA polymerase is a mixture of Taq enzyme and Klenow fragment, the enzyme activity unit (U) ratio of Taq enzyme, klenow fragment and polynucleotide kinase in tube 1 is 1. Here, the units of activity of each enzyme are defined as follows: taq enzyme activity unit: the amount of enzyme required to incorporate 10nmol of dNTP into the acid-insoluble precipitate at 37 ℃ for 30 minutes is defined as 1 activity unit (U); klenow fragment activity units: the amount of enzyme required to incorporate 10nmol of dNTP into the acid-insoluble precipitate at 37 ℃ for 30 minutes was defined as 1 activity unit (U); nucleotide kinase activity units: the amount of enzyme required to incorporate 1nmol of [ gamma-32P ] ATP into the acid-insoluble precipitate at 37 ℃ for 30 minutes was defined as 1 activity unit (U).
In one case, the tube 1 further contains a DNA-fragmenting enzyme, and the tube 1 is prepared by preparing a mixed enzyme solution a except the DNA-fragmenting enzyme and then adding the DNA-fragmenting enzyme solution to the mixed enzyme solution a, for example, a DNA-fragmenting enzyme solution and the mixed enzyme solution a in a volume ratio of 1:2 mix such that the DNA-fragmenting enzyme, the mix of Klenow fragments, the Taq enzyme, klenow fragments, and the polynucleotide kinase have an enzyme activity unit (U) ratio of 18: 1; the DNA fragmenting enzyme may be selected from the group consisting of the Tiangen DNA fragmenting kit NG305-02, the Qiagen CM0162 fragmenting enzyme kit or the NEB fragmenting enzyme. The Taq enzyme, klenow and polynucleotide kinase contained in the enzyme mixture A may be selected from those sold by NEB, tiangen, novozam (Vazyme), and the like. DNA-fragmenting enzyme Activity Unit 1. Mu.g of supercoiled pUC (AT) was converted into a linear form (double-strand-cleaved) or a nicked form (single-strand-cleaved) in a reaction of 20ml AT 37 ℃ within 30 minutes.
When preparing the tube 1, preparing or purchasing each individual enzyme solution separately, and mixing each individual enzyme solution; alternatively, a mixed enzyme solution and a buffer solution may be prepared separately and then mixed, for example, in a volume ratio of 1:1 to prepare a tube 1,.
In one case, in preparing tube 1, separate enzyme solutions including separate DNA-fragmenting enzymes, T4 polynucleotide kinase, taq DNA polymerase and Klenow fragment kits were selected for purchase from each merchant; the individual enzyme solutions in each commercially available kit were then mixed in the specified ratio and MgCl was additionally added 2 Solutions, e.g. by additionally adding MgCl of not less than 60mM 2 Thereby, the tube 1 was produced.
In one case, the various enzymes in tube 1 are placed together in the following solution system: the 10 × Buffer specific composition is 700mM Tris-HCl pH 7.6,120-150mM MgCl2,50mM DTT and 1mM dNTPs; here, 1mM dNTPs means that the concentration of each dNTP is 1mM. The ratio of the total volume of the various enzymes in tube 1 to the volume of 10x Buffer was 1:1, the mixing system of the tube 1 obtained at this time is 5x End Prep Mix, that is, when the reaction of DNA fragmentation, end repair and dA tail addition is performed by using the mixing system of the tube 1, the volume ratio of the mixing system of the tube 1 to the total reaction system is 1:5; the specific components and concentrations of Buffer in tube 1 are respectively: 350mM Tris-HCl pH 7.6,60-75mM MgCl2,25mM DTT and 0.5mM dNTPs, the concentration of taq enzyme in tube 1 is (1/3-2/3) U/ul.
In some cases, the kit further comprises a tube 2, the tube 2 being a mixed system with Ligation function (Ligation Mix) consisting of DNA ligase and a ligase buffer system. The DNA Ligase may be Blunt/TA Ligase, e.g., T4 DNA Ligase. In some cases, the kit further comprises a tube 2, the tube 2 being a mixed system with Ligation function (Ligation Mix) consisting of DNA ligase and a ligase buffer system. The DNA Ligase may be Blunt/TA Ligase, e.g., T4 DNA Ligase. The concentration of each substance of the 2x Ligation Mix is: t4 DNA Ligase buffer:80-100mM Tris-HCl pH 7.8, 20mM MgCl2,20mM DTT,10mM ATP,50ug/ml BSA, and the activity unit concentration of T4 DNA Ligase is 60-100U/ul. Different concentrations of Ligation Mix can be configured according to requirements. The T4 DNA Ligase activity unit is defined as the amount of enzyme required to ligate 50% of 6ug of lambda DNA HindIII digest in 20ul reaction 50mM Tris-HCl pH 7.5, 10mM MgCl2,10mM MDTT,5mM ATP,25ug/ml BSA at 16 ℃ for 30 min. The Ligation Mix may be selected from the reagents in the NEB Cat M0367S kit.
In some cases, the kit further comprises tube 3, tube 4, tube 5, and the like, e.g., tube 3 comprising PCR reaction reagents, tube 4 comprising a linker, tube 5 comprising a primer, and the like. For example, linker 1 (D9-T) comprising an independent packaging useful for the construction of a third generation sequencing library, linker 2 comprising an independent packaging suitable for the construction of a second generation sequencing library, e.g., the ILLUMINA platform; the PCR amplification reagent can be selected from a common PCR amplification kit (containing taq enzyme) or a high-fidelity PCR amplification kit (containing high-fidelity enzyme, such as pfu), and can be selected from PCR amplification kits of companies such as Sammy fly, moke, beckman and the like.
By using the kit, libraries suitable for various sequencing platforms can be efficiently constructed, including but not limited to the second generation sequencing platform and the third generation sequencing platform.
Example 2
This example provides the use of the kit of example 1 in library construction. In this example, 4 parallel experiments were performed, wherein the used samples were F4, F5, F6, and F7 genomes, and the genome DNA had to be preliminarily evaluated for genome quality before fragmentation to ensure that the genome was present in a solvent free of metal ion chelators or other salts, and the genome integrity was detected by gel electrophoresis. The specific steps of library construction are as follows:
1. genomic DNA fragmentation, end repair and dA tail addition
This step fragments the DNA while filling in the ends of the fragmented DNA, phosphorylates it at the 5 'end and adds a dA tail at the 3' end.
The reaction system was configured in a PCR tube as shown in table 1:
TABLE 1
H2O | 14ul |
End Prep Mix | 4ul |
DNA(25ng/ul) | 2ul |
Total | 20ul |
The PCR tube was placed in a PCR apparatus, and the reaction conditions were set as shown in Table 2:
TABLE 2
Temp | Time |
105 deg.C thermal cover | On |
32℃ | 15-20min |
65℃ | 10min |
4℃ | Hold |
The reaction was immediately carried out to the next step.
2. Joint connection
After the reaction of step 1, a linker ligation system was prepared in a PCR tube as shown in Table 3:
TABLE 3
Components | Volume of |
Product of |
20ul |
Joint 1 (concentration 15 uM) | 5ul |
Ligation Mix(NEB M0367S) | 25ul |
Total | 50ul |
The reaction conditions are as follows: standing at room temperature for 15min.
3. Purification of
The reaction product was purified using VAHTS DNA Clean Beads, the purification procedure is as follows:
1) The adaptor-ligated system was transferred to a 1.5mL EP tube, 0.8X (40. Mu.L) magnetic beads were added, and the mixture was pipetted and mixed 10 times, and allowed to stand at room temperature for 3min.
2) Place 1.5mL of EP tube on magnetic stand, let stand for 2-3min, and remove the supernatant.
3) The beads were washed on the shelf using 200 μ L of 80% ethanol freshly prepared.
4) After removal of the ethanol, it was centrifuged instantaneously, placed on a magnetic stand and removed with a 10 μ L gun.
5) And opening the cover and drying the magnetic beads for about 5-10min until the ethanol is completely volatilized.
6) Adding 22 mu LddH 2 Eluting with O, mixing, standing at room temperature for 3min, placing on magnetic frame for 3min, recovering 20 μ L product, adding 1.2x (24 ul) magnetic bead, blowing and mixing for 10 times, and standing at room temperature for 3min.
7) Place 1.5mL of EP tube on magnetic rack, stand for 2-3min, remove supernatant.
8) Freshly prepared 200. Mu.L of 80% ethanol was used for bead wash on the shelf.
9) After removal of the ethanol, it was centrifuged instantaneously, placed on a magnetic stand again and removed with a 10 μ L gun.
10 Uncapping and drying the magnetic beads for about 5-10min until the ethanol is completely volatilized.
11 Add 12 μ LddH 2 Eluting with O, mixing, standing at room temperature for 3min, placing on magnetic frame for 3min, and recovering 13 μ L product.
mu.L of the recovered product (ligation product) was subjected to labchip assay, and the assay results are shown in FIG. 1, in which FIG. 1 shows that the major band of 4 samples after the linker addition was 320bp. From the results of 4 samples, it can be seen that the End Prep Mix can reduce the stable disruption of genome to a specific size fragment.
4. Library amplification
And carrying out PCR amplification on the recovered product. The PCR amplification reaction system was prepared as shown in table 4:
TABLE 4
Components | Volume of |
Amplification module | 12.5ul |
Ligation product | 11.5ul |
Forward primer (10 uM) | 0.5ul |
Reverse primer (10 uM) | 0.5ul |
In total | 25ul |
A forward primer: 5' AATGATACGGGCGACCACGAAGATTACACTCTTTCCTACGACCGACGACGCTCTTCCGATCT-
Reverse primer: 5 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3' (SEQ ID NO: 7)
The PCR amplification reaction conditions are shown in Table 5:
TABLE 5
5. Purification of
The reaction product was purified using VAHTS DNA Clean Beads:
(1) After the Beads were equilibrated to room temperature, VAHTS DNA Clean Beads were vortexed and mixed well.
(2) The ligated PCR system (25 ul) was transferred to a 1.5mL EP tube, and 1.8X (45 ul) magnetic beads were added thereto, and the mixture was pipetted and mixed 10 times, and allowed to stand at room temperature for 3min.
(3) Place 1.5mL of EP tube on magnetic stand, let stand for 2-3min, and remove the supernatant.
(4) The magnetic beads were washed on the shelf with freshly prepared 200ul 80% ethanol.
(5) Repeat step 4
(6) After removing the ethanol, the mixture was centrifuged instantaneously, placed on a magnetic stand again, and then removed with a 10ul gun.
(7) And opening the cover and drying the magnetic beads for about 5-10min until the ethanol is completely volatilized.
(8) 1.5ml was removed from the magnetic rack and eluted: adding 22ul ddH2O, mixing by vortex oscillation or gently blowing with a pipette, standing at room temperature for 3min, centrifuging EP tube for a short time, standing in a magnetic frame, standing until the solution is clear,
20ul of the supernatant was removed to a new 1.5ml EP tube.
1ul of purified and purified product after PCR amplification is taken for labchip detection, the detection result is shown in figure 2, and figure 2 shows that the main band of the product after 4 samples are added with joints for PCR amplification is 320bp. Because the primer used is matched with the sequence in the joint in a complementary way, the segment can be effectively amplified according to the amplification result, so the joint can be effectively added by using the Ligation Mix, and the segment size is consistent after the joint is interrupted by 4 samples.
6. Quantitative sequencing on machine
The quantitatively qualified library was used for sequencing by the Illumia sequencer.
In the above related steps, preferably, the amount of template DNA is in the range of 15ng-50ng, OD260/OD280=1.8-2.0. The interruption range is 150-200bp
Recommended joint Adapter: the Input DNA molar ratio is between 100 and 1. Excessive Adapter input may result in Adapter or Adapter Dimer residue; insufficient input will affect ligation efficiency and result in reduced library yield. Adapter working concentration 25uM, template molar number (pmol) ≈ Input DNA mass (ng)/[ 0.66. Input DNA average length (bp) ].
The amount of beads directly affects the lower limit of the length of DNA that can be purified. The higher the multiplier, the shorter the lower limit of the DNA length that can be purified; otherwise, the longer. For example: 1x magnetic beads can only purify DNA longer than 250bp efficiently, and shorter DNA can be lost in a large amount in the purification process; after increasing to 1.8x, 150bp DNA can be purified efficiently.
The eluted product can be stably stored for one week at 4 ℃; the product should be kept at-20 deg.C for long term storage to avoid unnecessary repeated freezing and thawing.
Example 3
This example provides the use of the kit of example 1 in library construction 2. In this example, 12 parallel experiments were performed, the used samples were N5, N6, N13, N14, N21, N22, N23, N24, O5, O6, O11 and O12 genomes, the quality of the genomes before fragmentation was preliminarily evaluated to ensure that the genomes were present in a solvent without metal ion chelating agent or other salts, and the genome integrity was checked by gel electrophoresis. The specific steps of library construction are as follows:
DNA fragmentation, end repair and dA tailing
This step fragments the DNA, filling in the fragmented DNA ends, phosphorylates at the 5 'end and adds a dA tail at the 3' end.
The reaction systems of different samples are the same, and as shown in Table 6, the reaction time at 32 ℃ is different, namely 20min,22min,25min,30min,35min and 40min.
The sample types and corresponding reaction times were as follows:
N5:50ng,32℃20min;N6:50ng,32℃20min;
N13:50ng,32℃22min;N14:50ng,32℃22min;
N21:50ng,32℃25min;N22:50ng,32℃25min;
N23:50ng,32℃35min;N24:50ng,32℃35min;
O5:50ng,32℃30min;O6:50ng,32℃30min;
O11:50ng,32℃40min;O12:50ng,32℃40min。
TABLE 6
H2O | 14ul |
End Prep Mix | 4ul |
DNA(25ng/ul) | 2ul |
Total | 20ul |
The PCR tube was placed in a PCR apparatus, and the reaction conditions were set as shown in Table 7: :
TABLE 7
Temp (temperature) | Time (Time) |
105 ℃ Heat cover | On |
32℃ | (20,22,25,30,35,40)min |
65℃ | 10min |
4℃ | Hold |
The reaction was immediately carried out to the next step.
Products after the reaction are detected by using Labchip, the detection result is shown in figure 3, and the highest-lowest main peaks in the detection result curve graph correspond to N5, N6, N13, N14, N21, N22, N23, N24, O5, O6, O11 and O12. As can be seen from the graph 3, the breaking time is 20min-40min, the breaking temperature is 32 ℃, the fragmenting enzyme effectively breaks the genome DNA, the broken fragment main band is about 280bp, the different breaking time has little influence on the breaking size of the genome breaking fragment, and the size fluctuation is about 20bp.
2. Joint connection
After the reaction of step 1, a linker ligation system was prepared in a PCR tube as shown in Table 8:
TABLE 8
Reaction conditions are as follows: standing at room temperature for 15min.
3. Purification of
The reaction product was purified using VAHTS DNA Clean Beads, the purification procedure was as follows:
12 Transfer the linker-ligated system to a 1.5mL EP tube, add 0.8X (40. Mu.L) magnetic beads, blow and mix well 10 times, and leave it at room temperature for 3min.
13 A 1.5mL EP tube was placed on a magnetic stand, allowed to stand for 2-3min, and the supernatant was removed.
14 Magnetic bead on-shelf washing was performed with 200 μ L80% ethanol in fresh configuration.
15 ) remove the ethanol, centrifuge instantaneously, place on magnetic rack, and remove with 10 μ L gun.
16 Uncapping and drying the magnetic beads for about 5-10min until the ethanol is completely volatilized.
17 Add 22. Mu. LddH 2 Eluting with O, mixing, standing at room temperature for 3min, placing on magnetic frame for 3min, recovering 20 μ L product, adding 1.2x (24 ul) magnetic bead, blowing and mixing for 10 times, and standing at room temperature for 3min.
18 1.5mL of EP tube was placed on a magnetic rack, allowed to stand for 2-3min, and the supernatant was removed.
19 Magnetic bead on-shelf washing was performed with 200 μ Ι _ 80% ethanol in fresh configuration.
20 ) remove the ethanol, centrifuge instantaneously, place on magnetic rack, and remove with 10 μ L gun.
21 Uncapping and drying the magnetic beads for about 5-10min until the ethanol is completely volatilized.
22 Add 12 μ LddH 2 And (4) eluting by taking the mixture off a shelf, fully and uniformly mixing the mixture, standing the mixture for 3min at room temperature, putting the mixture on a magnetic shelf for 3min, and recovering 10 mu L of product.
The recovered product can be stably stored at 4 ℃ for one week. The long-term preservation is carried out at-20 ℃, and unnecessary repeated freezing and thawing is avoided.
4. Sequence Capture, sequencing on machine
The qualified library was quantitated for sequence capture and sequenced using a single molecule sequencer.
Probes (SEQ ID NO: 8) were immobilized on the chip using the method disclosed in the specification of published patent application CN201510501968.7, and the prepared library was diluted with 3 XSSC hybridization solution and then hybridized with the probes immobilized on the chip. The number of hybridizations of the linker sequence to the probe was then determined from the signal of Cy 3.
SEQ ID NO:8:5’-TTTTTTTTTTTCCTTGATACCTGCGACCATCCAGTTCCACTCAGATGTGTATAAGAGACAG-3’。
The procedure for library chip hybridization was as follows:
(1) Chip selection: the base glass of the chip used is an epoxy-modified glass chip of SCHOTT corporation, and the probe shown in Seq ID No.4 is fixed by a method of reacting an amino group on the probe with an epoxy group on the chip surface, for example, a method disclosed in published patent application No. CN 201811191581589.2, and the density of the fixed probe in a 110 × 110 μ M area is about 18000Dot/FOV, that is, 18000 bright spots in a 110 × 110 μ M field of view.
(2) Preparing a hybridization solution: as shown in Table 3, the hybridization solution was prepared using 20 XSSC buffer (Sigma, # S6639-1L) at a final concentration of 3 XSSC, and the library at a final concentration of 1nM in a total volume of 40. Mu.L. The prepared hybridization solution is denatured at 95 ℃ for 2min and rapidly cooled on ice.
TABLE 3
20 XSSC buffer | 6μL |
Libraries | Final concentration of 1nM |
Enucleated acid water | Make up to 40. Mu.L |
(3) And (3) quickly loading the denatured hybridization solution onto a chip, and then placing the chip at 55 ℃ for 30min to hybridize the library and the probe on the surface of the chip.
(4) The chip was washed sequentially with 3 XSSC, 1 XSSC, and 0.1 XSSC.
Sequencing the library captured by hybridization using the GenoCare third generation sequencing platform.
The above-described preferred embodiments are not intended to limit the scope of the present invention, and any modifications, equivalents, improvements, etc. made within the spirit and principle of the present invention should be included in the scope of the present invention. Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and not to be construed as limiting the present invention, and those skilled in the art can make changes, modifications, substitutions and alterations to the above embodiments within the scope of the present invention.
Sequence listing
<110> Shenzhen Zhenzhiji Biotech Limited
<120> nucleic acid sample processing method, sequencing method and kit
<130> PI2019005
<150> 2019107411271
<151> 2019-08-12
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(20)
<223> linker sequence
<400> 1
agatgtgtat aagagacagt 20
<210> 2
<211> 54
<212> DNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(54)
<223> linker sequence
<400> 2
actgtctctt atacacatct gagtggaact ggatggtcgc aggtatcaag gatt 54
<210> 3
<211> 51
<212> DNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(51)
<223> linker sequence
<400> 3
ctgtctctta tacacatctg agtggaactg gatggtcgca ggtatcaagg a 51
<210> 4
<211> 33
<212> DNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (32)..(32)
<223> S2C
<400> 4
acactctttc cctacacgac gctcttccga tct 33
<210> 5
<211> 31
<212> DNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(31)
<223> linker sequence
<400> 5
gatcggaaga gcacacgtct gaactccagt c 31
<210> 6
<211> 58
<212> DNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(58)
<223> primer sequences
<400> 6
aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatct 58
<210> 7
<211> 34
<212> DNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(34)
<223> primer sequences
<400> 7
gtgactggag ttcagacgtg tgctcttccg atct 34
<210> 8
<211> 61
<212> DNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(61)
<223> Probe sequence
<400> 8
tttttttttt tccttgatac ctgcgaccat ccagttccac tcagatgtgt ataagagaca 60
g 61
Claims (31)
1. A method of processing a DNA sample comprising fragmenting, end-repairing and tail-adding said DNA in a first pre-mix system to obtain a first product; the first pre-mix system comprises pre-mixed enzymes comprising a DNA-fragmenting enzyme, a polynucleotide kinase, and a DNA polymerase consisting of a Klenow fragment of DNA polymerase I and Taq DNA polymerase, and the ratio of the total enzyme activity units U of the DNA-fragmenting enzyme, the polynucleotide kinase, the Klenow fragment of DNA polymerase I, and Taq DNA polymerase in the first pre-mix system is 18;
the first premix system further comprises Mg 2+ And in the total reaction system of the fragmentation, end repair and dA-tail addition treatment, the Mg 2+ The concentration of (B) is 12mM to 15 mM.
2. The method of claim 1, wherein the DNA is not less than 5Kbp.
3. The method of claim 2, wherein the first product has a size of 100 to 400bp.
4. The method of claim 3, wherein the first product has a size of 100 to 300bp.
5. The method of claim 1, wherein the DNA is present in the first pre-mix system in a range of 10ng to 60ng.
6. The method according to claim 5, wherein the DNA is contained in an amount of 15ng to 50ng in the first premix system.
7. The method of any one of claims 1 to 6, wherein said Mg 2+ The concentration of (B) is 60mM to 100 mM.
8. The method of claim 7, wherein said Mg 2+ The concentration of (b) is 60mM to 75mM.
9. The method of claim 1, wherein the polynucleotide kinase is a T4 polynucleotide kinase.
10. The method of any one of claims 1 to 6, wherein the DNA fragmenting enzyme is present in the first pre-mix system in an amount at least 2 times greater than the polynucleotide kinase.
11. The method of any one of claims 1-6, further comprising providing at least one end of the first product with a predetermined sequence in a second pre-mix system to obtain a second product; the second pre-mix system includes the first pre-mix system and the preset sequence.
12. The method of claim 11, wherein the second pre-mix system further comprises a ligase.
13. The method of claim 12, wherein the ligase is T4 DNA ligase.
14. The method of claim 11, wherein the predetermined sequence is double-stranded DNA consisting of a first strand and a second strand that are complementary, and wherein the predetermined sequence has at least one single-stranded end.
15. The method of claim 14, wherein the 5' end of the first strand has a phosphate group.
16. The method of claim 14, wherein the 3' end of the second strand does not have a hydroxyl group.
17. The method according to any one of claims 14 to 16, wherein 80 ℃ and/or more (Tm 1-Tm 2) and/or more 10 ℃ and 90 ℃ and/or more Tm1 and/or more 50 ℃ and Tm1 is a dissolution temperature of the first strand and Tm2 is a dissolution temperature of the second strand.
18. The method of claim 17, wherein the Tm1 is 71 ℃ and the Tm2 is 45.6 ℃.
19. The method of claim 17, wherein the predetermined sequence is selected from the group consisting of SEQ ID NOs: 1 and SEQ ID NO: 2. SEQ ID NO:1 and SEQ ID NO:3 and/or SEQ ID NO:4 and SEQ ID NO:5.
20. a method for sequencing DNA comprising:
treating said DNA by the method of any one of claims 1-10 to obtain said first product;
treating said first product by a process according to any one of claims 11 to 19 to obtain said second product;
attaching the second product to the surface of a solid substrate and sequencing the second product to determine the sequence of at least a portion of the DNA.
21. The method of claim 20, wherein the second product is labeled with an optically detectable label.
22. The method of claim 21, wherein the second product is provided with a fluorescent molecule.
23. The method of any one of claims 20 to 22, wherein the solid substrate has a probe on its surface, and the second product is attached to the surface of the solid substrate via the probe, the probe having a length of 20 to 80nt.
24. The method of claim 23, wherein the predetermined sequence is a double-stranded DNA consisting of a first strand and a second strand that are complementary, and wherein the predetermined sequence has a single-stranded end that is located on the first strand.
25. The method of claim 24, wherein said first strand is fully complementary to said probe, and wherein said first strand is no longer than said probe.
26. The method of claim 25, wherein Tm2-5 ℃. Ltoreq.T.ltoreq.Tm 1-5 ℃, T being the reaction temperature for attaching the second product to the surface of the solid substrate, tm1 being the dissolution temperature of the first strand, and Tm2 being the dissolution temperature of the second strand.
27. The method of claim 26, further comprising denaturing the second product prior to attaching the second product to the surface of the solid substrate.
28. A kit for carrying out the method of any one of claims 1 to 19 or for carrying out the method of any one of claims 20 to 27, comprising the first pre-mix system.
29. The kit of claim 28, further comprising the second pre-mix system.
30. The kit of claim 29, for performing the method of any one of claims 20-27, further comprising a probe through which the second product is attached to the surface of the solid substrate, the probe being 20-80nt in length.
31. The kit of claim 30, wherein the probe is complementary to a first strand, the probe is not shorter than the first strand, the predetermined sequence is a double-stranded DNA consisting of the complementary first and second strands, the predetermined sequence has a single-stranded end, and the single-stranded end is on the first strand.
Priority Applications (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202310178386.4A CN116144735A (en) | 2019-08-12 | 2019-09-16 | Nucleic acid sample processing method, sequencing method and kit |
PCT/CN2020/108420 WO2021027810A1 (en) | 2019-08-12 | 2020-08-11 | Nucleic acid sample processing method, sequencing method and kit |
EP20852389.4A EP4015646B1 (en) | 2019-08-12 | 2020-08-11 | Nucleic acid sample processing method, sequencing method and kit |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201910741127 | 2019-08-12 | ||
CN2019107411271 | 2019-08-12 |
Related Child Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202310178386.4A Division CN116144735A (en) | 2019-08-12 | 2019-09-16 | Nucleic acid sample processing method, sequencing method and kit |
Publications (2)
Publication Number | Publication Date |
---|---|
CN112391442A CN112391442A (en) | 2021-02-23 |
CN112391442B true CN112391442B (en) | 2023-03-10 |
Family
ID=74603690
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201910868866.7A Active CN112391442B (en) | 2019-08-12 | 2019-09-16 | Nucleic acid sample processing method, sequencing method and kit |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN112391442B (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113046418A (en) * | 2021-04-02 | 2021-06-29 | 武汉博越致和生物科技有限公司 | 16S rDNA amplicon database building method for gestational diabetes intestinal flora detection |
Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105112408A (en) * | 2015-08-14 | 2015-12-02 | 深圳市瀚海基因生物科技有限公司 | Fixing method of targeted primer in single-molecule targeted sequencing, single-molecule targeted sequencing reagent box and application |
CN106283202A (en) * | 2016-09-23 | 2017-01-04 | 依科赛生物科技(太仓)有限公司 | A kind of supper-fast DNA library based on illumina secondary order-checking platform builds test kit |
CN106987905A (en) * | 2017-04-06 | 2017-07-28 | 深圳华大基因股份有限公司 | A kind of construction method and kit in BRCA1/2 genetic tests library |
CN107586835A (en) * | 2017-10-19 | 2018-01-16 | 东南大学 | A kind of construction method of sequencing library of future generation based on single-stranded joint and its application |
CN108251504A (en) * | 2018-01-17 | 2018-07-06 | 翌圣生物科技(上海)有限公司 | A kind of method and kit of supper-fast structure genomic DNA sequencing library |
CN109610006A (en) * | 2018-10-12 | 2019-04-12 | 深圳市瀚海基因生物科技有限公司 | The fixing means and chip of a kind of preparation method of chip, DNA or protein |
-
2019
- 2019-09-16 CN CN201910868866.7A patent/CN112391442B/en active Active
Patent Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105112408A (en) * | 2015-08-14 | 2015-12-02 | 深圳市瀚海基因生物科技有限公司 | Fixing method of targeted primer in single-molecule targeted sequencing, single-molecule targeted sequencing reagent box and application |
CN106283202A (en) * | 2016-09-23 | 2017-01-04 | 依科赛生物科技(太仓)有限公司 | A kind of supper-fast DNA library based on illumina secondary order-checking platform builds test kit |
CN106987905A (en) * | 2017-04-06 | 2017-07-28 | 深圳华大基因股份有限公司 | A kind of construction method and kit in BRCA1/2 genetic tests library |
CN107586835A (en) * | 2017-10-19 | 2018-01-16 | 东南大学 | A kind of construction method of sequencing library of future generation based on single-stranded joint and its application |
CN108251504A (en) * | 2018-01-17 | 2018-07-06 | 翌圣生物科技(上海)有限公司 | A kind of method and kit of supper-fast structure genomic DNA sequencing library |
CN109610006A (en) * | 2018-10-12 | 2019-04-12 | 深圳市瀚海基因生物科技有限公司 | The fixing means and chip of a kind of preparation method of chip, DNA or protein |
Also Published As
Publication number | Publication date |
---|---|
CN112391442A (en) | 2021-02-23 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN109415758B (en) | Tagmentation using adaptor-containing immobilized transposomes | |
CN107541546B (en) | Compositions, methods, systems, and kits for target nucleic acid enrichment | |
ES2254505T3 (en) | METHOD FOR AMPLIFICATION AND OPTIONAL CHARACTERIZATION OF NUCLEIC ACIDS. | |
CN110612351B (en) | Methods and compositions for preparing nucleic acid libraries | |
CN110129415B (en) | NGS library-building molecular joint and preparation method and application thereof | |
CN112626189A (en) | Short joint, double-index joint primer and double-index library construction system of gene sequencer | |
JP2005323607A (en) | Dna sequencing by stepwise ligation and cleavage | |
CN111321208B (en) | Library construction method based on high-throughput sequencing | |
CN110878298B (en) | rRNA capture probe and application thereof | |
CN112930405A (en) | Complex surface-bound transposome complexes | |
JPH0866200A (en) | Method for production of amplification reaction product of nucleic acid incapable of being established as later amplification target,diagnostic assay using said method and appropriate kit and container for practicing said method andassay | |
CN112226486B (en) | Library construction method for targeted enrichment of genome methylated DNA and application thereof | |
JP2022533916A (en) | Single-channel sequencing method based on autoluminescence | |
CN112410331A (en) | Linker with molecular label and sample label and single-chain library building method thereof | |
CN112391442B (en) | Nucleic acid sample processing method, sequencing method and kit | |
WO2015050501A1 (en) | Amplification paralleled library enrichment | |
WO1994016107A1 (en) | DNA SEQUENCING WITH Bst POLYMERASE | |
CN114657232A (en) | Universal blocking reagent for improving target capture efficiency and application thereof | |
CN116043337A (en) | DNA methylation marker screening kit and method | |
CN113337590A (en) | Second-generation sequencing method and library construction method | |
CN114807300A (en) | Application of single-primer multiple amplification technology in detection of fragmented rare characteristic nucleic acid molecules and kit | |
CN116144735A (en) | Nucleic acid sample processing method, sequencing method and kit | |
CN115715323A (en) | High-compatibility PCR-free library building and sequencing method | |
EP1275734A1 (en) | Method for random cDNA synthesis and amplification | |
CN112292460A (en) | Nucleic acid amplification method |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
REG | Reference to a national code |
Ref country code: HK Ref legal event code: DE Ref document number: 40044741 Country of ref document: HK |
|
GR01 | Patent grant | ||
GR01 | Patent grant |