CN112362873A

CN112362873A - RCQDs nano probe solution applied to AFP detection and preparation method thereof

Info

Publication number: CN112362873A
Application number: CN202011240976.8A
Authority: CN
Inventors: 胡月芳; 梁冬梅; 陈雨昕; 汤泉; 颜秋玉; 莫济秋; 黄岳
Original assignee: Hezhou University
Current assignee: Hezhou University
Priority date: 2020-11-09
Filing date: 2020-11-09
Publication date: 2021-02-12

Abstract

The invention provides a method for applying a functionalized RCQDs nano probe to AFP detection, and the design of the functionalized RCQDs nano probe and the AFP detection principle are as follows: carbon-based quantum dots (RCQDs) are prepared by taking loquat leaves as precursors, AFP-aptamer labeled by a quenching group BHQ3 is hybridized and combined with DNA single-chain covalently coupled on the surface of the RCQDs, as the absorption spectrum of the quenching group BHQ3 is mostly overlapped with the fluorescence emission of the RCQDs, after the hybridization and combination on the surface of the RCQDs, fluorescence resonance energy transfer effect (FRET) occurs, and the fluorescence of the RCQDs is quenched. After AFP appears, the AFP specifically hybridizes with an aptamer to generate a strand displacement reaction, and RCQDs fluorescence is recovered. The detection method is simple, has the characteristics of wide linear range of detection, low detection limit, interference resistance and the like, and can be widely applied to detection of liver cancer markers clinically.

Description

RCQDs nano probe solution applied to AFP detection and preparation method thereof

Technical Field

The invention relates to a method for preparing a functional carbon quantum dot (RCQDs) nano probe by using near-infrared emission carbon quantum dots (RCQDs), which is applied to the technical field of alpha-fetoprotein (AFP) detection.

Background

Alpha-fetoprotein (AFP) is a high-specificity protein expressed by liver cancer cells, the molecular weight of the protein is about 70KDa, many liver cancer patients (70-80%) have the characteristic of high expression of AFP genes in the disease period, the AFP is an embryogenic protein, the genes of the AFP are opened and expressed in the fetal development process, the AFP is basically in a closed state after two years of birth of a human, the AFP level of a normal organism does not exceed 20ng/mL, but when an adult generates liver cancer or liver benign regeneration, the genes of the AFP are reactivated and expressed in a large amount, and the AFP is clinically considered as a classic tumor marker of the liver cancer.

Aptamers are single-stranded dna (ssdna) or RNA fragments that specifically bind to a target molecule and are typically obtained by in vitro screening. Compared with antibodies, aptamers have the advantages of good chemical stability, small molecular weight, good modification performance, non-toxicity, recoverability and the like, and in addition, aptamers usually show higher specificity and affinity to targets of the aptamers.

The maximum fluorescence emission spectrum is located at the near infrared emission carbon dots (RCQDs) of 650-900nm, the radiation energy is smaller, the autofluorescence of an organism in the interval is very low, the absorption of light waves by hemoglobin, water, lipid and the like in living tissues is very little, the RCQDs have a large penetration depth in the living tissues, can generate light signals in deep tissues, hardly generate any influence on the living tissues, can avoid background interference to obtain higher analysis sensitivity, and particularly has obvious superiority in the fields of biological sample detection and analysis, living body imaging and the like.

Currently, many methods have been reported for the detection of AFP, such as enzyme-linked immunoassay, fluorescence assay, chemiluminescence, electrochemiluminescence, electrochemistry, colorimetry, and surface-enhanced raman spectroscopy. Among them, enzyme-linked immunosorbent assay and electrochemiluminescence assay are most commonly used, but these methods have some disadvantages, such as low sensitivity, expensive instrument and equipment, complex sample pretreatment and long consumption time, and therefore, it is a continuous effort in the industry to develop a simple, rapid and sensitive method for detecting AFP.

Disclosure of Invention

In order to solve the problems of low AFP detection sensitivity, expensive instrument and equipment, long consumed time and the like, the invention aims to provide a simple, quick and sensitive functional RCQDs probe solution for AFP detection. The design principle of the functional probe solution is as follows: the method comprises the steps of preparing an extracting solution by taking loquat leaves as a precursor, and treating the extracting solution by a microwave method to prepare a nitrogen self-doped near-infrared emission carbon-based quantum dot (RCQDs), wherein the maximum emission peak of the obtained RCQDs is 682nm, the quantum yield is 19.34%, and the prepared RCQDs have good water solubility, good light stability, good compatibility and low toxicity. Based on the excellent performance of RCQDs, an AFP-aptamer labeled by a quenching group BHQ3 with the maximum absorption wavelength of 672nm is hybridized and combined with a DNA single strand covalently coupled on the surface of the RCQDs, and because the absorption spectrum of the quenching group BHQ3 is mostly overlapped with the fluorescence emission spectrum of the RCQDs, the RCQDs are taken as fluorescence donors after being hybridized and combined on the surface of the RCQDs, the quenching group BHQ3 is taken as fluorescence acceptors, the fluorescence resonance energy transfer effect (FRET) occurs, and the fluorescence of the RCQDs is quenched. After AFP appears, the AFP specifically hybridizes with an aptamer to generate a strand displacement reaction, and the BHQ 3-AFP-aptamer connected to the surface of RCQDs is competitively displaced, so that a quenching group BHQ3 is far away from the RCQDs, the FRET effect disappears, and the fluorescence of the RCQDs is recovered.

The preparation method of the functionalized RCQDs probe solution comprises the following steps:

step one, preparation of RCQDs:

cleaning fresh folium Eriobotryae, air drying, cutting into small pieces, soaking appropriate amount of folium Eriobotryae in certain amount of anhydrous ethanol, continuously stirring for 4h, centrifuging at 8000rpm for 10min to obtain transparent supernatant, and concentrating the supernatant with rotary evaporator until slurry sample appears. Placing the slurry sample in a beaker, heating with 700W power microwave oven for 5min to obtain residue, dispersing the residue in ultrapure water to obtain dispersion, and further filtering the dispersion with 0.22 μm filter membrane filter to obtain filtrate containing RCQDs with small particle size.

Step two, preparing RCQDs nano probe solution:

taking a proper amount of the filtrate of the RCQDs prepared in the step (1), and adding a certain proportion of H₂N-PEG-NH₂And (3) fully and uniformly mixing the anhydrous ethanol solution, refluxing and heating to 120 ℃, stirring for 10h under the nitrogen atmosphere, demixing the solution, taking supernatant, filtering the supernatant through a 0.22 mu m inorganic filter membrane, and dialyzing the filtrate for 48h by using a dialysis membrane (MWCO:2kDa) to obtain a pure aminated RCQDs solution.

Mixing the dialyzed aminated RCQDs solution with NHS and EDC at a certain ratio, stirring and activating for 30min, adding 1.5mL activated solution into 100 μ L of 100 μmol/L DNA single strand (DNA-NH) with one end modified with amino₂) Mixing the two solutions in a constant temperature shaking table at 37 ℃ for 30min, carrying out covalent coupling on activated carboxyl on RCQDs and amino, then adding 100 mu L of 30-80 mu mol/L modified single-chain AFP-aptamer (AFP aptamer-BHQ 3) of BHQ3, hybridizing in the constant temperature shaking table at 37 ℃ for 45-75min, transferring the compound solution to a 10kD ultrafiltration tube, centrifuging for 15min at 10000 r/min, adding Tris-HC1 solution, repeating the centrifuging step for three times, and recovering the solution in the ultrafiltration tube to obtain the functionalized RCQDs nano probe solution.

Preferably, the ratio of the loquat leaves to the absolute ethyl alcohol in the first step is 2 g: 5 mL.

Preferably, the RCQDs filtrate is mixed with H₂N-PEG-NH₂The proportion of the absolute ethyl alcohol solution is 30 mL: 0.2 g.

Preferably, the mixing ratio of the aminated RCQDs solution to NHS and EDC is 5 mL: 0.01 g: 0.1 g.

Preferably, the solubility of the single-chain AFP-aptamer of the modified BHQ3 is 70. mu. mol/L.

Preferably, the hybridization time is 60 min.

The functional RCQDs nano probe solution prepared by the invention has the following advantages:

(1) the prepared detection solution has good stability;

(2) by a strand displacement method, a fluorescence 'off-on' probe based on FRET effect is constructed, AFP can be specifically detected, and an aptamer is adsorbed and displaced from the surface of RCQDs by a competition mechanism, so that the method has the characteristics of quick operation, wide detection linear range and low detection limit;

(3) can be used for detecting AFP in actual serum samples, various cancer cells and liver cancer tumors of nude mice.

Drawings

FIG. 1 is a UV-Vis spectrum and a fluorescence emission spectrum of the functionalized RCQDs;

FIG. 2(a) is I/I₀Graphs of the change in value at different hybridization times (0, 15, 3, 45, 60, 75, 90, 105, 120, 135 min);

FIG. 2(b) is I/I₀Graphs of the change in value at different hybridization concentrations (0, 10, 20, 30, 40, 50, 60, 70, 80, 100. mu. mol/L);

FIG. 3(a) is a time-resolved fluorescence decay plot of RCQDs versus functionalized RCQDs;

FIG. 3(b) is a graph showing fluorescence spectra of RCQDs, functionalized RCQDs, and functionalized RCQDs + AFP;

FIG. 4(a) is a graph of the fluorescence signal of a functionalized RCQDs solution system when different concentrations of AFP are added;

FIG. 4(b) is the fluorescence signal ratio (I/I) of the functionalized RCQDs nanoprobes₀) A graph relating AFP concentration;

FIG. 5 is a graph of the detected fluorescence response signal of AFP and possible co-occurrences.

Detailed Description

The present invention will be described in further detail with reference to specific examples, but the present invention is not limited thereto.

Reagent used in example

Folium Eriobotryae collected in university of Guangxi university of Umbelliferae, alpha-fetoprotein (AFP) purchased from Shanghai Lin KeshengScience and technology limited (shanghai, china). Bovine serum albumin (BSA, 96% -99%), diethylenetriamine pentaacetate (DTPA) and Chitosan (CHIT) were obtained from SigmaeAldrich (beijing, china) and all analytical reagent grade reagents were used directly in subsequent experiments without further purification. CEA, CA125, CA15-3, thrombin (TT), Tyrosinase (TYR), Dopamine (DA), vitamin B1, vitamin B2, ascorbic acid (Vc), Norepinephrine (NE), glucose (Glu), Folic Acid (FA), and Adenosine Triphosphate (ATP) were purchased from Boson Biotech co. DNA was synthesized and purified by Sangon Biotech co., Ltd. (shanghai, china). All experimental water was ultrapure water (18.25 MU cm, Chongqing, China). Other conventional reagents were purchased from Dingguo Changsheng Bio-technologies, Inc. (Beijing, China). The buffer required for the experiment was 20mmol/L Tris-HCl (0.1mol/L, pH 7.0) buffer. The DNA sequences used in this experiment were synthesized and purified by Sangon Biotech co., Ltd. (shanghai, china), and the specific DNA sequences (5 'to 3') were as follows: AFP aptamer-BHQ 3: 5'-GTGACGCTCCTAACGCTGACTCAGGTGCAGTTCTCGACTCGGTCTTGATGTGGGTCCTGTCC GTCCGAACCAATC-3' -BHQ 3; DNA-NH₂：5’-H₂N-TTTGTCAGCGTTAGGAGCGTCAC-3’。

Second, the instruments used in the examples

The apparatus used in the examples is shown in Table 1:

TABLE 1

Third, example sample preparation and detection methods

1. Preparation of RCQDs

Cleaning and airing fresh loquat leaves, cutting the fresh loquat leaves into small blocks, soaking 20g of loquat leaves into 50mL of absolute ethyl alcohol, continuously stirring for 4h, centrifuging at the rotating speed of 8000rpm for 10min to obtain transparent supernatant, and concentrating the supernatant by using a rotary evaporator until a slurry sample appears. Placing the slurry sample in a beaker, heating with 700W power microwave oven for 5min to obtain residue, dispersing the residue in ultrapure water to obtain dispersion, and further filtering the dispersion with 0.22 μm filter membrane filter to obtain filtrate containing RCQDs with small particle size.

2. Preparation of functionalized RCQDs nano probe solution

30mL of RCQDs filtrate was taken in a 50mL beaker, and 0.2g of H was added₂N-PEG-NH₂And (3) fully and uniformly mixing the anhydrous ethanol solution, refluxing and heating to 120 ℃, and stirring for 10 hours in a nitrogen atmosphere. The obtained supernatant was filtered through a 0.22 μm inorganic filter, the filtrate was purified by dialyzing against a dialysis membrane (MWCO:2kDa) for 48 hours to obtain pure aminated RCQDs, 0.01g NHS and 0.1g EDC were added to 5mL of the dialyzed solution, stirred and activated for 30min, 100 μ L of 100 μmol/L of a single-stranded amino group-modified DNA at one end and carboxyl group activated on RCQDs were added to 1.5mL of the activated solution, and covalent coupling was carried out for 30min in a 37 ℃ constant temperature shaker. And then adding 100 mu L of 70 mu mol/L single-chain AFP-aptamer of modified BHQ3 and the single-chain incomplete complementation of the modified amino group, hybridizing for 60min in a constant-temperature shaking table at 37 ℃ to form a functionalized RCQDs nano probe, transferring the compound solution into a 10kD ultrafiltration tube, centrifuging for 15min at 10000r, adding 40mL of Tris-HCl solution, repeating the centrifuging step for three times, and recovering the solution in the ultrafiltration tube to obtain the functionalized RCQDs nano probe solution.

3. Detection of tumor marker AFP

100 μ L of functionalized RCQDs (1mg/mL), 40 μ L of Tris-HCl (20mmol/L, pH 7.0), and 60 μ L of standard solution or sample solution of AFP at different concentrations were sequentially placed in a 1.5mL tube; then diluting to 500 mu L with ultrapure water and thoroughly swirling uniformly; finally, the mixture was reacted at 37 ℃ for a further 30min before fluorescence measurement. Where each sample was tested in 4 replicates, all concentrations refer to the final assay concentration in the sample.

4. Serum sample preparation and detection

Serum samples collected from three healthy volunteers in Min Hospital in Hezhou city were centrifuged (10000rpm, 10min) to remove impurities from the blood samples; the supernatant was then collected into 1.5mL centrifuge tubes and different amounts of AFP (10ng, 20ng, 50ng and 100ng) were added; the detection method of the serum sample is the same as that of the tumor marker AFP.

5. Detection of Selectivity and interferents

The detection of the selectivity and the interferent is the same as the detection method of the tumor marker AFP.

Fourth, example results and discussion

1 characterization of functionalized RCQDs

Taking 1mL of the prepared functionalized RCQDs solution to carry out ultraviolet-visible spectrum analysis at 200-880nm, taking 100 muL of the RCQDs solution to carry out fluorescence emission spectrum analysis at 400-900nm, wherein the spectrogram is shown in figure 1, and as can be seen from the figure, the functionalized RCQDs have obvious absorption peaks at about 300nm and 672nm, the characteristic absorption of the RCQDs is at about 300nm, and the characteristic absorption peak of the BHQ3 is at about 672nm, which indicates that the BHQ3 is successfully loaded on the surface of the RCQDs. From FIG. 1, it can also be found that the absorption spectrum of BHQ3 has a large overlap with the emission spectrum of RCQDs, and it is theoretically presumed that BHQ3 and RCQDs are fully capable of causing FRET effect.

Fluorescence stability of 2RCQDs

In order to evaluate the stability of RCQDs, the performance of RCQDs under different conditions is tested and analyzed, and the RCQDs are stored in a solution form for 6 months at room temperature or are irradiated by ultraviolet light for 2 hours, and the fluorescence intensity and the shape of the RCQDs are not changed, which indicates that the RCQDs have good photobleaching resistance. Another solution of RCQDs was subjected to fluorescence analysis at pH from 2 to 13, and showed different changes with increasing pH due to the large number of N-H and COO-groups in RCQDs. The RCQDs solution is taken to be mixed with NaCl solutions with different concentrations, the fluorescence intensity of the RCQDs is hardly changed along with the change of the NaCl concentration, and the result shows that the RCQDs have good stability.

Optimization of hybridization time and concentration of 3BHQ 3-AFP-aptamer

The influence of the length and concentration of the hybridization time of the RCQDs of BHQ 3-AFP-aptamer and modified amino-DNA single-strand on the detection performance of the fluorescent probe is respectively tested in a constant temperature shaking table at 37 ℃, and the I/I can be seen from the graph of FIG. 2(a)₀Trend of values versus hybridization time (wherein I₀And I respectively refer to the fluorescence intensity of RCQDs before and after adding BHQ 3-AFP-aptamer), we can clearly see that the I/I of the fluorescent probe ranges from 1 to 60min₀Value following incubationThe time increases and becomes smaller rapidly. As can be seen, BHQ 3-AFP-aptamer can hybridize to generate FRET on the surface of RCQDs at a constant temperature of 37 ℃, and enables the fluorescence quenching of RCQDs to reach the maximum quenching rate at 60min, however, I/I is carried out later₀The value remains in a relatively constant state at all times. Therefore, the optimal hybridization time for BHQ 3-AFP-aptamers and RCQDs that modify amino-DNA single strands was 60 min.

As shown in FIG. 2(b), the fluorescence intensity of RCQDs rapidly decreased with increasing concentrations of hybridization with BHQ 3-AFP-aptamer (0, 10, 20, 30, 40, 50, 60, 70, 80, 100. mu. mol/L), i.e., I/I₀The value gradually decreases. It can be seen that BHQ 3-AFP-aptamer can hybridize with RCQDs of modified amino-DNA single strand and generate FRET effect to effectively quench fluorescence of RCQDs, FIG. 2(b) also shows that I/I at BHQ 3-AFP-aptamer concentration exceeding 70. mu. mol/L₀The change in value was not significant, i.e., the fluorescence intensity of RCQDs was quenched to the greatest extent upon hybridization with 70. mu. mol/L BHQ 3-AFP-aptamer. Therefore, in general terms, 70. mu. mol/L BHQ 3-AFP-aptamers were best selected for hybridization with RCQDs that modified amino-DNA single strands.

3 fluorescent characterization feasibility analysis

ssDNA labeled with a quenching group BHQ3 can be incompletely complementary linked to the amino-DNA modified on RCQDs, and because the absorption peak of BHQ3 and the emission peak of RCQDs are mostly overlapped, FRET effect occurs, which results in quenching of fluorescence donor RCQDs. However, when encountering their complementary ssDNA, the ssDNA leaves the RCQDs by forming more stable double stranded DNA (dsDNA), and the fluorescence of the RCQDs is restored by the disappearance of the FRET effect. FRET of RCQDs is an effect occurring between fluorescence donors RCQDs in a short-range excited state and fluorescence acceptors in a ground state, and an absorption spectrum of the fluorescence acceptors and an emission spectrum of the fluorescence donors RCQDs overlap, and is a non-radiative energy transfer, and the fluorescence lifetime of the fluorescence donors RCQDs after the occurrence of FRET is reduced. In order to further verify the quenching mechanism of the fluorescence of RCQDs, the fluorescence lifetime measurement (containing RCQDs with the same concentration) is respectively carried out on the RCQDs and the functionalized RCQDs, as shown in FIG. 3(a), the fluorescence decay curve of the functionalized RCQDs is obviously different from the RCQDs, and the average fluorescence lifetime is calculated to be reduced from 4.8ns to 2.6ns after the RCQDs are hybridized by BHQ 3-AFP-aptamer chain, which indicates that the fluorescence resonance energy transfer is generated between BHQ3 and the RCQDs, thereby causing the fluorescence lifetime reduction and the fluorescence quenching phenomenon of the RCQDs.

Taking the solution which is hybridized for 60min to form 100 mu L of the functionalized RCQDs, carrying out fluorescence analysis test on the solution, adding 100 mu L of 300ng/mLAFP solution into the solution, carrying out fluorescence analysis test again, taking the RCQDs solution with the same concentration to carry out fluorescence analysis test, wherein the fluorescence spectra of the three solutions are shown in figure 3(b), and it is obvious from the figure that compared with the RCQDs, the fluorescence of the functionalized RCQDs is obviously quenched, and the fluorescence quenching rate can reach 76%. It can also be seen that upon addition of AFP, the fluorescence of RCQDs is significantly restored, indicating a stronger specific binding between AFP and BHQ 3-AFP-aptamer, thereby displacing BHQ 3-AFP-aptamer from the surface of RCQDs, and the FRET effect disappears, thereby restoring the fluorescence of RCQDs.

4 fluorescence analysis of tumor marker AFP with different concentrations by functional RCQDs solution

The functionalized RCQDs are formed after 70 mu mol/L BHQ 3-AFP-aptamer and 1 mu g/mL aqueous solution of the modified amino-DNA single-stranded RCQDs are hybridized for 60min, 13 parts of the functionalized RCQDs nano-probe solution with 50 mu L each are respectively added into 50 mu L AFP solutions with different concentrations (0.006, 6.0, 20, 40, 60, 90, 110, 130, 160, 190, 210, 260 and 320ng/mL) to be subjected to fluorescence analysis, and fluorescence emission signals are recorded, wherein as shown in FIG. 4(a), the fluorescence intensity of the functionalized RCQDs solution is obviously recovered along with the increase of the AFP concentration in the range from 0.006 to 320 ng/mL. The demonstration shows that the AFP can be hybridized with the modified BHQ 3-AFP-aptamer, the BHQ 3-AFP-aptamer is replaced, so that the BHQ 3-AFP-aptamer falls off from the surface of RCQDs, the FRET effect disappears, and the fluorescence quenched by the RCQDs is recovered. We can also see that the AFP concentration is in the range of 0.006-210ng/mL, the fluorescence intensity of the functionalized RCQDs solution is enhanced along with the increase of the AFP concentration, and when the AFP concentration reaches 210ng/mL, the trend of the increase of the fluorescence intensity is smaller, and the reaction is saturated. FIG. 4(b) shows fluorescence signal ratio (I '/I ') of functionalized RCQDs solution '₀) In relation to the AFP concentration, wherein I' isRefers to the fluorescence intensity, I 'of the functionalized RCQDs solution at a wavelength of 682nm when different concentrations of AFP were added'₀The fluorescence signal intensity of the functionalized RCQDs in the absence of AFP. I '/I ' can be seen from the inset in FIG. 4(b) '₀Has good linear relation with AFP concentration of 0.006-210ng/mL, and the linear regression equation is I '/I'₀0.0101C (ng/mL) +1.042, coefficient of linear correlation R²0.9976, the detection limit calculation result is 2pg/mL based on signal/noise being 3. Compared with the reported AFP detection method, as shown by comparison in Table 2, the fluorescence detection method of the functionalized RCQDs nano-probe shows more excellent detection effect. Therefore, the functionalized RCQDs nano-probe can be used for the specific high-sensitivity detection of AFP.

TABLE 2

5 interference analysis of Selective and coexisting materials

In order to evaluate the proposed fluorescent detection method of functionalized RCQDs nanoprobes with sufficiently high selectivity and sensitivity to AFP, analytical proteins (3mg/mL CEA, 3mg/mL CA125, 3mg/mL CA15-3, 3mg/mL thrombin (TT), 0.3mg/mL LBSA, 0.3mg/mL Tyrosinase (TYR) and 0.3mg/mL Dopamine (DA) were detected under the same conditions and with AFP detected at a concentration of 0.3mg/mL as a control, respectively, and compounds (3mg/mL vitamin B) which may exist under physiological conditions (TYR) and (DA) were detected at a concentration of 0.3mg/mL₁(Vit B₁) 0.3mg/mL vitamin B₂(Vit B₂) 0.3mg/mL ascorbic acid (Vc), 0.3mg/mL Norepinephrine (NE), 0.3mg/mL glucose (Glu), 0.3mg/mL Folic Acid (FA), 0.3mg/mL Adenosine Triphosphate (ATP), and ions (3mg/mL Na)⁺、3mg/mLK⁺、3mg/mLCa²⁺、3 mg/mLFe³⁺) And recording the fluorescence signal generated by detection. Fluorescence signals are shown in FIG. 5, I '/I ' of AFP '₀Value I '/I ' of other related proteins, compounds and metal ions '₀Value comparison (where I 'and I'₀Fluorescence signal of the system in the presence or absence of AFP or interferent, respectively, of functionalized RCQDs fluorescent probes), I '/I ' of AFP '₀The value is far higher than that of I '/I ' of other detection substances '₀The values show that the proteins, biological compounds and ions have small influence on the fluorescence intensity of the fluorescence detection of the functionalized RCQDs fluorescent probe, and the functionalized RCQDs fluorescent probe has good anti-interference and specificity on AFP detection.

6 analysis of AFP in serum samples

In order to evaluate the analysis application potential of the functionalized RCQDs fluorescent probe in actual samples, the recovery rate of diluted serum samples added with different concentrations of AFP is also considered, and the analysis process is shown in Table 3. We can see that the standard recovery rate of the functionalized RCQDs fluorescent probe for AFP detection is between 98.5% and 105.2%, and the experimental requirements are met. The result shows that the method for detecting AFP by the functionalized RCQDs fluorescent probe can be used for analyzing actual samples in clinic and can be used as a promising method for clinically detecting the AFP concentration.

TABLE 3

Claims

1. A functionalized RCQDs nano probe solution applied to AFP detection is characterized in that the preparation method of the functionalized RCQDs nano probe solution comprises the following steps:

(1) preparation of RCQDs: cleaning fresh loquat leaves, air drying, cutting into small blocks, immersing a proper amount of loquat leaves into a certain amount of absolute ethyl alcohol, continuously stirring for 4 hours, centrifuging at the rotating speed of 8000rpm for 10 minutes to obtain transparent supernatant, concentrating the supernatant by using a rotary evaporator until a slurry sample appears, putting the slurry sample into a beaker, heating for 5 minutes by using a 700W power microwave oven to obtain residues, dispersing the residues in ultrapure water to obtain dispersion, and further filtering the dispersion by using a 0.22 mu m filter membrane filter to obtain filtrate containing RCQDs with small particle sizes.

(2) Preparation of RCQDs nanoprobe solution:

taking a proper amount of the filtrate of the RCQDs prepared in the step (1), and adding a certain proportion of H₂N-PEG-NH₂Fully and uniformly mixing the anhydrous ethanol solution, refluxing and heating to 120 ℃, stirring for 10h under the nitrogen atmosphere, layering the solution, taking supernatant, filtering the supernatant through a 0.22 mu m inorganic filter membrane, and dialyzing the filtrate for 48h by using a dialysis membrane (MWCO:2kDa) to obtain a pure aminated RCQDs solution; and mixing the dialyzed aminated RCQDs solution with NHS and EDC according to a certain proportion, stirring and activating for 30min, adding 100 mu L of 100 mu mol/L DNA single chain with one end modified with amino into 1.5mL of activated solution, mixing the two in a constant temperature shaking table at 37 ℃ for 30min, carrying out covalent coupling on the activated carboxyl on the RCQDs and the amino, then adding 100 mu L of 30-80 mu mol/L single chain AFP-aptamer with BHQ3 modified, hybridizing in the constant temperature shaking table at 37 ℃ for 45-75min, transferring the compound solution into a 10kD ultrafiltration tube, centrifuging for 15min at 10000 r/min, adding Tris-HC1 solution, repeating the centrifuging step for three times, and recovering the solution in the ultrafiltration tube to obtain the functionalized RCQDs nano probe solution.

2. The RCQDs nanoprobe solution of claim 1, wherein the ratio of the loquat leaves to the absolute ethyl alcohol in (1) is 2 g: 5 mL.

3. The RCQDs nanoprobe solution of claim 2, wherein the RCQDs filtrate is mixed with H in step (2)₂N-PEG-NH₂The proportion of the absolute ethyl alcohol solution is 30 mL: 0.2 g.

4. The RCQDs nanoprobe solution of claim 3, wherein the mixing ratio of the aminated RCQDs solution with NHS and EDC in step (2) is 5 mL: 0.01 g: 0.1 g.

5. The RCQDs nanoprobe solution of claim 4, wherein in step (2) the solubility of the single-stranded AFP-aptamer modifying BHQ3 is 70 μmol/L.

6. The RCQDs nanoprobe solution of claim 5, wherein in step (2) the hybridization time is 60 min.