CN112391401B

CN112391401B - Method for improving lipid yield of yarrowia lipolytica

Info

Publication number: CN112391401B
Application number: CN201910747616.8A
Authority: CN
Inventors: 王士安; 李家欣; 李福利
Original assignee: Qingdao Institute of Bioenergy and Bioprocess Technology of CAS
Current assignee: Qingdao Institute of Bioenergy and Bioprocess Technology of CAS
Priority date: 2019-08-14
Filing date: 2019-08-14
Publication date: 2022-09-27
Anticipated expiration: 2039-08-14
Also published as: CN112391401A

Abstract

The invention relates to the technical field of biology, in particular to a method for improving the grease yield of yarrowia lipolytica. A yarrowia lipolytica strain is taken as an original strain, and a CAG79599.1 coding gene YAIL 0-E16060 g is knocked out in a homologous recombination or CRISPR-Cas9 gene editing mode, so that the recombinant strain for improving the grease yield of the yarrowia lipolytica is obtained. The oil yield and the oil content of cells of the recombinant strain are improved by more than 24 percent compared with those of a control strain. The method provided by the invention can be used for constructing the high-yield oil yeast, and has wide application prospects in the fields of renewable energy, chemical industry, medicine and health care and the like.

Description

Method for improving lipid yield of yarrowia lipolytica

Technical Field

The invention relates to the technical field of biology, in particular to a method for improving the grease yield of yarrowia lipolytica.

Background

The microbial oil has important application value in the fields of renewable energy sources, chemical industry, medicines, health products and the like. The microbial oil is used as a raw material to produce renewable fuels such as biodiesel and biological aviation kerosene, and certain components of the microbial oil, such as eicosapentaenoic acid (EPA), can be developed into medical health products. Oleaginous yeasts are important hosts for the synthesis of microbial oils (Kumar D, Singh B, Korstad J. Recewable and sustaminatable Energy Reviews,2017,73: 654-. Yarrowia lipolytica (Yarrowia lipolytica) is a typical oleaginous yeast, and the lipid content of engineered bacteria is up to 80% of the dry cell weight (Xu P, Qiao K, Stephanopoulos G.Biotechnology and Bioengineering,2017,114(7): 1521-1530). Also, yarrowia lipolytica was identified by the food and drug administration (FAD) as a "generally recognized as safe bacterial species (GRAS)" and was a "first-class biosafety microorganism".

Yarrowia lipolytica has been used industrially in the production of citric acid and various proteases. In the aspect of oil products, the production of EPA by using yarrowia lipolytica is close to industrialization; the application of yarrowia lipolytica to produce renewable energy grease raw materials has been greatly improved, but the links of raw material utilization, strain fermentation, product purification and processing and the like need to be improved continuously to reduce the difference of economical efficiency with fossil raw materials. Most of the fats and oils synthesized by yarrowia lipolytica are neutral fats (triglycerides), and the proportion of phospholipids is small. However, hydrolysis products of phospholipases can produce signaling molecules that play an important role in the regulation of cellular functions, including lipid metabolism (Barman A, Gohain D, Bora U, et al. microbiological Research,2018,209: 55-69). However, the gene encoding phospholipase in yarrowia lipolytica has not been functionally identified. In the phospholipase family, phospholipase A ₂ (PLA ₂ ) Specifically hydrolyzing the sn-2 fatty acyl ester bond of the glycerophospholipid backbone to produce free fatty acids and lysophospholipids. This patent is directed to exploring yarrowia lipolytica PLA ₂ The application in regulating oil synthesis and improving oil yield.

Disclosure of Invention

The invention aims to provide a method for improving the oil yield of yarrowia lipolytica by knocking out a phospholipase gene.

In order to achieve the purpose, the invention adopts the technical scheme that:

a method for improving the oil yield of yarrowia lipolytica comprises the steps of taking yarrowia lipolytica as an initial strain, knocking out a CAG79599.1 encoding gene YAIL0_ E16060g by adopting homologous recombination or a CRISPR-Cas9 gene editing mode, and obtaining the yarrowia lipolytica for improving the oil yieldRecombinant strains of parent oil production; the gene YAIL0_ E16060g (PLA) ₂ The sequence of-3) is shown as SEQ ID NO. 1.

Further, yarrowia lipolytica po1g delta Ku70 is used as an original strain, a CAG79599.1 encoding gene YAIL0_ E16060g is knocked out in a homologous recombination mode, and the strain po1g delta Ku70 delta P3 is obtained;

or, taking yarrowia lipolytica po1G-G3 as an original strain, knocking out the CAG79599.1 encoding gene YAIL0_ E16060G in a CRISPR-Cas9 gene editing mode, and obtaining the strain po1G-G3 delta P3.

In a still further aspect of the present invention,

1) constructing a homologous recombination knockout plasmid pYLEX-URA delta P3;

2) the resulting plasmid pYLEX-URA. DELTA.P 3 transformed yarrowia lipolytica strain po1 g. DELTA.Ku 70;

3) obtaining PLA by screening transformant through uracil auxotroph plate ₂ -3 knock-out strain, i.e. recombinant strain po1g Δ Ku70 Δ P3.

In a still further aspect of the present invention,

1) constructing CRISPR-Cas9 gene editing knockout plasmid pCAS1y-URA delta P3;

2) plasmid pCAS1y-URA Δ P3 transformed yarrowia lipolytica strain po 1G-G3;

3) screening transformant by uracil auxotroph plate to obtain PLA ₂ -3 knock-out strain, i.e. recombinant strain po 1G-G3. delta.P 3.

Constructing a homologous recombination knockout plasmid pYLEX-URA delta P3, using the plasmid pYLEX-URA as a skeleton template, using a primer P1-F/P1-R to amplify a skeleton DNA fragment, then using primers UP-F/UP-R and down-F/down-R, using yarrowia lipolytica po1g genome DNA as a template, and respectively amplifying an upstream fragment (UP) and a downstream fragment (down) of a PLA2-3 gene; assembling the obtained framework DNA fragment and the up fragment by adopting a Gibson Assembly method to obtain a plasmid containing an upstream fragment, and then amplifying by using a primer p2-F/p2-R by using the plasmid containing the upstream fragment as a template to obtain a new plasmid framework; assembling the new framework and the down fragment to obtain a PLA2-3 knockout plasmid pYLEX-URA delta P3.

The knockout plasmid pCAS1y-URA delta P3 is constructed by adopting primers P-F/P3-R and pP3-F/pP-R, adopting the plasmid pCAS1y-URA as a template, amplifying two DNA fragments, and assembling by adopting a Gibson Assembly method to obtain the knockout plasmid pCAS1y-URA delta P3.

The recombinant strain of yarrowia lipolytica with the PLA2-3 gene inactivated and the oil yield increased is obtained according to the method.

The PLA2-3 gene inactivated yarrowia lipolytica recombinant strain is applied to the production of microbial oil.

A homologous recombination vector containing a PLA2-3 gene capable of being inactivated is a knockout plasmid pYLEX-URA delta P3 or a knockout plasmid pCAS1y-URA delta P3.

The invention has the advantages that:

a method for improving the lipid yield of yarrowia lipolytica by knocking out phospholipase genes. The method relates to the application of homologous recombination or CRISPR-Cas9 gene editing technology to knock out the CAG79599.1 coding gene YAIL0_ E16060g (PLA) ₂ -3, SEQ ID NO:1) to increase yarrowia lipolytica lipid production. The method is realized by knocking out phospholipase gene PLA ₂ -3, the fatty acid composition and the yield of yarrowia lipolytica are altered, wherein both the oil yield and the oil content of the cells are increased by more than 24% compared to the control strain. The method provided by the invention can be used for constructing the high-yield oil yeast, and has wide application prospects in the fields of renewable energy, chemical industry, medicine and health care and the like.

Drawings

FIG. 1 is a graph of the differential expression analysis of the yarrowia lipolytica PLA2 gene provided in the examples of the invention.

FIG. 2 shows a PLA knock-out provided by an embodiment of the present invention ₂ -3 Gene vs other PLA ₂ And analyzing the influence of the gene expression amount.

FIG. 3 shows the effect of the knockout of PLA2-3 gene on strain growth. A: strains po1g Δ Ku70 and po1g Δ Ku70 Δ P3; b: strains po1G-G3 and po 1G-G3. delta. P3.

FIG. 4 shows the effect of the knocked-out PLA2-3 gene on the oil production of a strain. A: strains po1g Δ Ku70 and po1g Δ Ku70 Δ P3; b: strains po1G-G3 and po 1G-G3. delta. P3.

FIG. 5 is a graph showing the effect of knocking out a PLA2-3 gene on fatty acid composition, according to an embodiment of the present invention. A: strains po1g Δ Ku70 and po1g Δ Ku70 Δ P3; b: strains po1G-G3 and po 1G-G3. delta. P3.

FIG. 6 is a High Performance Thin Layer Chromatography (HPTLC) analysis of the phospholipid fraction provided in the examples of the present invention.

FIG. 7 shows the effect of PLA2-3 gene of the knockout strain po1g Δ Ku70 on strain stress tolerance. P < 0.001.

FIG. 8 shows the effect of the PLA2-3 gene of the knockout strain po1G-G3 on strain stress tolerance provided in the examples of the present invention. P < 0.001.

Detailed Description

The following examples are presented to further illustrate embodiments of the present invention, and it should be understood that the embodiments described herein are for purposes of illustration and explanation only and are not intended to limit the invention.

Examples

1. Materials and methods

1.1 strains and culture conditions

The yarrowia lipolytica starting strain used in the examples was po1g (MATa, leu2-270, URA3-302:: URA3, xpr2-3) available from Yeaster Biotech Co., Ltd. Strains po1G Δ Ku70 and po1G-G3 were obtained by: the po1g delta Ku70 strain is obtained by knocking out a Ku70 gene by using po1g as an initial strain and adopting a homologous recombination gene knockout mode; strain po1G-G3 was obtained by high expression of yarrowia lipolytica endogenous genes DGAT1, ACC1 and SCD genes (Tai M, Stephanopoulos G.Metabolic Engineering,2013,15: 1-9; Qiao K, Imam Abidi SH, Liu H, Zhang H, Chakraborty S, Watson N, Ajikumar PK, Stephanopoulos G.Metabolic Engineering,2015,29: 56-65).

Yarrowia lipolytica was cultured at 28 ℃ and 250rpm in the following medium:

YPD liquid medium: 20g/L of glucose, 20g/L of peptone and 10g/L of yeast extract; used for routine culture.

Uracil auxotrophic medium: 2% glucose, 0.8% Ura minus media, 1.5% agar, adjusting pH to 5.5 with KOH; and (4) screening the recombinant strain.

Leucine auxotrophic medium: 2% glucose, 0.8% Leu minus media, 1.5% agar, adjusting pH to 5.5 with KOH; the recombinant strain screening method is used for recombinant strain screening.

DB Medium: 5% of glucose, 0.6% of yeast extract, 0.6% of monopotassium phosphate, 0.15% of magnesium sulfate, 0.33% of disodium hydrogen phosphate dodecahydrate, high-pressure steam sterilization at 115 ℃ for 30min, 0.225% of ammonium sulfate, 0.0015 per mill of vitamin B1, 0.02 per mill of uracil and 0.1 per mill; used for oil production culture.

1.2 vector construction

Plasmid vectors were constructed using the Gibson Assembly method, all assembled fragments were obtained using the PCR amplification method (table 1), and the plasmid backbone was derived from the pYLEX plasmid (yeaster Biotech co., Ltd). All PCR amplifications used KAPA HiFi high fidelity DNA polymerase, the amplification system was 25ul (2 XKAPA Mix,12.5 ul; 10uM primers 0.75ul each; template 1 ul; water was added to 25ul) to obtain each DNA sequence. The amplification conditions were: pre-denaturation at 95 ℃ for 3 min; denaturation at 98 deg.C for 20 s, annealing at 60-72 deg.C for 15s, and extension at 72 deg.C, wherein the extension time is calculated according to 15s per kb, and the number of cycles is 29-31; extension at 72 ℃ for 8 min.

The plasmid pYLEX-URA is obtained by replacing LEU2 gene on pYLEX plasmid with URA3 gene by Gibson Assembly method; the obtained plasmid pYLEX-URA is used as a framework to construct a homologous recombinant plasmid pYLEX-URA delta P3 for knocking out the PLA2-3 gene of the po1g delta Ku70 strain.

The specific construction process is as follows:

firstly, a backbone DNA fragment with AMP and URA selection markers is obtained by amplification by using p1-F and p1-R primers and pYLEX-URA plasmid as a template. Then, the upstream fragment (UP) and the downstream fragment (down) of the PLA2-3 gene were amplified respectively using UP-F and UP-R primers and down-F and down-R primers, using yarrowia lipolytica starting strain po1g genomic DNA as a template (see Table 1 for the primers).

After assembling the backbone with the up fragment Gibson to obtain a plasmid containing the upstream fragment, the plasmid was used as a template and amplified with p2-F and p2-R primers to obtain a new backbone. Assembling the new framework and the down fragment Gibson, converting into Escherichia coli competence Trans-T1, and carrying out colony PCR and sequencing verification to obtain PLA2-3 knockout plasmid pYLEX-URA delta P3.

TABLE 1 PCR primers used for plasmid construction

Constructing a knock-out plasmid pCAS1y-URA delta P3, knocking out PLA2-3 gene of a strain po1G-G3 by using CIRPR-Cas 9 technology,

the method specifically comprises the following steps: the CIRSP-Cas 9 plasmid pCAS1y was provided at no cost by the institute for physiological and biochemical studies of Shanghai plants, Chinese academy of sciences. The knock-out plasmid pCAS1y-URA delta P3 was constructed by the Gibson Assembly method, as follows: two DNA fragments are amplified by using P-F and P3-R primers and pP3-F and pP-R primers in the table 1 and pCAS1y-URA plasmid as a template, assembled by adopting a Gibson Assembly method, and subjected to colony PCR and sequencing verification to obtain a knockout plasmid pCAS1y-URA delta P3.

1.3 Yeast transformation

The recombinant plasmid pYLEX-URA. DELTA.P 3 was linearized with Not I restriction enzyme, and the digested fragment was recovered using a PCR product purification kit. The linearized recombinant plasmid pYLEX-URA delta P3 or the circular plasmid pCAS1y-URA delta P3 was transformed into yarrowia lipolytica by the LiAc transformation method, respectively, the transformation system is shown in Table 2, and the method steps are described as follows:

TABLE 2 yarrowia lipolytica transformation System

(1) The components were added according to the transformation system of table 1;

(2) carrying out vortex oscillation after water bath at 30 ℃ for 1h, and carrying out heat shock at 39 ℃ for 10 min;

(3) directly coating the mixed solution of the transformation system on a URA-minus screening plate, and culturing at 28 deg.C for 2-4 days.

Homologous recombination knockout plasmid pYLEX-URA delta P3 is transformed into yarrowia lipolytica strain po1g delta Ku70, and transformants are screened by uracil auxotroph plates to obtain PLA ₂ -3 knock-out strain, i.e. recombinant strain po1g Δ Ku70 Δ P3. CRISPR-Cas9 gene editing knockout plasmid pCAS1y-URA delta P3 is transformed into yarrowia lipolytica strain po1G-G3, transformants are screened by uracil auxotroph plate, and PLA is obtained ₂ -3 knock-out strain, i.e. recombinant strain po 1G-G3. delta.P 3. The genomic and phenotypic assay analysis was performed on each recombinant strain obtained above.

1.4 extraction and quantitative analysis of RNA

The Total RNA Extraction Reagent method of Nanjing Novozam biotechnology, Inc. is used to extract RNA by TRIzol separation. Yarrowia lipolytica strains were grown in 50mL of DB medium with initial OD600 adjusted to 0.15, in triplicate, in a shaker at 28 ℃ and 250 rpm. 2mL of the sample was taken at 72 hours, 96 hours and 120 hours, centrifuged at 6500rpm for 10min, and the cells were collected and ground with liquid nitrogen. An appropriate amount of the powder was taken into a 1.5mL EP tube, and 1mL TRIzol was quickly added to the EP tube. Add 200. mu.L chloroform, shake well for 15s, ice-wash for 5min, centrifuge at 14000 Xg for 16min at 4 ℃ and take the supernatant into a new 1.5mL EP tube. Adding 500 μ L isopropanol into EP tube, mixing, standing on ice for 10min, 14000 Xg, and centrifuging at 4 deg.C for 10min to obtain small piece of RNA precipitate. The supernatant was decanted, the RNA pellet washed with 1mL 75% ethanol-DEPC water, 7500 Xg, centrifuged at 4 ℃ for 5min, decanted, and washed again. After the supernatant was removed, the mixture was left to stand at room temperature and naturally drained, and 50. mu.L of RNase-Free Water was added to dissolve RNA. Use of

II Q RT Supermix for qPCR (+ gDNA wiper) reverse transcription kit for RNA reverse transcription. The transcription level was measured using fluorescent quantitative PCR (qPCR), and the reaction system and reaction conditions are shown in tables 3 and 4.

TABLE 3.qPCR reaction System

TABLE 4.qPCR reaction conditions

1.5 acid thermal extraction of Total fats

(1) Collecting a fermentation culture solution of yarrowia lipolytica by a 50mL centrifuge tube, and carrying out high-speed centrifugation at 6000rpm for 5min to collect yeast cells;

(2) adding 10mL of 4M hydrochloric acid into 1g of wet thallus, uniformly oscillating, and shaking in a shaking table at 28 ℃ for about 1-2 h;

(3) boiling in water bath for 6-8min, immediately cooling at-20 deg.C for 30 min;

(4) adding chloroform: methanol was mixed well in 20mL at 1:1(V/V),

(5) separating the lower layer of chloroform, weighing the volume, adding equal volume of 0.15% sodium chloride, and centrifuging at 4000rpm for 10 min;

(6) the lower layer was transferred to a new weighed glass tube, the solvent phase was blow dried with a nitrogen blower, and the oil yield was calculated by weighing again.

1.6 fatty acid methylation

(1) To the glass tube was added 2.6mL of methanol: mixing 98:2(V/V) sulfuric acid solution, reacting at 85 ℃ for 3 hours, and cooling in a refrigerator;

(2) adding 1mL of saturated NaCl solution and 1mL of n-hexane, shaking, centrifuging at 5000rpm for 5min, sucking the supernatant into an EP tube, filtering with an organic phase filter membrane, and performing gas chromatography.

1.7 gas chromatography analysis of fatty acid composition

The fatty acid composition was analyzed by gas chromatography (Agilent 7890B-GC). And (3) chromatographic detection conditions: the chromatographic column is HP-5(30m × 0.32mm × 0.25 μm); sample introduction temperature: 250 ℃; detector temperature: 250 ℃; sample introduction volume: 1 mu L of the solution; the initial column temperature is 140 deg.C, maintained for 1min, heated to 180 deg.C at 10 deg.C/min, maintained for 2min, heated to 210 deg.C at 5 deg.C/min, maintained for 4min, and then heated to 250 deg.C at 5 deg.C/min, maintained for 4 min. The relative content of each fatty acid component is obtained by an area normalization method.

1.8 high Performance thin layer chromatography for phospholipid separation

And (3) carrying out extraction and drying on the oil by using chloroform: methanol: the acetic acid solution was dissolved in 1:1:0.1(V/V) to a uniform concentration of 100 μ g/mL. The phospholipid developing agent adopts chloroform: methanol: water: triethylamine 35:35:7:35(V/V), and the silica gel plate was used without treatment. And loading 1 mu L of the solution, and putting the solution into a chromatographic bar filled with a developing agent for about 1h after the solvent is completely volatilized. And (3) performing color development by using an anisaldehyde color development agent spray plate, and heating in a 120 ℃ oven for 15min to finish the color development.

1.9 cellular stress tolerance assay

All solid plates for detecting the pressure tolerance of yarrowia lipolytica are based on YPD solid culture medium, and pressure factors or pressure conditions are respectively added. 9% NaCl medium: 9% sodium chloride solids were added to YPD medium; 15% KCl medium: 15% potassium chloride solids were added to YPD medium; pH11 medium: adjusting the pH of the YPD medium to 11 by using potassium hydroxide; 5mM H ₂ O ₂ Culture medium: 5mM filtered H was added to YPD medium ₂ O ₂ (ii) a 3% Ethanol medium: adding 3% filtered ethanol to YPD medium; 6% DMSO medium: 6% DMSO was added to YPD medium. The above culture medium is sterilized directly with solid additive, and sterile filtered with liquid additive except dimethyl sulfoxide (DMSO).

Seeds were inoculated into 20mL YPD liquid medium from a freezer at-80 ℃ overnight for activation, and transferred to 20mL YPD liquid medium for culture. Selecting yeast cells in exponential growth phase, and measuring OD ₆₀₀ The number of cells was estimated, and the cells were spread on YPD plates and YPD plates with various pressures, each of which was made in triplicate, and cultured at 28 ℃ until colonies grew, and the number of colonies was counted and the survival rate was calculated.

2. Results and analysis

2.1 differential expression of the yarrowia lipolytica PLA2 Gene

From the genome of yarrowia lipolytica strain CLIB122, 6 genes annotated as PLA2 were retrieved (Table 5), but the function and application of these genes were not studied.

TABLE 5 yarrowia lipolytica PLA2 gene

As can be seen from the above 1.4RNA extraction and quantitative analysis, the 6 PLA were detected by fluorescent quantitative PCR ₂ Relative expression levels of genes (FIG. 1). PLA in the starting Strain po1g ₂ The expression level of the-3 gene is highest, and the other 5 PLA genes ₂ Expression level of Gene relative to PLA ₂ The-3 genes are all very low, PLA ₂ The expression level of the-3 gene can reach 60 times of that of other genes. Based on this presumption, PLA ₂ The-3 gene may play an important role in lipid metabolism of yarrowia lipolytica.

2.2 knockouts of PLA ₂ Analysis of Effect of-3 Gene on expression level of other genes

Using Ku70 gene deletion strain po1g delta Ku70 as an original strain, and knocking out PLA by adopting a homologous recombination method ₂ -3 genes, resulting in po1g Δ Ku70 Δ P3 strain. The quantitative fluorescence PCR was carried out for the strains po1 g. delta. Ku70 and po1 g. delta. Ku 70. delta. P3 in accordance with the procedure described in 1.4, and 6 PLA were detected ₂ Relative expression amount of gene. As is clear from FIG. 2, in the knockout strain po1 g. delta. Ku 70. delta. P3, PLA was present ₂ The expression level of the-3 gene is close to zero, and the expression levels of other genes are not significantly different from that of the strain po1g delta Ku70, which indicates that other 5 PLA genes are similar to the expression level of the-3 gene ₂ Gene uncompensated PLA ₂ -3 knock-out effect of gene.

2.3 Effect of knockout of PLA2-3 Gene on growth and oil production of strains

Growth conditions of the strains po1G delta Ku70 and po1G delta Ku70 delta P3 and the strains po1G-G3 and po1G-G3 delta P3 are respectively measured, and as shown in FIG. 3, the PLA2-3 gene is knocked out, so that the strain growth is hardly influenced. The method specifically comprises the following steps:

the oil production of strains po 1G. delta. Ku70 and po 1G. delta. Ku 70. delta. P3 and of strains po1G-G3 and po 1G-G3. delta. P3 were determined in the manner described above under 1.5, 1.6 and 1.7, respectively, using DB oil-producing medium, under shake flask conditions where the oil content of strain po 1G. delta. Ku 70. delta. P3 was 133. + -. 1.57mg/G DCW, the oil content of control strain po 1G. delta. Ku70 was 102. + -. 0.23mg/G DCW, and the oil content of knock-out strain po 1G. delta. Ku 70. delta. P3 was increased by 30% compared to the control strain (FIG. 4A). The oil yield of the strain po1g delta Ku70 delta P3 is 0.42 +/-0.00 g/L, which is increased by 68 percent compared with the control strain po1g delta Ku70(0.25 +/-0.01 g/L). The fat content of the knockout strain po1G-G3 delta P3 is 298 +/-16.7 mg/G DCW, the fat content of the control strain po1G-G3 is 234 +/-21.2 mg/G DCW, and the fat content of the knockout strain po1G-G3 delta P3 is increased by 27% compared with that of the control strain (figure 4B). The oil yield of the knockout strain po1G-G3 delta P3 is 4.78 +/-0.12G/L, the oil yield of the control strain po1G-G3 is 3.84 +/-0.38G/L, and the oil yield of the knockout strain po1G-G3 delta P3 is increased by 24% compared with that of the control strain.

2.4 Effect of knocking out PLA2-3 Gene on fatty acid composition

Changes in the fatty acid composition of strains po1G Δ Ku70 and po1G Δ Ku70 Δ P3, and strains po1G-G3 and po1G-G3 Δ P3 were examined by gas chromatography as described in 1.7 above (fig. 5). According to significance analysis, the strains po1g delta Ku70 delta P3 and po1g delta Ku70 have significant changes in the content of C16:0, C18:1 and C18:2 fatty acid components. The content of C16:0 in the control bacterium po1g delta Ku70 is 8.34 percent, while the content in the knockout bacterium po1g delta Ku70 delta P3 is 10.64 percent, which is improved by 27.58 percent; the content of C18:1 is increased from 47.61% to 54.77%, and the content is increased by 15.04%; the C18:2 is reduced from 29.21% to 21.49%, and the content is reduced by 26.43%. As a result of comparing the fatty acid compositions of strains po1G-G3 and po 1G-G3. delta. P3, it was found that PLA was knocked out ₂ The-3 gene causes the significant reduction of C16:0 and C18:0, and the significant increase of C16:1 and C18:1, such as the increase of C16:1 from 6.03% to 9.80%, and the content is increased by 62.52%; the content of C18:0 is reduced from 13.84% to 8.08%, which is reduced by 41.62%.

2.5 Effect of the knockout PLA2-3 Gene on phospholipid composition

The phospholipid fraction of the total lipids of strains po1g Δ Ku70 and po1g Δ Ku70 Δ P3 was analyzed by High Performance Thin Layer Chromatography (HPTLC) in the manner described in 1.8 above (fig. 6). It can be seen that the composition of phospholipids is significantly changed in the control strain po1g Δ Ku70 and the knockout strain po1g Δ Ku70 Δ P3, with PG (phosphatidylglycerol), PE (phosphatidylethanolamine), and PI (phosphatidylinositol) being detected in the knockout strain, whereas the control strain is not. It was presumed that the amounts of the three phospholipids synthesized in the control strain were low, and the detection line of HPTLC could not be achieved. This result indicates that knocking out PLA2-3 gene not only changed the yield of neutral lipid but also changed the amount of synthesized phospholipid.

2.6 Effect of knockout of PLA2-3 Gene on Strain stress tolerance

The survival rates under pressure of strains po1G Δ Ku70 and po1G Δ Ku70 Δ P3, and of strains po1G-G3 and po1G-G3 Δ P3 were determined by the colony forming unit method in the manner described in 1.9 above (fig. 7 and 8). The results of the comparison of the two strains are similar, and both show that PLA is knocked out ₂ The-3 gene results in increased oxygen pressure tolerance, decreased osmotic pressure, ethanol, DMSO, and temperature tolerance of yarrowia lipolytica. In combination with the foregoing growth and oil production assay results, it can be seen that although PLA is knocked out ₂ The pressure tolerance of the-3 gene is reduced under certain conditions, but under the oil production condition, the biomass is not reduced, the oil production is also obviously improved, the oil yield and the oil content of cells are improved by more than 24 percent compared with those of a control strain, and the fact that the PLA2-3 gene is knocked out can effectively improve the oil production of yarrowia lipolytica.

>SEQ ID NO:1

PLA2-3 gene sequence

ATGAAATTCTCTCCACTTTTGCTGGCGACCGTGGGTCTGGCCCAGAGCTTCTATTCGCCCACCGACTCGTACGCGCCCGGGTCGGTCGACTGTCCCTCCAACTCCACCCAGATTGTGCGAAAGGGCGAGGGCCTTTCTTCGCAGGAACGAGAGTGGGTCCAGAACCGACACGAACAGACCCGACCGGAGCTGCTCAACTACCTGAAACGGGTGGGCTTTAAGTCGGTGGACCCGGACCAGTTCCTGGGCCAGGACACTAATATCACCATCGGACTGTCCTTTTCTGGAGGAGGATACAGAGCCATGTTGGCGGGAGCAGGCCAATTTGCGGCTCTGGACGCGCGAACACCCAACGCCACCGAACCGGGCCATGTGGGAGGTCTGGTCCAGGCCGCCACCTATCTGGTGGGTCTTTCGGGCGGAAACTGGATGGTGGGATCTGTGGTCATCAACAACTTCACCACCATTCCCGACCTGCAACACTCGTCCGACGTGTGGGACCTGGAACACTCCATGATCAACCCCGGCGGAATCAACATCTTCAAGACCGGCTCTTATTGGGACGACATCAACGACGACGTCAACGACAAGCAGCACGCCGGATACAACACCTCTTTCACCGACATCTGGGGCCGAGGTCTGTCGTACCAGTTCTTCAACGCTTCCAACACCGCCCGACTCACCTGGTCCGAGATCCAGAACTACGACCACTTCAAGAACCACTCTATGCCCTACCCCATTGTTGTGGCCGACGGCCGAGCCCCCGGAACCCGAATCATCTCCGGAAACTCCACCATTTTCGAGCTGGCCCCGTTCGAGGTCGGCTCCTGGGACCCCAATGTCTACTCCTTTGCCAAGACCGAGTGGCTGGGAACCAACATGACCAACGGCCGACCCAACGGAACCTGTGTGCATGGCTTTGACAACGCCGGTTTCATTGTGGGAACCTCTTCTTCCCTGTTCAACCAGTTCATTCTCCAGCTCAACTCCACCGGAGTAACCGGAGTGGTCTACGACCTGGCCCACTCTATCCTCAAGCGTCTGGATAAGGACTCGGACGATATCGCCATCTACTCGCCCAACCCCTTCAAGGGCATGTCCTACCTCGGCAACTCGTCCATTGCCCAAACCGAGTATCTGGATCTGGTCGACGGAGGAGAAGATGGACAGAATGTGCCCTACTACCCTCTGCTGCAGCCCGAGAGAGCCGTCGACGTGGTCATCTCCTACGACAACTCCGCCGACACCGACTTTAACTGGCCCAACGGAACCTCCGCTGTCCAGACATACCGACGACAGTTTGAGAACCAGGCCAATGGCACCATTTTCCCCTACGTGCCCGACGTGAACACATTCATCAATGAGAACCTGACTTCTCGACCCGCCTTCTTTGGCTGTGACGTGCAGAACATGACCTCGCTGGACAAGAACGGTTATACCGACGTCAACTCTTCCGCCGCCCTTCCCCCTCTCATTGTCTACATTGCTAACTACCCCTGGACCTTTTTCTCCAACACATCGACCATGTCCAAGCTGTCGTACAACAAGAAGGAGGTTGCCGGCATGATCGAGAACGGCTACTCCACCTCCACCCAGTTCAACGGAACCGTGGACCCCGACTGGCCTGTGTGTCTTGGCTGTGCTCTGCTCAAGCGAGAGGCCACCCGACGAAACCAGTCTCTGGGCTCTGACTGTGACAAGTGCTTCTCCAAGTACTGCTGGAACGGAAAGACTGACGATGATGCCGAAAAGGCTCTGAAGTTTGCTCCCGCCATCTATGCCAACGGCCCTAACGTTTCTTCCAACGCCTCAATTGGCCAGGCTTCGTCCACCTCCAAGCCCAAGAAGAACGGCGCCGAGGGTCTGGTTCCGGGTATGGCTGCCATTGCCATTGGTTTTGCCGCTCTTCTTATGTAA

(a) Sequence characteristics:

● length: 1917

● type: DNA sequence

● chain type: single strand

● topology: linearity

(b) Molecular type: DNA

(c) Suppose that: whether or not

(d) Antisense: whether or not

(e) The initial sources were: yarrowia lipolytica

The sequence characteristics are as follows: the amino acid coded by the gene contains Ser/Asp catalytic sites, and the coded product belongs to cytoplasmic PLA2 enzyme (cPLA 2).

Sequence listing

<110> institute of bioenergy and Process in Qingdao, China academy of sciences

<120> method for improving lipid yield of yarrowia lipolytica

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1917

<212> DNA

<213> yarrowia lipolytica (po1G-G3)

<400> 1

atgaaattct ctccactttt gctggcgacc gtgggtctgg cccagagctt ctattcgccc 60

accgactcgt acgcgcccgg gtcggtcgac tgtccctcca actccaccca gattgtgcga 120

aagggcgagg gcctttcttc gcaggaacga gagtgggtcc agaaccgaca cgaacagacc 180

cgaccggagc tgctcaacta cctgaaacgg gtgggcttta agtcggtgga cccggaccag 240

ttcctgggcc aggacactaa tatcaccatc ggactgtcct tttctggagg aggatacaga 300

gccatgttgg cgggagcagg ccaatttgcg gctctggacg cgcgaacacc caacgccacc 360

gaaccgggcc atgtgggagg tctggtccag gccgccacct atctggtggg tctttcgggc 420

ggaaactgga tggtgggatc tgtggtcatc aacaacttca ccaccattcc cgacctgcaa 480

cactcgtccg acgtgtggga cctggaacac tccatgatca accccggcgg aatcaacatc 540

ttcaagaccg gctcttattg ggacgacatc aacgacgacg tcaacgacaa gcagcacgcc 600

ggatacaaca cctctttcac cgacatctgg ggccgaggtc tgtcgtacca gttcttcaac 660

gcttccaaca ccgcccgact cacctggtcc gagatccaga actacgacca cttcaagaac 720

cactctatgc cctaccccat tgttgtggcc gacggccgag cccccggaac ccgaatcatc 780

tccggaaact ccaccatttt cgagctggcc ccgttcgagg tcggctcctg ggaccccaat 840

gtctactcct ttgccaagac cgagtggctg ggaaccaaca tgaccaacgg ccgacccaac 900

ggaacctgtg tgcatggctt tgacaacgcc ggtttcattg tgggaacctc ttcttccctg 960

ttcaaccagt tcattctcca gctcaactcc accggagtaa ccggagtggt ctacgacctg 1020

gcccactcta tcctcaagcg tctggataag gactcggacg atatcgccat ctactcgccc 1080

aaccccttca agggcatgtc ctacctcggc aactcgtcca ttgcccaaac cgagtatctg 1140

gatctggtcg acggaggaga agatggacag aatgtgccct actaccctct gctgcagccc 1200

gagagagccg tcgacgtggt catctcctac gacaactccg ccgacaccga ctttaactgg 1260

cccaacggaa cctccgctgt ccagacatac cgacgacagt ttgagaacca ggccaatggc 1320

accattttcc cctacgtgcc cgacgtgaac acattcatca atgagaacct gacttctcga 1380

cccgccttct ttggctgtga cgtgcagaac atgacctcgc tggacaagaa cggttatacc 1440

gacgtcaact cttccgccgc ccttccccct ctcattgtct acattgctaa ctacccctgg 1500

acctttttct ccaacacatc gaccatgtcc aagctgtcgt acaacaagaa ggaggttgcc 1560

ggcatgatcg agaacggcta ctccacctcc acccagttca acggaaccgt ggaccccgac 1620

tggcctgtgt gtcttggctg tgctctgctc aagcgagagg ccacccgacg aaaccagtct 1680

ctgggctctg actgtgacaa gtgcttctcc aagtactgct ggaacggaaa gactgacgat 1740

gatgccgaaa aggctctgaa gtttgctccc gccatctatg ccaacggccc taacgtttct 1800

tccaacgcct caattggcca ggcttcgtcc acctccaagc ccaagaagaa cggcgccgag 1860

ggtctggttc cgggtatggc tgccattgcc attggttttg ccgctcttct tatgtaa 1917

Claims

1. A method for increasing the lipid production of yarrowia lipolytica, comprising: the method comprises the step of knocking out the CAG79599.1 encoding gene of yarrowia lipolytica strain serving as an original strain by adopting homologous recombination or CRISPR-Cas9 gene editing modePLA ₂ -3Obtaining a recombinant strain for improving the lipid yield of the yarrowia lipolytica; the above-mentionedGenePLA ₂ -3The sequence of (A) is shown in SEQ ID NO. 1.

2. A recombinant bacterium produced by the method according to claim 1, wherein the recombinant bacterium is characterized in that: obtained by the process of claim 1PLA ₂ -3The gene inactivated oil yield is improved by the yarrowia lipolytica recombinant strain.

3. Use of the recombinant bacterium of claim 2 for producing microbial oils.