CN112359025B - Mutein AnLPMO15g-Ep3 and construction method, expression and application thereof - Google Patents

Abstract

The invention provides a mutant protein AnLPMO15g-Ep3 and a construction method, expression and application thereof, wherein the nucleotide sequence of the mutant protein AnLPMO15g-Ep3 is shown in SEQ ID NO. 1. The mutant protein is obtained by directed evolution by utilizing an error-prone PCR technology, can be applied to degradation of lignocellulose, provides a theoretical basis for development of novel cellulose degrading enzymes and efficient lignocellulose degrading enzyme systems, and has a wide application prospect in the field of biorefinery.

Description

Mutein AnLPMO15g-Ep3 and construction method, expression and application thereof

Technical Field

The invention belongs to the technical field of bioengineering, and particularly relates to a mutein AnLPMO15g-Ep3, and a construction method, expression and application thereof.

Background

Lignocellulose is one of the most abundant and potential renewable resources on the earth, but the complex network structure of lignocellulose hinders efficient enzymolysis and utilization of lignocellulose, and at present, research mainly focuses on expression optimization, directional modification and the like of a cellulose degradation enzyme system so as to improve the expression quantity and the enzyme activity of cellulase. In addition, the problems of high-efficiency enzymolysis and utilization of lignocellulose can be effectively solved by excavating novel cellulase, auxiliary protein and constructing a high-efficiency cellulose degrading enzyme system.

So far, the most effective method for modifying and obtaining a superior mutant enzyme is random mutagenesis, which is an irrational design, also called directed evolution, unlike rational design such as site-directed mutagenesis, which is limited by the knowledge of the gene and requires a definite direction. The common means is error-prone PCR, which is widely used because it does not require protein structural information and is simple to operate.

In order to improve the enzymatic efficiency, in recent years, accessory proteins such as swollenin, CBM module, AA9 family Lytic Polysaccharide Monooxygenase (LPMO) and the like have entered the field of people. Among them, the AA9 family LPMO is one of the most potential helper proteins for applications. The extracellular AA9 family polysaccharide monooxygenase AnLPMO15g is derived from Aspergillus niger, and can break the polysaccharide chain of a cellulose substrate by means of oxidation of metal ions and a reduction type electron donor to provide more binding sites for cellulase, so that the degradation efficiency of lignocellulose is improved. Currently, the reported directed evolution of AA9 is still limited, and the directed evolution of aspergillus niger AA9 family polysaccharide monooxygenase AnLPMO15g has important significance for the research of AA9 active sites and the improvement of lignocellulose enzymolysis efficiency.

Through searching, no patent publication related to the present patent application has been found.

Disclosure of Invention

Aiming at the defects of the prior art, the invention provides a mutant protein AnLPMO15g-Ep3 and a construction method, expression and application thereof, wherein an error-prone PCR technology is utilized to directionally evolve Aspergillus niger AA9 family polysaccharide monooxygenase AnLPMO15g to obtain the mutant protein, and the mutant protein can be applied to degradation of lignocellulose, provides a theoretical basis for development of novel cellulose degrading enzymes and efficient lignocellulose degrading enzyme systems, and has wide application prospects in the field of biorefinery.

In order to achieve the purpose, the technical scheme adopted by the invention is as follows:

a mutein AnLPMO15g-Ep3, the nucleotide sequence of the mutein AnLPMO15g-Ep3 is shown in SEQ ID No. 1.

Further, the mutant protein AnLPMO15g-Ep3 is constructed by taking an extracellular AA9 family polysaccharide monooxygenase AnLPMO15g as an original enzyme through error-prone PCR mutation screening, wherein the AnLPMO15g is derived from Aspergillus niger CBS513.88.

The NCBI gene ID of the Aspergillus niger CBS513.88 is NT _166530.1.

The invention also provides a preparation method of the coding gene of the mutant protein AnLPMO15g-Ep3, which comprises the following steps:

s1: taking the genomic DNA of Aspergillus niger CBS513.88 as a template, taking an upstream primer and a downstream primer as amplification primers, wherein the upstream primer and the downstream primer are SEQ NO.2 and SEQ NO.3, and carrying out PCR amplification to obtain an encoding gene segment of extracellular AA9 family polysaccharide monooxygenase AnLPMO15 g;

s2: by altering Mg in error-prone PCR ²⁺ And Mn ²⁺ The concentration of the mutant protein is that the template DNA segment of extracellular AA9 family polysaccharide monooxygenase AnLPMO15g is mutated and amplified by taking SEQ NO.4 and SEQ NO.5 as an upstream primer and a downstream primer, and the screened mutated gene segment forms a mutant gene, namely the coding gene of the mutant protein AnLPMO15g-Ep3.

Further, said Mg ²⁺ The concentration is 20-30mM ²⁺ At a concentration of 40-60mM, preferably said Mg ²⁺ The concentration was 25mM ²⁺ The concentration is 50mM;

the nucleotide sequences of SEQ NO.2, SEQ NO.3, SEQ NO.4 and SEQ NO.5 are as follows:

SEQ NO.2：5’-GCGCGAATTCCACGGTCACGTCACTAACCTCGTCGT-3’；

SEQ NO.3：5’-TATATGCGGCCGCTTAGTGATGGTGATGGTGATGAGCACTAGCAATGCACTGGTAGTAGTA-3’；

SEQ NO.4：5’-GCTGAAGCTTACGTAGAATTCCACACCACCGTCCAGGCC-3’；

SEQ NO.5：5’-CGCGGCCGCCCTAGGTTAGTGATGGTGATGGTGATGCTG-3’。

the invention also provides a recombinant vector pPic9k-AnLPMO15g-Ep3 of the coding gene of the mutein AnLPMO15g-Ep3.

The invention also provides a preparation method of the recombinant vector pPic9k-AnLPMO15g-Ep3, which comprises the following steps:

the pPic9k vector was digested with EcoRI and digested with

II, connecting the enzyme-digested pPic9k vector with the encoding gene fragment of the mutein AnLPMO15g-Ep3 by using recombinase, transforming, and extracting a plasmid to obtain a recombinant vector.

The invention also provides a recombinant pichia pastoris engineered strain GS115-AnLPMO15g-Ep3 containing the recombinant vector pPic9k-AnLPMO15g-Ep3 as claimed in claim 5.

The invention also provides a construction method of the recombinant pichia pastoris engineering strain GS115-AnLPMO15g-Ep3, which comprises the following steps:

s1: carrying out linearization on the recombinant vector pPic9k-AnLPMO15g-Ep3 by BglII enzyme to obtain a linear enzyme digestion product;

s2: and (3) taking pichia pastoris as a host bacterium, transferring the linear enzyme digestion product obtained in the step (S1), and screening positive clones through resistance to obtain a recombinant pichia pastoris engineering strain GS115-AnLPMO15g-Ep3.

The invention also provides a method for preparing the mutein AnLPMO15g-Ep3 by the recombinant Pichia pastoris engineering strain GS115-AnLPMO15g-Ep3, which comprises the following steps:

s1: inoculating and culturing the recombinant pichia pastoris engineering strain GS115-AnLPMO15g-Ep3, and inducing the expression of the strain;

s2: and (4) harvesting the expression product of the step S1, and purifying to obtain the mutein AnLPMO15g-Ep3.

The invention also provides application of the mutein AnLPMO15g-Ep3 in the degradation of microcrystalline cellulose and/or lignocellulose.

Compared with the prior art, the invention has the advantages and positive effects that:

the mutein AnLPMO15g-Ep3 provided by the invention is prepared by changing Mg by using error-prone PCR technology ²⁺ And Mn ²⁺ The target fragment is amplified in concentration, and the mutant protein is obtained by expression and purification in pichia pastoris. The yield of reducing sugar degraded by microcrystalline cellulose, filter paper and straw powder can be respectively improved by the mutant protein after the directed evolution, and the yield of reducing sugar degraded by mutant protein enzyme after the directed evolution is respectively improved by about 70.15 percent and 28 percent compared with the yield of reducing sugar generated before the directed evolution59.34 percent of the mutant protein, the invention provides theoretical basis for developing novel cellulose degrading enzyme and high-efficiency lignocellulose degrading enzyme system, and the mutant protein has great application potential and economic benefit in the biological energy and bio-based chemical industry.

Drawings

FIG. 1 is a SDS-PAGE analysis of the mutein AnLPMO15g-Ep3 of example 3 according to the invention;

FIG. 2 is a graph showing the analysis of the reducing sugar yields obtained by hydrolyzing microcrystalline cellulose, filter paper and straw foundation with the mutein AnLPMO15g-Ep3 of the present invention, respectively;

FIG. 3 is a scanning electron microscope comparison graph of a substrate microcrystalline cellulose after enzymolysis of the mutein and a microcrystalline cellulose substrate without protein addition in example 4 of the invention, wherein a and b are scanning electron microscope graphs of the microcrystalline cellulose substrate without protein addition, and c and d are scanning electron microscope graphs of the microcrystalline cellulose substrate after enzymolysis of the mutein;

FIG. 4 is a comparison of the scanning electron microscope images of the substrate filter paper after the enzymatic hydrolysis of the mutein in example 5 of the present invention and the filter paper substrate without protein addition, wherein a and b are the scanning electron microscope images of the filter paper substrate without protein addition, and c and d are the scanning electron microscope images of the filter paper substrate after the enzymatic hydrolysis of the mutein.

Detailed Description

The following detailed description of the embodiments of the present invention is provided for the purpose of illustration and not limitation, and should not be construed as limiting the scope of the invention.

The raw materials used in the invention are conventional commercial products unless otherwise specified; the methods used in the present invention are conventional in the art unless otherwise specified.

Example 1: acquisition of target gene of directed evolution polysaccharide monooxygenase AnLPMO15g-Ep3

(1) Inoculating Aspergillus niger CBS513.88 spores stored in a glycerin tube to a PDA plate by adopting a plate marking method for activation, sealing, carrying out inverted culture in an incubator at 28 ℃ for 4-5 days until thalli growing on the plate become brown, washing the spores on the surface by using sterilized deionized water, sucking spore suspension, adding into a shake flask filled with 50mL of wort culture medium, and carrying out culture at 28 ℃ and 200rpm for 2-3 days.

(2) Filtering the cultured culture medium to obtain mycelium, sucking residual liquid on the mycelium with filter paper as much as possible, putting the mycelium into a precooled mortar, adding liquid nitrogen, and quickly grinding the mycelium into powder. Storing the ground mycelium powder at-80 deg.C. Total RNA of Aspergillus niger was extracted using a plant Total RNA extraction kit from Tiangen, and was reverse transcribed into cDNA using a reverse transcription kit from Solebao.

(3) The target gene with the signal peptide removed is amplified by a PCR method. The primers used were as follows:

the nucleotide sequences of the upstream primer and the downstream primer are shown as follows:

an upstream primer: 5' GCGCGCGAATTCCACGTCACGTCACTAACCTCGTCGT-;

a downstream primer: 5' -TATATGCGGCCGCTTAGTGATGGTGATGGTGGTGATGAGCA

CTAGCAATGCACTGGTAGTAGTA-3’。

The PCR system was 1. Mu.L of cDNA, 0.5. Mu.L each of the forward and reverse primers, and 10. Mu.L of 2 XPyrobest Mix, supplemented with deionized water to 20. Mu.L. The program is 94 ℃,10min;94 ℃,5min,55 ℃,30 seconds, 72 ℃,1 minute and 10 seconds, and 30 cycles; storing at 72 deg.C, 7min,4 deg.C, performing agarose electrophoresis to verify correct strip, and recovering correct strip with Solebao gel recovery kit.

(4) The target gene is obtained by an error-prone PCR method, and the primers are as follows:

an upstream primer: 5 'GCTGAAGCTTACGTAGAATTCCACCACCGTCCAGGCC 3';

a downstream primer: 5' CGCGGCCGCCCTAGGTTAGTGATGGTGATGGTGGTGATGCTGC-.

The PCR system was 1. Mu.L of cDNA, 1. Mu.L each of the forward and reverse primers, and 10 XPCR Buffer (Mg) ²⁺ free)5μL，d ATP 0.1μL，d GTP 0.1μL，d CTP 0.5μL，d TTP 0.5μL，rTaq1μL，50mM Mn ²⁺ 0.5μL，25mM MgCl ₂ 10 μ L, and adding deionized water to 50 μ L. The program was 95 ℃ for 5 minutes; 30 cycles of 94 ℃,45 seconds, 55 ℃,45 seconds, 72 ℃,50 seconds; storing at 72 deg.C and 10min, and at 4 deg.C, and performing agarose electrophoresis to verify stripCorrect bands were recovered using the glue recovery kit from solibao.

Example 2: construction of recombinant vector pPic9k-AnLPMO15g-Ep3 comprising the nucleotide sequence of mutein AnLPMO15g-Ep3

(1) Carrying out single enzyme digestion on the pPic9k vector by using EcoRI, wherein the volume of the plasmid is 20 mu L; ecoR I2. Mu.L; 10 × Buffer 5 μ L; adding deionized water to 50 mu L to prepare a 50 mu L EcoR I single enzyme digestion system, carrying out water bath at 37 ℃ for 2.5h, and recovering the enzyme digestion product by using a purification recovery kit of Novozan company.

(2) Use of nunoprazan

II One Step Cloning Kit for ligation of the digested plasmid and the gene fragment, the ligation system is as follows: 2. Mu.L of gene, 2. Mu.L of pPic9k,

1 μ L of II, 2 μ L of 5 XCE II Buffer, and adding deionized water to 10 μ L. Placed in a 37 ℃ water bath for 45 minutes.

(3) Coli competence was transformed with the ligated plasmid. And adding 10 mu L of the ligation product obtained in the previous step into 100 mu L of escherichia coli DH5 alpha competence, gently mixing uniformly, and standing on ice for 30min. The mixture of the previous step is heated in a water bath at 42 ℃ for 90 seconds, and immediately placed on ice for 3-5min. 1mL of LB medium without ampicillin was added to the centrifuge tube. Shaking and culturing for 1h at 120rpm in a constant-temperature shaking table at 37 ℃, coating 100 mu L of the culture solution on an LB (Luria-Luria) plate containing ampicillin (1%), carrying out inverted culture in an incubator at 37 ℃ overnight, selecting a universal primer AOX1 for carrying out PCR (polymerase chain reaction) verification on positive clones, sending the correctly verified fresh bacterial solution to a Jinzhi corporation for sequencing, and obtaining a successfully constructed plasmid with correct sequencing result. Plasmids were extracted using the Novozam plasmid miniprep kit. The universal primers are as follows:

AOX1-F 5’-GACTGGTTCCAATTGACAAGC-3’

AOX1-R 5’-GCAAATGGCATTCTGACATCC-3’

example 3: construction and induced expression of recombinant pichia pastoris engineering strain GS115-AnLPMO15g-Ep3 containing recombinant vector pPic9k-AnLPMO15g-Ep3

(1) The recombinant vector pPic9k-AnLPMO15g-Ep3 was linearized with BglII enzyme, according to plasmid, 25. Mu.L; bglII 2. Mu.L; buffer H5. Mu.L; ddH ₂ And preparing 50 mu L of linearized system by using 18 mu L of O, performing water bath at 37 ℃ for 2.5h, and purifying by using a purification recovery kit of Novoxel company after the nucleic acid electrophoresis is verified to be correct.

(2) Pichia pastoris was transformed to be competent. And adding 10 mu L of the linear plasmid obtained in the previous step into 80 mu L of competence, uniformly mixing, transferring into a pre-cooled electric rotor cup of 0.2cm, and placing the electric rotor cup on ice for standing for 5min. The electrotransformation machine was set to a voltage of 1500V, a resistance of 200 Ω, a capacitance of 20 μ F, and a shock time of 5 ms. Immediately adding 1mL of precooled sorbitol into the cup after electric shock, uniformly mixing, transferring the bacterial liquid into a sterilized 1.5mL centrifuge tube, sealing, and then statically culturing for 1h in an incubator at 30 ℃. After the precipitated bacteria were resuspended, 200. Mu.L of the suspension was spread on an MD plate and inverted in a 30 ℃ incubator for 2 to 3 days until the colonies were produced. And (3) selecting positive clones to YPD plates added with different concentrations of G418, culturing for 2-3 days, selecting colonies with larger growth for colony PCR verification, and storing strains with correct verification.

(3) The correct positive clones were inoculated into 5mL BMGY liquid medium at 30 ℃ and 220rpm with shaking overnight. The overnight cultures were inoculated at 1% inoculum size into 25mLBMGY medium and incubated at 30 ℃ with shaking at 200rpm to an OD600 of 2-6 (log phase, approximately 12-16 h). The culture was transferred to a 50mL centrifuge tube, centrifuged at 5000rpm for 5min, the supernatant was discarded, the cells were resuspended to an OD600 of 1.0 with 50mL BMMY broth, and methanol was added to a concentration of 0.5%. The culture broth was transferred to a 250mL shake flask and cultured with shaking at 30 ℃ and 250 rpm. Samples were taken every 24h and OD600 was measured, and the supernatant was collected by centrifugation at 12000rpm for 1 min. Methanol is supplemented every 24h until the final concentration is 0.5%, and after the optimal induction time is reached, the culture is centrifuged at 7500rpm for 10min, and the supernatant is collected. The supernatant was purified by Ni column and dialyzed against 50mM citrate buffer pH5.0 to recover the protein, and the recovered protein was analyzed by SDS-PAGE, as shown in FIG. 1, and the electrophoresis result of AnLPMO15g-Ep3 was about 66KD, which did not change the protein size as compared with the original enzyme, and the results were confirmed to be correct.

Example 4: activity assay for the mutein AnLPMO15g-Ep3 hydrolysed microcrystalline cellulose

The enzymatic mixture contained 1% microcrystalline cellulose substrate, 0.9mg/g AnLPMO15g-Ep3/AnLPMO15g protein/no protein, 10mM ascorbic acid, buffered with 50mM sodium acetate buffer pH5.0 to a final volume of 1mL. And (3) placing the different systems at 50 ℃ and 200rpm for reaction for 48h, heating in a boiling water bath for 5min to terminate the reaction, centrifuging at 12000rpm for 1min, taking the supernatant, and measuring the yield of reducing sugar by using a DNS method. The results are shown in fig. 2, and the amount of reducing sugar produced by enzymolysis of microcrystalline cellulose by the mutein AnLPMO15g-Ep3 is increased by 70.15% compared with that before directed evolution. As shown in fig. 3, when the microcrystalline cellulose substrate obtained after enzymolysis of the mutein AnLPMO15g-Ep3 is observed under a Scanning Electron Microscope (SEM) with different multiples, the microcrystalline cellulose substrate becomes fluffy and porous when compared with the microcrystalline cellulose substrate without protein, and thus the crystal structure of the microcrystalline cellulose substrate is damaged to a great extent after the treatment of the mutein AnLPMO15g-Ep3.

Example 5: activity assay of the mutein AnLPMO15g-Ep3 hydrolysis Filter paper

The enzymolysis mixture system contains 0.01g of filter paper, 100. Mu.L of AnLPMO15g-Ep3/AnLPMO15g protein/non-protein, 10mM ascorbic acid, and 900. Mu.L of 50mM, pH5.0 sodium acetate buffer solution is taken as a buffer solution by a pipette, so that the final volume is 1mL. And (3) placing the different systems at 50 ℃, reacting for 48h at 200rpm, heating in a boiling water bath for 5min to terminate the reaction, centrifuging for 1min at 12000rpm, taking the supernatant, and measuring the yield of the reducing sugar by using a DNS method. As shown in FIG. 2, the amount of reducing sugars produced by enzymolysis of the filter paper with the mutein AnLPMO15g-Ep3 was increased by 28% relative to that before directed evolution. As shown in FIG. 4, when the substrate filter paper after the zymohydrolysis of the mutant protein AnLPMO15g-Ep3 is observed under SEM of different times, the filter paper substrate becomes fluffy and porous when compared with the filter paper substrate without protein, and the structure of the filter paper substrate is damaged to a great extent after the treatment of the AnLPMO15g-Ep3.

Example 6: analysis of the hydrolytic Activity of the mutein AnLPMO15g-Ep3 on lignocellulose

The enzymatic mixture contained 1% straw foundation, 0.9mg/g AnLPMO15g-Ep3/AnLPMO15g protein/no protein, 10mM ascorbic acid, buffered with 50mM, pH5.0 sodium acetate buffer to a final volume of 1mL. And (3) placing the different systems at 50 ℃ and 200rpm for reaction for 48h, heating in a boiling water bath for 5min to terminate the reaction, centrifuging at 12000rpm for 1min, taking the supernatant, and measuring the yield of reducing sugar by using a DNS method. The results are shown in fig. 2, and the amount of reducing sugar produced by the straw powder enzymolyzed by the mutant protein AnLPMO15g-Ep3 is increased by 59.34 percent relative to that before the directed evolution.

Although the embodiments of the present invention have been disclosed for illustrative purposes, those skilled in the art will appreciate that: various substitutions, changes and modifications are possible without departing from the spirit and scope of the invention and the appended claims, and therefore the scope of the invention is not limited to the disclosure of the embodiments and the accompanying drawings.

Claims (7)

1. A mutein AnLPMO15g-Ep3 characterized by: the nucleotide sequence of the mutein AnLPMO15g-Ep3 is shown in SEQ ID NO. 1.

2. The mutein AnLPMO15g-Ep3 according to claim 1, characterized in that: the mutant protein AnLPMO15g-Ep3 is constructed by taking an extracellular AA9 family polysaccharide monooxygenase AnLPMO15g as an original enzyme through error-prone PCR mutation screening, wherein the AnLPMO15g is derived from Aspergillus niger CBS513.88.

3. A recombinant vector pPic9k-AnLPMO15g-Ep3 comprising the gene encoding the mutein AnLPMO15g-Ep3 of claim 1.

4. A recombinant Pichia pastoris engineered strain GS115-AnLPMO15g-Ep3 comprising the recombinant vector pPic9k-AnLPMO15g-Ep3 of claim 3.

5. The construction method of the recombinant Pichia pastoris engineered strain GS115-AnLPMO15g-Ep3 according to claim 4, characterized in that: the method comprises the following steps:

s1: carrying out linearization on the recombinant vector pPic9k-AnLPMO15g-Ep3 by BglII enzyme to obtain a linear enzyme digestion product;

s2: and (3) taking pichia pastoris as a host bacterium, transferring the linear enzyme digestion product obtained in the step (S1), and screening positive clones through resistance to obtain a recombinant pichia pastoris engineering strain GS115-AnLPMO15g-Ep3.

6. The method for preparing the mutein AnLPMO15g-Ep3 by using the recombinant Pichia pastoris engineered strain GS115-AnLPMO15g-Ep3, according to claim 5, is characterized in that: the method comprises the following steps:

s1: inoculating and culturing the recombinant pichia pastoris engineering strain GS115-AnLPMO15g-Ep3, and inducing the expression of the strain;

s2: and (4) harvesting the expression product of the step S1, and purifying to obtain the mutein AnLPMO15g-Ep3.

7. Use of the mutein AnLPMO15g-Ep3 according to any one of claims 1 to 2 for the degradation of microcrystalline cellulose and/or lignocellulose.

Images