CN112378965A - Electrochemical detection method for hypersensitive microRNA of endopeptidase-driven polypod DNA molecular machine - Google Patents
Electrochemical detection method for hypersensitive microRNA of endopeptidase-driven polypod DNA molecular machine Download PDFInfo
- Publication number
- CN112378965A CN112378965A CN202011252668.7A CN202011252668A CN112378965A CN 112378965 A CN112378965 A CN 112378965A CN 202011252668 A CN202011252668 A CN 202011252668A CN 112378965 A CN112378965 A CN 112378965A
- Authority
- CN
- China
- Prior art keywords
- probe
- microrna
- detection
- molecular machine
- polypod
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
- G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
- C12Q1/682—Signal amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
- C12Q1/6825—Nucleic acid detection involving sensors
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Microbiology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Electrochemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
Abstract
The invention relates to the technical field of molecular diagnosis, and discloses a hypersensitive microRNA electrochemical detection method of an endonuclease driven polypod DNA molecular machine, which comprises the following steps: aiming at target microRNA, detection probes 1, 2 and 3 (probes 1, 2 and 3) are designed and synthesized in a programmed mode to serve as recognition elements, a sulfhydrylation modified probe 4(probe 4) is designed and synthesized to serve as a report element, the sulfhydrylation probe4 is dripped on the surface of a gold electrode, and the gold electrode is incubated overnight in a refrigerator at 4 ℃ to promote the report probe to be anchored on the surface of the gold electrode, so that a molecular track is prepared, a target sequence and the detection probes are recognized and carry out cascade programming reaction to form a three-fork DNA nano structure, each end of the structure is designed with a short piece of nucleic acid restriction endonuclease site serving as a foot of a molecular machine, and then the endonuclease-driven multi-foot molecular machine can be formed.
Description
Technical Field
The invention relates to the technical field of molecular diagnosis, in particular to a hypersensitive microRNA electrochemical detection method of an endonuclease driven polypod DNA molecular machine.
Background
The tumor cell subclone population evolves continuously along with various selective pressures, promotes the proliferation and dissemination thereof, and reduces the treatment susceptibility. Accurate diagnosis and monitoring are realized, ineffective treatment is avoided, and a molecular detection technology for continuously probing dynamic molecular evolution information of tumor cells is urgently needed. Circulating microRNAs (18-24 nucleotides) play a key role in tumor proliferation, differentiation and apoptosis and can be used as potential biomarkers for treatment monitoring, drug resistance assessment and quantification of minimal residual diseases. Meanwhile, the detection of the circulating microRNA in the blood has the advantages of simple and almost non-invasive molecular dynamic landscape for real-time reaction of the tumor, thereby showing wide application prospect.
Nucleic acid detection techniques based on Polymerase Chain Reaction (PCR) have high sensitivity, but are often limited by specialized laboratories, expensive instruments, and complex primer designs. The method for exploring a simple and high-performance microRNA quantitative new method has important research value.
Disclosure of Invention
Technical problem to be solved
Aiming at the defects of the prior art, the invention provides a hypersensitive microRNA electrochemical detection method of an endonuclease driven polypod DNA molecular machine, which has the advantages of no need of a PCR instrument with accurate temperature control, amplification and amplification under an isothermal condition, simplicity and convenience, high efficiency of the DNA molecular machine, single-molecule controllability and detection and analysis performance improvement, provides the advantages of a simple, convenient and sensitive candidate technology with application prospect for cyclic microRNA detection by using an electrochemical sensing technology of the gene polypod molecular machine, and solves the problem that the nucleic acid detection technology based on polymerase chain reaction has high sensitivity but is often limited by professional laboratories, expensive instruments, complex primer designs and the like.
(II) technical scheme
In order to realize the PCR instrument without accurate temperature control, amplification can be realized under the isothermal condition, the PCR instrument has the advantages of simplicity and convenience, the DNA molecular machine has high efficiency and single-molecule controllability, and the detection and analysis performance is improved, the electrochemical sensing technology of the gene multi-foot molecular machine provides a simple, convenient and sensitive candidate technology with application prospect for circulating microRNA detection, and the invention provides the following technical scheme: a hypersensitive microRNA electrochemical detection method of an endonuclease driven polypod DNA molecular machine is characterized by comprising the following steps:
for a target microRNA, programming and synthesizing detection probes 1, 2 and 3 ( probes 1, 2 and 3) as recognition elements, and designing and synthesizing a thiol-modified probe 4(probe 4) as a report element;
dripping the sulfhydrylation probe4 on the surface of the gold electrode, and incubating overnight in a refrigerator at 4 ℃ to promote the report probe to be anchored on the surface of the gold electrode, thereby preparing a molecular orbit;
through the recognition of the target sequence and the detection probe and the generation of cascade programming reaction, the three-fork type DNA nano structure is formed. Each segment of the structure is designed with a short piece of restriction endonuclease site as a foot of a molecular machine, so that a multi-foot molecular machine driven by the endonuclease can be formed;
wherein the sequence of the Probe 1(Probe 1) is CCTCAGCTTCAACATCAGTCTGATAAGCTAGATGTTGTAGCTTATCAGACTG, the sequence of the Probe 2(Probe 2) is CCTCAGCTCAGTCTGATAAGCTACAACATCTCAGACTGATGTTGTAGCTTAT, and the sequence of the Probe 3(Probe 3) is CCTCAGCTATAAGCTACAACATCAGTCTGATAGCTTATCAGACTGATGTTGT.
Preferably, when the target microRNA exists, the target microRNA triggers three detection probes ( probes 1, 2 and 3) to perform a programmed self-assembly reaction, and the three detection probes are assembled to form a three-fork type DNA nano-structure.
Preferably, a short single-stranded nucleic acid fragment extends from each 5' end of the trifurcate structure, so as to form a multi-footed DNA molecular machine, and each foot of the multi-footed DNA molecular machine is recognized and hybridized with a reporter probe (probe4) fixed on the surface of a gold electrode to form a DNA double strand, so as to be captured on the surface of the electrode.
Preferably, the double strand is designed with a restriction enzyme site, the restriction enzyme recognizes and cleaves the double strand to promote the cleavage of the reporter from the probe, and after the cleavage, the restriction enzyme site is sufficient to recognize and hybridize with the next reporter probe, and then enter the next round of the endonuclease reaction.
Preferably, the hybridization and cutting process is repeatedly identified, and then the polypod molecular machine is driven to continuously walk on the reporting probe track on the surface of the gold electrode.
Preferably, each time the single strand extending from each end of the trident structure is combined with and cut on the surface of the electrode, the reporter group is cut off from the probe, so that the electric signal is weakened, and the amplified output of the signal is realized.
Preferably, when the target microRNA does not exist, the programmed reaction cannot be triggered, the detection probes ( probes 1, 2 and 3) exist independently, a short single strand extending from the tail end of the detection probe cannot form a double strand due to weak binding force with the electrode surface probe, the report probe cannot be cut by the restriction enzyme, and the electrochemical signal is unchanged.
(III) advantageous effects
Compared with the prior art, the invention provides a hypersensitive microRNA electrochemical detection method of an endonuclease driven polypod DNA molecular machine, which has the following beneficial effects:
1. according to the electrochemical detection method for the hypersensitive microRNA of the endopeptidase-driven polypod DNA molecular machine, the polypod DNA walking molecular machine is formed by programming detection probes 1, 2 and 3 ( probes 1, 2 and 3), and the sulfhydrylation modification probe 4(probe 4) is designed to serve as a report probe track on the surface of a gold electrode, the DNA molecular machine walks on the report track on the surface of the gold electrode under the drive of the restriction endonuclease, so that the amplification output of signals is realized, and further, a novel technology for the electrochemical sensing detection of the cycling microRNA based on the polypod molecular machine is developed, the novel technology does not need a PCR instrument with accurate temperature control, the amplification can be realized under the isothermal condition, and the electrochemical detection method has the advantages of simplicity and convenience.
2. According to the electrochemical detection method of the hypersensitivity microRNA of the endonuclease driven polypod DNA molecular machine, the DNA molecular machine has high efficiency and single molecule controllability, the detection and analysis performance is improved, and the electrochemical sensing technology of the polypod molecular machine provides a simple, convenient and sensitive candidate technology with application prospect for circulating microRNA detection.
Drawings
FIG. 1 is a schematic diagram of electrochemical sensing detection based on a triplex DNA walking machine in example 1 of the present invention;
FIG. 2 is a diagram showing the electrophoretic verification of the assembly of the polypod molecular machine in example 2 of the present invention;
FIG. 3 is a graph showing the verification of electrochemical signals of the polypod molecular machine in example 2 of the present invention;
FIG. 4 is a graph of impedance characterization of the electrode preparation process in example 2 of the present invention;
FIG. 5 is a graph showing the correlation between the logarithm of the microRNA concentration and the detection signal in example 2 of the present invention;
FIG. 6 is a graph showing the current response of target microRNAs with different concentrations in example 2 of the present invention;
FIG. 7 is a graph of the current response of different target sequences in example 2 of the present invention;
FIG. 8 is a bar graph of signal values for different target sequences in example 2 of the present invention;
FIG. 9 is a graph showing the recovery analysis of a simulated sample of an actual sample in example 2 of the present invention.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
Referring to fig. 1-9, in one aspect of the embodiments of the present invention, a method for electrochemical detection of hypersensitive microRNA by an endonuclease driven polypod DNA molecular machine is provided, which includes:
for a target microRNA, programming and synthesizing detection probes 1, 2 and 3 ( probes 1, 2 and 3) as recognition elements, and designing and synthesizing a thiol-modified probe 4(probe 4) as a report element;
dripping the sulfhydrylation probe4 on the surface of the gold electrode, and incubating overnight in a refrigerator at 4 ℃ to promote the report probe to be anchored on the surface of the gold electrode, thereby preparing a molecular orbit;
through the recognition of the target sequence and the detection probe and the generation of cascade programming reaction, the three-fork type DNA nano structure is formed. Each segment of the structure is designed with a short piece of restriction endonuclease site as a foot of a molecular machine, so that a multi-foot molecular machine driven by the endonuclease can be formed;
wherein the sequence of the Probe 1(Probe 1) is CCTCAGCTTCAACATCAGTCTGATAAGCTAGATGTTGTAGCTTATCAGACTG, the sequence of the Probe 2(Probe 2) is CCTCAGCTCAGTCTGATAAGCTACAACATCTCAGACTGATGTTGTAGCTTAT, and the sequence of the Probe 3(Probe 3) is CCTCAGCTATAAGCTACAACATCAGTCTGATAGCTTATCAGACTGATGTTGT.
When the target microRNA exists, the target microRNA triggers three detection probes ( probes 1, 2 and 3) to perform programmed self-assembly reaction, and a three-way type DNA nano-structure is formed by assembly.
Each 5' end of the trifurcate structure extends out a short single-stranded nucleic acid segment, so that a multi-foot DNA molecular machine is formed, and each foot of the multi-foot DNA molecular machine is recognized and hybridized with a report probe (probe4) fixed on the surface of a gold electrode to form a DNA double strand, so that the DNA double strand is captured on the surface of the electrode.
And designing a restriction enzyme site on the double strand, recognizing and cutting the double strand by using the restriction enzyme to promote the reporter group to be cut from the probe, and after cutting, recognizing and hybridizing the restriction enzyme site with the next reporter probe to enter the next round of incision reaction.
The process of identifying hybridization and cutting is repeated, and then the multi-foot molecular machine is driven to continuously walk on the surface of the gold electrode by the reporting probe track.
The combination and the cutting of the single chain extended from each end of the three-fork structure and the surface of the electrode each time promote the cutting and the falling of the report group from the probe, so that the electric signal is weakened, and the amplification and the output of the signal are realized.
When the target microRNA does not exist, the programmed reaction cannot be triggered, the detection probes ( probes 1, 2 and 3) exist independently, a short single strand extending from the tail end of the detection probe cannot form a double strand due to weak binding force with the electrode surface probe, the report probe cannot be cut by the restriction endonuclease, and the electrochemical signal is unchanged.
Example 1
FIG. 1 is a schematic diagram of the electrochemical sensing detection principle based on the trident-type walking DNA molecular machine in example 1 of the present invention.
(1) The sequence of the biological probe used in the electrochemical detection process of microRNA in the embodiment is shown in Table 1:
table 1: biological probe sequence used in electrochemical detection process of microRNA
(2) Preparing a gold electrode interface by using a biological probe:
the gold electrode is first scanned in 0.5M dilute sulfuric acid for 12 weeks, then polished on deer skin with 0.3 μ M and 0.05 μ M aluminum powder for 10min, the surface of the gold electrode is cleaned with clear water, and then piranha solution (H)2SO4:H2O23:1) for 5min each, followed by washing the surface of the electrode with clean water and drying the surface of the gold-loaded electrode with nitrogen gas, and dropping a reporter probe (1 μ M,5 μ L) on the surface of the electrode and in a 4-degree refrigerator for 10h to prepare a detection electrode.
(3) And (3) electrophoretic characterization:
0.5 g of agar sugar powder is weighed and then added into 25mL of 0.5 XTBE buffer solution to prepare 2% agarose gel, 6 mu L of reaction system solution is respectively added into gel holes, electrophoresis is carried out for 30min under the constant voltage of 110V, and results are photographed and stored under a gel imaging system.
(4) Electrochemical detection:
the concentration of each of probes 1, 2 and 3(Probe1, 2 and 3) was 200nM, the concentration of restriction endonuclease (Nb. BbvCI) was 0.05U/. mu.L, and the concentration of target microRNA was 1X 10-16、1×10-15、1×10-14、1×10-13、1×10-12、1×10-11、1×10-10、1×10-9、1×10-8Adding mol per liter (mol/L) of the solution to the surface of a gold electrode for incubation for 1h, respectively washing the surface of the electrode by using PBS solution and PBST solution after reaction, then adding streptavidin-labeled alkaline phosphatase (1.00 mu g/mL) for incubation for 35 min, respectively washing the surface of the electrode by using the PBS solution and the PBST solution, then placing the gold electrode in alpha-naphthol-containing substrate solution (1mg/mL) for 90 s, and carrying out electrochemical signal detection at a scanning voltage of 0-0.45V.
Example 2
(1) Feasibility verification results for nucleic acid detection:
agarose gel (3%) electrophoresis verified the polypod DNA nanostructure construction, the results are shown in fig. 2: lane 1 is 500bp DNA marker, lanes 2, 3, 4, and 5 are target microRNA and detection probe (probe1, 2, and 3), respectively; lane 6 is assembly strand microRNA + probe 1; lane 7 is assembled strand microRNA + probe1+ probe 2; lane 8 is assembled strand microRNA + probe1+ probe2+ probe 3; lane 9 is probe1+ probe2+ probe, the maker lane is 500bp DNA ladder (Takara), lanes 1 to 4 are assembly strands, as an electrophoresis control, and lanes 5 to 7 are DNA assembly process, and compared to the control band, the band is gradually set back because the assembly strands are gradually assembled into a large molecular weight DNA hybrid, thereby causing a slow electrophoretic moving rate, which suggests that: the construction of the multi-foot DNA nano structure is feasible, the responsiveness result of the electrochemical sensing detection system is shown in figure 3, and when the detection system has no target microRNA, the signal value is about 15 muA; when the detection system is added with the target microRNA, the current value is remarkably reduced by about 2.1 muA, and the result indicates that: the construction of nucleic acid detection bodies based on nb.
(2) And (3) detecting a characterization result of an electrode preparation process:
characterization of electrode surface by impedance the results of the preparation process are shown in fig. 4 (a-d): the preparation steps include that 1, a bare gold electrode is prepared, 2, a report Probe Probe4 is fixed on the surface of the gold electrode, 3, a mercaptoethanol sealed gold electrode surface is prepared, and 4, a fetal bovine serum sealed gold electrode surface is prepared, wherein resistance is gradually increased in the preparation process of the electrode surface (from a to d), and because nucleic acid and sealing molecules on the surface of the electrode gradually block electron transfer on the surface of the gold electrode, impedance is increased, and the preparation of the electrode surface detection Probe is successful. After the electrode surface detection probe is successfully prepared, the molecular reaction process on the electrode surface is further characterized by impedance as shown in fig. 4 (e-f): adding streptavidin-labeled alkaline phosphatase (e), adding Probe1, 2, 3, Nb.BbvCI and target microRNA (f) again, wherein the impedance value e of the added streptavidin-labeled alkaline phosphatase is increased compared with the impedance value d in the step 4, because the streptavidin-labeled alkaline phosphatase connected to the surface of the electrode gradually obstructs electron transfer on the surface of the gold electrode, so that the impedance is increased, and when a reaction system (Probe1, 2, 3, Nb.BbvCI and target microRNA) is added for acting for 60min, the impedance value f is greatly reduced, because the resistance is reduced due to the fact that the reporter Probe4 is sheared away from the surface of the electrode, and the result shows that the electrochemical sensing detection system works according to experimental design.
(3) Sensitivity and linear range results:
as shown in FIG. 5, the results were each at a concentration of 1X 10-16、1×10-15、1×10-14、1×10-13、1×10-12、1×10-11、1×10-10、1×10-9、1×10-8The electrochemical signal spectrum under the condition of mol per liter (mol/L) is shown in figure 6, the result is the correlation analysis of the target microRNA concentration and the detection signal, and the correlation analysis is at 1 x 10-16mol/L to 1X 10-8The logarithm of the inter-mol/L concentration value is linearly related to the current signal value, and the equation is that Y is-8.19-1.3 log10C (R)20.999), according to the principle of average of signal values of 6 blank experiments +3 times standard deviation (Mean)Blank+3 δ), the lowest detection limit was calculated to be 0.29 fM.
(4) The specific result of the novel electrochemical sensing detection technology is as follows:
fig. 7-8 are specific analyses of the new electrochemical sensing detection technology, and the specific analyses (b) are respectively performed through single base mismatching (e), double base pairing (d), triple base mismatching (c) and incomplete mismatching, as shown in fig. 7, current curves b, c, d and e of different target sequences have no significant change in electrochemical signals compared with a blank (a), when a target sequence exists, the electrochemical signals are significantly reduced (f) compared with the blank (a), when single base mismatching exists, the signals are slightly reduced (e), fig. 8 is a current value bar graph corresponding to the current curves of fig. 7, and fig. 8 shows that the new established electrochemical sensing detection technology has single base mismatching distinguishing capability and high specificity.
(5) The recovery rate experiment result is as follows:
FIG. 9 shows the recovery rate analysis of the new electrochemical sensing detection technology, in which artificially synthesized target microRNA is added to serum of a healthy person to prepare a simulated actual sample for subsequent detection. Specifically, a simulated actual sample containing 10pM of target microRNA and a standard solution containing 10pM of target microRNA are respectively added to a new detection system, a current signal is detected after reaction, the current signal (a) is a signal of the simulated actual sample containing microRNA, the current signal (b) is a signal of the standard solution containing the target microRNA, the corresponding concentration of the detected current signal (b) is about 9.85pM, the recovery rate is 98.50%, and the recovery rate shows that the constructed new electrochemical sensing detection technology still has good analysis performance in a complex matrix solution, the performance is not influenced by a complex mechanism, and therefore the new electrochemical sensing detection technology has a good prospect of being applied to detection and analysis of the concentration of the microRNA in the actual sample.
It is noted that, herein, relational terms such as first and second, and the like may be used solely to distinguish one entity or action from another entity or action without necessarily requiring or implying any actual such relationship or order between such entities or actions. Also, the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus. Without further limitation, an element defined by the phrase "comprising an … …" does not exclude the presence of other identical elements in a process, method, article, or apparatus that comprises the element.
Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that changes, modifications, substitutions and alterations can be made in these embodiments without departing from the principles and spirit of the invention, the scope of which is defined in the appended claims and their equivalents.
Claims (7)
1. A hypersensitive microRNA electrochemical detection method of an endonuclease driven polypod DNA molecular machine is characterized by comprising the following steps:
for a target microRNA, programming and synthesizing detection probes 1, 2 and 3 (probes 1, 2 and 3) as recognition elements, and designing and synthesizing a thiol-modified probe 4(probe 4) as a report element;
dripping the sulfhydrylation probe4 on the surface of the gold electrode, and incubating overnight in a refrigerator at 4 ℃ to promote the report probe to be anchored on the surface of the gold electrode, thereby preparing a molecular orbit;
through the recognition of a target sequence and a detection probe and the occurrence of cascade programming reaction, a three-fork DNA nano structure is formed, each section of the structure is designed with a short piece of nucleic acid restriction endonuclease site as a foot of a molecular machine, and further a multi-foot molecular machine driven by the nucleic acid restriction endonuclease can be formed;
wherein the sequence of the Probe 1(Probe 1) is CCTCAGCTTCAACATCAGTCTGATAAGCTAGATGTTG TAGCTTATCAGACTG, the sequence of the Probe 2(Probe 2) is CCTCAGCTCAGTCTGATAAGCTACAACA TCTCAGACTGATGTTGTAGCTTAT, and the sequence of the Probe 3(Probe 3) is CCTCAGCTATAAGCTACAA CATCAGTCTGATAGCTTATCAGACTGATGTTGT.
2. The method of claim 1, wherein when the target microRNA exists, the target microRNA triggers three detection probes (probes 1, 2 and 3) to perform a programmed self-assembly reaction, and the three detection probes are assembled to form a ternary DNA nanostructure.
3. The method of claim 2, wherein a short single-stranded nucleic acid fragment extends from each 5' end of the trifurcated structure, thereby forming a polypod DNA molecular machine, each foot of the polypod DNA molecular machine recognizing hybridization with a reporter probe (probe4) immobilized on the surface of a gold electrode to form a DNA double strand, thereby being captured on the surface of the electrode.
4. The method of claim 3, wherein the double strand is designed with a restriction enzyme site, the restriction enzyme recognizes and cleaves the double strand to facilitate cleavage of the reporter from the probe, and after cleavage, the restriction enzyme site is sufficient to recognize and hybridize with the next reporter probe for the next round of the cleavage reaction.
5. The method of claim 4, wherein the hybridization and cleavage process is identified and repeated, and the polypod molecular machine is driven to continuously walk on the report probe track on the surface of the gold electrode.
6. The method of claim 5, wherein each binding and cleavage of the single strand extending from each end of the trifurcated structure to the electrode surface causes cleavage of the reporter group from the probe, resulting in a reduction of the electrical signal, thereby amplifying the signal output.
7. The method according to claim 1, wherein the target microRNA is not present and is not capable of triggering a programming reaction, the detection probes (probes 1, 2 and 3) are present individually, the short single strand extending from the end of the detection probe is weak in binding force with the electrode surface probe and cannot form a double strand, the reporter probe is not capable of being cleaved by the restriction enzyme, and the electrochemical signal is unchanged.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202011252668.7A CN112378965B (en) | 2020-11-11 | 2020-11-11 | Electrochemical detection method for hypersensitive microRNA of endopeptidase-driven polypod DNA molecular machine |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202011252668.7A CN112378965B (en) | 2020-11-11 | 2020-11-11 | Electrochemical detection method for hypersensitive microRNA of endopeptidase-driven polypod DNA molecular machine |
Publications (2)
Publication Number | Publication Date |
---|---|
CN112378965A true CN112378965A (en) | 2021-02-19 |
CN112378965B CN112378965B (en) | 2023-01-31 |
Family
ID=74582098
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202011252668.7A Active CN112378965B (en) | 2020-11-11 | 2020-11-11 | Electrochemical detection method for hypersensitive microRNA of endopeptidase-driven polypod DNA molecular machine |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN112378965B (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113237936A (en) * | 2021-05-08 | 2021-08-10 | 贵州省人民医院 | Target sequence lncARSR electrochemical detection method based on ortho-touch catalytic hairpin probe self-assembly and metal organic framework |
CN114410750A (en) * | 2022-01-21 | 2022-04-29 | 中国科学院苏州生物医学工程技术研究所 | Nucleic acid detection method and kit based on circular biped DNA walking strategy |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN108918509A (en) * | 2018-07-16 | 2018-11-30 | 青岛科技大学 | A kind of development and its application based on CdSe quantum dot Electrochemiluminescsensor sensor |
CN109813703A (en) * | 2019-01-11 | 2019-05-28 | 东南大学 | The method of electrochemical luminescence aptamer sensor detection ochratoxin A based on the building of DNA walking robot |
CN110849867A (en) * | 2019-12-06 | 2020-02-28 | 东北师范大学 | Electroluminescent sensor based on double-hairpin structure and construction method and application thereof |
CN111172246A (en) * | 2020-01-13 | 2020-05-19 | 天津国科医工科技发展有限公司 | Electrochemical nucleic acid detection method based on DNA walking and rolling circle amplification signal amplification |
-
2020
- 2020-11-11 CN CN202011252668.7A patent/CN112378965B/en active Active
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN108918509A (en) * | 2018-07-16 | 2018-11-30 | 青岛科技大学 | A kind of development and its application based on CdSe quantum dot Electrochemiluminescsensor sensor |
CN109813703A (en) * | 2019-01-11 | 2019-05-28 | 东南大学 | The method of electrochemical luminescence aptamer sensor detection ochratoxin A based on the building of DNA walking robot |
CN110849867A (en) * | 2019-12-06 | 2020-02-28 | 东北师范大学 | Electroluminescent sensor based on double-hairpin structure and construction method and application thereof |
CN111172246A (en) * | 2020-01-13 | 2020-05-19 | 天津国科医工科技发展有限公司 | Electrochemical nucleic acid detection method based on DNA walking and rolling circle amplification signal amplification |
Non-Patent Citations (2)
Title |
---|
RUFENG ZHANG ET AL: "Efficient strand displacement amplification via stepwise movement of a bipedal DNA walker on an electrode surface for ultrasensitive detection of antibiotics", 《ANALYST》 * |
YONGJIE XU ET AL: "Guanine-wire based walking machine for highly sensitive and selective detection of circulating microRNA", 《SENSORS AND ACTUATORS B: CHEMICAL》 * |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113237936A (en) * | 2021-05-08 | 2021-08-10 | 贵州省人民医院 | Target sequence lncARSR electrochemical detection method based on ortho-touch catalytic hairpin probe self-assembly and metal organic framework |
CN113237936B (en) * | 2021-05-08 | 2023-05-05 | 贵州省人民医院 | Target sequence lncARSR electrochemical detection method based on ortho-touch catalytic hairpin probe self-assembly and metal organic framework |
CN114410750A (en) * | 2022-01-21 | 2022-04-29 | 中国科学院苏州生物医学工程技术研究所 | Nucleic acid detection method and kit based on circular biped DNA walking strategy |
Also Published As
Publication number | Publication date |
---|---|
CN112378965B (en) | 2023-01-31 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
JP6664011B2 (en) | Determination of abundance parameters for polynucleotide sequences in a sample | |
US20040248098A1 (en) | Method of detecting polymorphisms in dna by using mass spectroscopy | |
EP1542009A1 (en) | Method of detecting nucleic acid by using dna microarrays and nucleic acid detection apparatus | |
Jin et al. | Hyperbranched rolling circle amplification based electrochemiluminescence aptasensor for ultrasensitive detection of thrombin | |
CN112378965B (en) | Electrochemical detection method for hypersensitive microRNA of endopeptidase-driven polypod DNA molecular machine | |
CN108192948B (en) | It is a kind of to detect the active method of DNA glycosylase using alpha hemolysin nano-pore | |
Yeh et al. | Gold nanoparticles conjugates-amplified aptamer immunosensing screen-printed carbon electrode strips for thrombin detection | |
Wang et al. | Dual-probe electrochemical DNA biosensor based on the “Y” junction structure and restriction endonuclease assisted cyclic enzymatic amplification for detection of double-strand DNA of PML/RARα related fusion gene | |
US6821734B2 (en) | Method for testing nucleic acid sequence | |
CN108588203B (en) | Fluorescent detection kit based on DNA enzyme and application thereof in nucleic acid detection | |
KR101820440B1 (en) | Method for detection of target nucleic acids | |
CN109504734B (en) | DNA motor for in-situ acceleration in living cells and preparation method and application thereof | |
CN109613096B (en) | DNA-related enzyme electrochemical biosensor constructed based on DNA-copper nanoclusters and application thereof | |
CN113774114A (en) | Nucleic acid analysis method and application | |
Sebuyoya et al. | Dual detection system for cancer-associated point mutations assisted by a multiplexed LNA-based amperometric bioplatform coupled with rolling circle amplification | |
CN117368284A (en) | Electrochemical sensor for detecting exosome miRNA, and preparation method and application thereof | |
CN109406596B (en) | Electrochemical sensor for detecting microRNA-21, preparation method and application thereof | |
US20140228247A1 (en) | Sequence-specific analysis of nucleic acids | |
Nie et al. | Enzyme-assisted amplification of target cycle triggers the unlocking of locked hairpin probes for let-7a detection | |
CN109136334B (en) | Rapid microRNA detection method based on Y-type DNA structure | |
US7132266B2 (en) | Method and kit for analyzing target nucleic acid fragment | |
JP2022530016A (en) | Porous determination of partial abundance of polynucleotide sequence in sample | |
CN115109855A (en) | Electrochemical method for detecting CYP2C19 x 2 genotype by combining ligase with exonuclease and realizing zero background | |
US20160265064A1 (en) | Electrochemical clamp assay | |
CN102937613B (en) | Electrochemistry ampere detection method for quantitively detecting polymerase chain reaction (PCR) based on methylene blue indicator |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |