Background
Ebola hemorrhagic fever disease caused by Ebola virus (EBOV) was outbreaked in 1976, when 431 people died together with sudan in the congo democratic republic. In humans and non-human primates, EBOV often causes fatal hemorrhagic fever with mortality rates ranging from 50% to 90%. The traditional sterilizing vaccine has poor effect, and related vaccines are mainly constructed by recombinant viruses, such as virus-like particle vaccines, nucleic acid vaccines and live vector vaccines.
Ebola virus belongs to the order Mononegavirales (monogaviridae) Filoviridae (Filoviridae) ebola virus genus (Ebolavirus). The Bora virus consists of a non-segmented single-stranded antisense RNA of 18.9kb in length and 4.17X 10 molecular weight6Replication and transcription of the virion genome is accomplished internally. The EBOV genome comprises 7 genes and two regulatory regions, wherein the 7 genes are respectively transcribed by respective mrnas, have respective independent open reading frames, and are sequentially 3 '-NP-VP 35-VP40-GP-VP30-VP 24-L-5', and respectively encode Nucleoprotein (NP), matrix protein (VP40), Glycoprotein (GP), structural protein (VP30), small matrix protein (VP24) and RNA-dependent RNA polymerase (L).
GP protein (EBOV-GP) of Ebola virus is the only surface envelope protein of Ebola, forms a spike structure on the surface of an envelope, is combined with a cell surface receptor to mediate virus invasion, and is therefore a target protein for vaccine research. The EBOV-GP protein is a glycosylated membrane protein and thus its expression is difficult.
GP proteins expressed in E.coli are often present in the form of inclusion bodies; the expression in mammalian cells has relatively high requirements on the expression level and antigenicity. The vaccine is favored to express adenovirus and vesicular stomatitis virus recombinant RNA vaccine of GP mutant protein at present. The disadvantage of adenoviral vector vaccines is mainly the ubiquitous presence of pre-existing immunity in the human population. The vesicular stomatitis virus vector, as a live virus vector, has potential biological safety risks. Furthermore, ebola virus-like particle vaccines can achieve complete protection for non-human primates, but cannot be produced in large quantities.
The foreign protein expressed by the baculovirus expression system can effectively modify the protein, for example, the expressed foreign protein can be well modified by glycosylation, phosphorylation and the like; the baculovirus host domain is narrow, is safe to human and livestock, and is more suitable for expressing exogenous protein related to biological medicine; the virus particle structure of the Budding Virus (BV) of the baculovirus is relatively simple, especially the BV envelope component is only composed of more than twenty proteins, if the expressed exogenous protein can be assembled to the BV or even to the BV envelope, the BV is collected by ultracentrifugation, the BV is further cracked, and the BV envelope is collected, so that the target exogenous protein containing little host protein can be obtained, and the high-purity target protein can be conveniently further obtained for preparing vaccines and the like.
In view of the above, the present invention discloses the use of a fusion gene for increasing the expression level of Ebola membrane protein GP.
Drawings
FIG. 1 is a schematic diagram of the original virus, the control virus and the recombinant virus constructed to demonstrate the enhanced efficiency of the present invention; a: BmBacJS13 is a shuttle vector Bacmid having the same infection characteristics as Bombyx mori baculovirus BmNPV [ Construction of the Bac-to-Bac System of Bombyx mori nucleolysis virus, virology sinica.2007, 22 (3): 218-225]And stored in E.coli DH10B for use as the original virus. B: control virus (BmBac-egfp-gp): the full-length Ebola membrane protein GP gene is inserted into the genome of BmBacJS13, and a reporter gene (green fluorescent protein gene) is also inserted into the genome of BmBacJS13 for convenient observation.C: the invention relates to a virus (BmBac-egfp-gp)short): a truncated Ebola membrane protein GP gene is inserted into a BmBacJS13 genome and a nucleotide sequence is fused at the C end of the gene, so that a reporter gene (a green fluorescent protein gene) is also inserted into the BmBacJS13 genome for convenient observation.
FIG. 2 is a comparison graph of Ebola GP protein expression in BV of infected cells collected by infecting cells with control virus and recombinant virus constructed according to the method of the present invention; get 105The insect cells (taking silkworm ovarian cells BmN as an example) in the logarithmic growth phase of the virus are transferred into a 6-pore plate (each virus to be detected has 3 repeats); after adhering to the wall, two viruses, BmBac-egfp-GP and BmBac-egfp-GP are takenshortRespectively infecting the BmN cells at a dose of multiplicity of infection of 5 (after the viruses are added, the total volume is ensured to be consistent, and errors are reduced by supplementing fresh culture medium); after 2h of infection, removing the infection liquid, adding 2mL of fresh culture medium, and normally culturing in an incubator; after culturing for 48 hours at a time point of 0 hour when 2mL of fresh medium was added, BV was collected, boiled at high temperature, centrifuged at 12000rpm, and 5. mu.L of the supernatant was separated by SDS-PAGE, transferred to NC membrane by a conventional method, and then Western Blot detection was carried out. Incubating primary antibody with Ebola membrane protein GP polyclonal antibody, incubating secondary antibody with goat anti-rabbit polyclonal antibody marked by alkaline phosphatase, and finally adding NBT and BCIP for color development.
The color development is shown in FIG. 2, left, and the result shows that the GP band deepens in the collected BV of the cell infected by the recombinant virus, and the expression quantity is obviously increased. The grayscale values analyzed by Image J software are shown on the right of FIG. 2, indicating a 40% increase in expression.
FIG. 3 is a comparison graph of Ebola GP protein expression in BV envelope collected when cells are infected with recombinant viruses and control viruses constructed according to the methods of the present invention; get 105The logarithmic growth phase of the BmN cells was transferred into 6-well plates (3 replicates per virus to be tested); after adhering to the wall, two viruses, BmBac-egfp-GP and BmBac-egfp-GP are takenshortRespectively infecting the BmN cells at a dose of multiplicity of infection of 5 (after the viruses are added, the total volume is ensured to be consistent, and errors are reduced by supplementing fresh culture medium); after 2h of infection, removing the infection liquid, adding 2mL of fresh culture medium, and normally culturing in an incubator; to add 2The time point of the mL of fresh culture medium is 0h, after 48h of culture, centrifugation is carried out at 5000rpm for 5min to remove precipitates, the supernatant is transferred to an ultracentrifugation tube, and BV cyst membrane is obtained by membrane decomposition through ultracentrifugation.
Ultracentrifugation: 5mL of 20% sucrose solution was added to the ultracentrifuge tube, and 5mL of BV solution was slowly added to the upper liquid layer along the wall and centrifuged (25000rpm, 1.5 h). The supernatant was discarded and the pellet was dissolved overnight with 100. mu.L of TE buffer.
Membrane decomposing: taking 50 mu L of the ultracentrifuged sample, adding 2% NP-40 with the same volume, and standing for 0.5 h; transferring the lysate to 4mL of 30% glycerol, and performing ultracentrifugation (35000rpm, 1h, 4 ℃) under the condition that the mass error of each sample is 0; precipitating the upper layer (BV protein solution) with four times of precooled acetone for 2 h; centrifugation (12000rpm, 15min) added 10. mu.L of the protein-loaded buffer suspension sample.
8 μ L of the supernatant was separated by SDS-PAGE, transferred to NC membrane by a conventional method, and then subjected to Western Blot detection. Incubating primary antibody with Ebola membrane protein GP polyclonal antibody, incubating secondary antibody with goat anti-rabbit polyclonal antibody marked by alkaline phosphatase, and finally adding NBT and BCIP for color development.
The color development picture is shown in the left of figure 3, and the result shows that BV is collected in the cell infected by the recombinant virus, after BV membrane is dissolved, GP strips in the cyst membrane are deepened, and the expression quantity is obviously increased. The grayscale values analyzed by Image J software are shown on the right of FIG. 3, indicating a 68% increase in expression.
Detailed Description
The invention is further illustrated by the following figures and examples.
The implementation of the present invention is described with reference to the description of the bac-to-bac system operation (Invitrogen company) with silkworm baculovirus expression vector BmBacJS13 and silkworm ovarian cells BmN.
BmBacJS13 (fig. 1) is a shuttle vector Bacmid having the same infection characteristics as Bombyx mori baculovirus BmNPV [ Construction of the Bac-to-Bac System of Bombyx mori nucleolysis virus, virology sinica.2007, 22 (3): 218-225] in E.coli DH10B for use in the following method of this embodiment.
pFBD-egfp-GP1,2 is obtained by cloning the egfp gene and Epbrara membrane protein GP gene [ effective Expression and Processing of Ebola Virus Glycopterin indexes metals GP64, Viruses, 2019.11(11):1067] respectively in pFASTBC donor plasmid, which will be further modified by the present invention for the practice of the present invention.
The implementation steps are as follows:
construction of recombinant Bombyx mori baculovirus expressing full-length Ebola GP protein (reference virus, BmBac-egfp-GP, figure 1)
0.4 mu g of donor plasmid pFBD-egfp-gp1,2 was transformed into DH10B competent cells carrying BmBacJS13 and helper plasmid, and cultured in E.coli liquid medium at 37 ℃ for 4 h. Then screening recombinant Bacmid on a solid culture medium plate containing Kanamycin, Gentamicin, IPTG and X-gal, picking out white spot colonies, putting the white spot colonies into an escherichia coli liquid culture medium, culturing overnight, extracting DNA, further identifying by PCR, and screening correct recombinant Bacmid, which is named as BmBac-egfp-gp.
About 5X10 cells were seeded in 35mm cell culture dishes5After the BmN cells per dish are attached to the wall, the cells are transfected by using 2 mu L of lipofectin transfection reagent, 30 mu L of serum-free culture medium and 2 mu g of BmBac-egfp-gp DNA mixed solution, after transfection for 4h, the transfection mixed solution is removed, fresh culture medium is added for conventional culture, and after 72 h, supernatant is collected.
Collecting 50 mu L of supernatant, continuously infecting healthy BmN cells, collecting the supernatant for 72 hours, and naming the supernatant as vBmBac-egfp-gp.
Secondly, constructing a recombinant virus carrying a truncated Ebola membrane protein GP gene sequence and fusing a foreign sequence at the C end of the recombinant virus (BmBac-egfp-GP virus implemented by the invention)shortFIG. 1)
The first step is as follows: amplification of truncated Ebola envelope protein GP Gene
With primers 5 ' -CGCTCTAGAATGGGCGTTACAGGAATATTG- ' 3(Xba I) and 5 ' -CCCGGATCCGTCTCCATCCTGTCCACCAAT-' 3(Bam HI), using plasmid pFBD-egfp-GP1,2 containing Ebola envelope protein GP gene as a template, amplifying target gene by a PCR method, cutting amplified fragment by Xba I and Bam HI enzyme, and recovering for later use.
The second step is that: synthesis of exogenous sequences
Synthesizing:
5 'CGCGGATCCATGTTTGGTCATGTAGCTACCTTTGTAATTGTATTTATTGTAATTTTATTTTTGTACTGTATGGTTAGAAACCGTAATAGTAGACAATATTAAAAGCTTCCC 3', digested with BamHI and Hind III, recovered and used.
The third step: cleavage of Donor plasmid
The plasmid pFast-egfp-gp1,2 was digested with Xba I and Hind III, respectively, and the vector was recovered for use.
The fourth step: construction of truncated Ebola GP protein Gene and recombinant Donor plasmid fused with exogenous sequence
Connecting the two fragments and donor plasmid recovered in the first, second and third steps according to conventional molecular biology method, transforming DH10B competent cell, screening recombinant donor plasmid, identifying, and naming pFBD-egfp-gpshortThe DNA was extracted and dissolved in 20. mu.L of ultrapure water for use.
The fifth step: construction of recombinant Bombyx mori baculovirus carrying truncated Ebola GP protein gene and exogenous sequence
Taking 0.4 mu g of the construction vector pFBD-egfp-gpshortThe cells were transformed into DH10B competent cells harboring BmBacJS13 and helper plasmid, and cultured in E.coli liquid medium at 37 ℃ for 4 h. Then screening recombinant Bacmid on a solid culture medium plate containing Kanamycin, Gentamicin, IPTG and X-gal, picking out white spot colony to be put into an escherichia coli liquid culture medium, after overnight culture, extracting DNA, further identifying by PCR, screening correct recombinant Bacmid, and naming as BmBac-egfp-gpshort。
About 5X10 cells were seeded in 35mm cell culture dishes5The BmN cells per dish were attached, after attachment, with 2. mu.L lipofectin transfection reagent, 30. mu.L serum-free medium and 2. mu.g BmBac-egfp-gpshortAnd (3) transfecting the cells by using the DNA mixed solution, removing the transfection mixed solution after 4 hours of transfection, adding a fresh culture medium for conventional culture, and collecting a supernatant after 72 hours.
Collecting 50 mu L of supernatant, continuously infecting healthy BmN cells, collecting the supernatant for 72 hours, and naming the supernatant as vBmBac-egfp-gpshort。
Third, two viruses expressing Ebola GP protein Assemble onto BV virions with efficiency comparison (FIG. 2)
Each of the cells was seeded at about 5X10 in 4mL cell culture dishes5The BmN cells of each dish are adhered to the wall and respectively used with vBmBac-egfp-gp and vBmBac-egfp-gp with the same dosageshortCells were infected and BV was collected 48 hours post infection. Add 120. mu.L of 1 XLoading buffer, boil at 95 ℃ for 10 min, and centrifuge at 12000rpm for 5min to load.
A10% polyacrylamide gel was prepared and 5. mu.L of the sample was added to the well. The power is switched on, electrophoresis is carried out until the indicator runs to the bottom of the separation gel, and then the power is switched off. The glass plate was detached from the electrophoresis apparatus, the gel was taken out, the upper concentrated gel layer was cut off, and the Western Blot detection was carried out after the NC membrane was transferred by the conventional method. Incubating primary antibody with Ebola membrane protein GP polyclonal antibody, incubating secondary antibody with goat anti-rabbit polyclonal antibody marked by alkaline phosphatase, and finally adding NBT and BCIP for color development. Silkworm baculovirus GP64 protein is used as an internal reference. The results are shown on the left of FIG. 2. The efficiency of the assembly of the GP64 protein expressed by the two viruses onto BV was not changed, but there was a significant difference in the efficiency of the assembly of the expressed ebola GP protein onto BV. Western Blot results show vBmBac-egfp-gpshortThe expressed protein is assembled on BV, the detection band is obviously deepened, and the software analysis data further shows that the assembly efficiency is high. The results are shown on the right of FIG. 2.
Four, two viruses expressing Ebola GP protein Assemble onto BV virion envelope efficiency comparisons (FIG. 3)
Each of the cells was seeded at about 5X10 in 4mL cell culture dishes5The BmN cells of each dish are adhered to the wall and respectively used with vBmBac-egfp-gp and vBmBac-egfp-gp with the same dosageshortCells were infected and BV was collected 48 hours post infection.
Ultracentrifugation: 5mL of 20% sucrose solution was added to the ultracentrifuge tube, and 5mL of BV solution was slowly added to the upper liquid layer along the wall and centrifuged (25000rpm, 1.5 h). The supernatant was discarded and the pellet was dissolved overnight with 100. mu.L of TE buffer.
Membrane decomposing: taking 50 mu L of the ultracentrifuged sample, adding 2% NP-40 with the same volume, and standing for 0.5 h; transferring the lysate to 4mL of 30% glycerol, and performing ultracentrifugation (35000rpm, 1h, 4 ℃) under the condition that the mass error of each sample is 0; precipitating the upper layer (BV protein solution) with four times of precooled acetone for 2 h; centrifugation (12000rpm, 15min) added 5X 10. mu.L of the loading buffer suspension.
A10% polyacrylamide gel was prepared and 8. mu.L of the sample was added to the well. The power is switched on, electrophoresis is carried out until the indicator runs to the bottom of the separation gel, and then the power is switched off. The glass plate was detached from the electrophoresis apparatus, the gel was taken out, the upper concentrated gel layer was cut off, and the Western Blot detection was carried out after the NC membrane was transferred by the conventional method. Incubating primary antibody with Ebola membrane protein GP polyclonal antibody, incubating secondary antibody with goat anti-rabbit polyclonal antibody marked by alkaline phosphatase, and finally adding NBT and BCIP for color development. Silkworm baculovirus GP64 protein is used as an internal reference. The results are shown in FIG. 3, left. The efficiency of the GP64 protein expressed by the two viruses to assemble to the BV envelope did not change, but there was a significant difference in the efficiency of the expressed ebola GP protein to assemble to the BV envelope. Western Blot results show vBmBac-egfp-gpshortThe expressed protein is assembled on BV, the detection band is obviously deepened, and the software analysis data further shows that the assembly efficiency is high. The results are shown on the right of FIG. 3.
Sequence listing
<110> university of Jiangsu science and technology
<120> fusion gene and application thereof
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 93
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
atgtttggtc atgtagctac ctttgtaatt gtatttattg taattttatt tttgtactgt 60
atggttagaa accgtaatag tagacaatat taa 93
<210> 2
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
cgctctagaa tgggcgttac aggaatattg 30
<210> 3
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
cccggatccg tctccatcct gtccaccaat 30
<210> 4
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
cgctctagaa tgggcgttac aggaatattg 30
<210> 5
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
cccggatccg tctccatcct gtccaccaat 30
<210> 6
<211> 111
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
cgcggatcca tgtttggtca tgtagctacc tttgtaattg tatttattgt aattttattt 60
ttgtactgta tggttagaaa ccgtaatagt agacaatatt aaaagcttcc c 111