CN112359004A - Application of enhanced expression yvbW gene in improvement of indoleacetic acid yield of bacillus amyloliquefaciens - Google Patents
Application of enhanced expression yvbW gene in improvement of indoleacetic acid yield of bacillus amyloliquefaciens Download PDFInfo
- Publication number
- CN112359004A CN112359004A CN202011237251.3A CN202011237251A CN112359004A CN 112359004 A CN112359004 A CN 112359004A CN 202011237251 A CN202011237251 A CN 202011237251A CN 112359004 A CN112359004 A CN 112359004A
- Authority
- CN
- China
- Prior art keywords
- yvbw
- bacillus amyloliquefaciens
- gene
- phy
- indoleacetic acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
- C12P17/10—Nitrogen as only ring hetero atom
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention belongs to the field of genetic engineering, and particularly discloses application of an enhanced expression yvbW gene in improving the yield of indoleacetic acid of bacillus amyloliquefaciens, wherein the enhanced expression is performed in bacillus amyloliquefaciens LX-12 through a genetic engineering methodyvbWGene, obtainyvbWExpression-enhanced Bacillus amyloliquefaciens LX-12/pHY-yvbW. Relative to a reference strain Bacillus amyloliquefaciens LX-12/pHY-300, the Bacillus amyloliquefaciens engineering strain LX-12/pHY-obtained by the construction methodyvbWThe yield of the indoleacetic acid after fermentation is improved by at least 39 percent, and a new method is provided for improving the yield of the indoleacetic acid.
Description
Technical Field
The invention belongs to the field of genetic engineering, and particularly relates to application of an enhanced expression yvbW gene in improving the yield of indoleacetic acid of bacillus amyloliquefaciens.
Background
The Bacillus amyloliquefaciens (Bacillus amyloliquefaciens) has wide antibacterial capacity and wide application prospect in the aspects of planting, breeding, disease control, environmental protection and the like. As a good probiotic, the probiotic is widely applied to the prevention and treatment of animal and plant pathogenic fungi and bacteria; as biological pesticides, there is a tendency to replace conventional chemical pesticides.
Indoleacetic acid (IAA) is an endogenous auxin commonly existing in plants, belongs to indole compounds, and is mainly present in parts with vigorous growth, such as coleoptiles, root tips, fertilized ovaries, young seeds and the like, in higher plants. Although the content in the plant is very small, the plant participates in the regulation and control of a plurality of physiological and biochemical processes, and has quite wide physiological effects. In a proper concentration range, the IAA can stimulate the formation of root hairs, improve the number and the length of transverse and primary roots and enhance the absorption of nutrition by a plant root system. In recent years, IAA is closely related to the stress resistance of plants, and through absorption and enrichment of heavy metals in soil, IAA can reduce the toxicity of the heavy metals on the plants, thereby playing a role in protecting the plants.
yvbW has been shown to be transcribed as a monocistronic mRNA containing a typical T-box anti-termination leader. YvbW was annotated as a putative amino acid permease, and in previous studies, Cai et al increased intracellular catena amino acid concentrations by enhancing expression of YvbW, which in turn increased the levels of bacitracin, a cyclic peptide antibiotic. However, it is not clear whether YvbW affects, and how, the synthesis of indole acetic acid.
Disclosure of Invention
The invention aims to provide application of an enhanced expression yvbW gene in improving the yield of indoleacetic acid of bacillus amyloliquefaciens, wherein the yvbW gene is shown as SEQ ID NO. 1.
In order to achieve the purpose, the invention adopts the following technical measures:
the application of the enhanced expression of the yvbW gene in improving the yield of indoleacetic acid of bacillus amyloliquefaciens comprises the steps of utilizing the conventional technology of the invention to enhance the expression of the yvbW gene in the bacillus amyloliquefaciens, wherein a strain with the enhanced expression of the yvbW gene can be used for fermentation production of the indoleacetic acid; the yvbW gene is shown as SEQ ID NO. 1.
In the above application, preferably, the bacillus amyloliquefaciens is a strain with indoleacetic acid in metabolites;
in the above application, preferably, the preservation number of the bacillus amyloliquefaciens is CCTCC NO: m2015234.
In the above-mentioned application, the preparation method of the strain involved in the application process comprises:
(1) PCR is carried out by taking Bacillus licheniformis DW2 genome DNA as a template to obtain yvbW gene segment;
(2) the P43 promoter, the yvbW gene and the amylase terminator were ligated together by overlap extension PCR to construct a desired gene expression cassette, which was arranged in the order: p43 promoter-yvbW gene-amylase terminator;
(3) carrying out double enzyme digestion on the target gene fragment by adopting SacI and XbaI restriction endonucleases to obtain an enzyme digestion fragment;
(4) preparing a plasmid pHY-300, and carrying out double enzyme digestion on the plasmid pHY-300 by adopting SacI and XbaI restriction endonucleases to obtain a linear plasmid fragment;
(5) connecting the enzyme digestion fragment obtained in the step (3) with the linear plasmid fragment obtained in the step (4) by using DNA ligase to obtain a free expression plasmid pHY-yvbW;
(6) transferring the free expression plasmid pHY-yvbW into escherichia coli DH5 alpha, screening to obtain a positive transformant by taking tetracycline resistance as a screening marker, carrying out colony PCR verification, extracting the plasmid of the positive transformant which is successfully verified, electrically converting the plasmid into the bacillus amyloliquefaciens LX-12, screening to obtain the positive transformant by taking the tetracycline resistance as the screening marker, and carrying out colony PCR detection to obtain the bacillus amyloliquefaciens LX-12/pHY-yvbW strain for strengthening expression of yvbW genes.
In the above-mentioned scheme, preferably, when the fermentation production of the indoleacetic acid is carried out by using the bacillus amyloliquefaciens strain which can enhance the expression of the yvbW gene in the application process, the formula of the fermentation medium is as follows: 15-25g/L glucose; 4-6g/L L-monosodium glutamate; 0.5-1g/L L-tryptophan; 0.5-1.5g/L yeast extract; 0.5-1.5g/L KH2PO4(ii) a 0.5-1g/L KCl and 0.5-1g/LMgSO4·7H2O, pH7.00-7.20, and the balance of water.
Compared with the prior art, the invention has the following advantages:
compared with the Bacillus amyloliquefaciens LX-12, the indole acetic acid yield of the Bacillus amyloliquefaciens LX-12/pHY-yvbW constructed by the invention is improved by more than 39 percent. The research result of the invention shows that: the enhancement expression of the yvbW gene in the bacillus licheniformis DW2 provides a new method for improving the yield of indoleacetic acid of the bacillus amyloliquefaciens LX-12.
Detailed Description
The following examples are further illustrative of the present invention and are not intended to be limiting thereof. The technical scheme of the invention is a conventional scheme in the field if not specifically stated; the reagents or materials, if not specifically mentioned, are commercially available.
Example 1:
obtaining the yvbW gene enhanced expression Bacillus amyloliquefaciens (Bacillus amyloliquefaciens) LX-12/pHY-yvbW:
the nucleotide sequence of the yvbW gene is shown as SEQ ID NO. 1.
(1) Designing an upstream primer (yvbW-F) and a downstream primer (yvbW-R) of the yvbW gene according to the yvbW gene sequence in the genome DNA sequence of Bacillus licheniformis DW 2; PCR amplification is carried out by taking Bacillus licheniformis DW2 genome DNA as a template and respectively taking an upstream primer and a downstream primer of the yvbW gene to obtain a yvbW gene fragment (1368 bp);
wherein the sequences of yvbW-F and yvbW-R are as follows:
yvbW-F：TAAGAGAGGAATGTACACATGGAGAAAGACATGCAG；
yvbW-R：TCCGTCCTCTCTGCTCTTTTAAGAAGCGGACGTTTG；
then, using the genomic DNA of the bacillus amyloliquefaciens LX-12 as a template, and respectively amplifying by PCR to obtain a P43 promoter (the used primers are P43-F and P43-R) and an amylase terminator (the used primers are TamyL-F and TamyL-R);
wherein the sequence of P43-F, P43-R, TamyL-F, TamyL-R is:
P43-F：GGTCTAGATGATAGGTGGTATGTTTT
P43-R：CTGCATGTCTTTCTCCATGTGTACATTCCTCTCTTA
TamyL-F：CAAACGTCCGCTTCTTAAAAGAGCAGAGAGGACGGA
TamyL-R：GGGAGCTCCGCAATAATGCCGTCGCA
(2) the P43 promoter, the yvbW gene and the amylase terminator are connected together by overlap extension PCR (the primers are P43-F and TamyL-R), so that a gene expression cassette of a yvbW gene fragment is obtained, wherein the upstream of the yvbW gene fragment is connected with the P43 promoter, and the downstream of the yvbW gene fragment is connected with the amylase terminator, the fragment is a complete yvbW expression cassette (2169bp), and the sequence is as follows: p43 promoter-yvbW gene-amylase terminator;
(3) carrying out double enzyme digestion on the target gene fragment by using XbaI and SacI restriction endonucleases to obtain an enzyme digestion fragment (2167 bp);
(4) plasmid pHY-300 was prepared, and plasmid pHY-300 was digested by XbaI and SacI restriction enzymes in a double manner (the construction method is described in Kyowa, Ursus et al (1991) construction of a Bacillus subtilis-Escherichia coli multifunctional shuttle vector, Bioengineering reports 7(3) construction of 224. sub.229 and Pengzhi, Zhang Shuji et al (2002) construction of a Bacillus brevis-Escherichia coli shuttle secretion expression vector, Bioengineering reports 18(4) 438. sub.441) to obtain a linear plasmid fragment (4250 bp). Wherein the restriction enzymes XbaI and SacI restriction enzymes are purchased from Beijing Quanji Biotechnology GmbH;
(5) connecting the enzyme digestion fragment obtained in the step (3) and the linear plasmid fragment obtained in the step (4) by using DNA ligase (commercially available DNA ligase can be used, and T4 DNA ligase is common) to obtain a connection product; the ligation product is transferred into Escherichia coli DH5 alpha by calcium chloride transformation method, a transformant is obtained by screening in a tetracycline resistant culture medium at 37 ℃, and colony PCR verification is carried out on the selected plasmid of the transformant (primers are pHY-F and pHY-R). If the PCR verification result of the transformant is as follows: an electrophoresis band appears at 2496bp, which indicates that the YvbW expression vector is successfully constructed, and the transformant is a positive transformant (named as YvbW free expression vector pHY-yvbW);
wherein the sequences of pHY-F and pHY-R are as follows:
pHY-F：GTTTATTATCCATACCCTTAC、
pHY-R：CAGATTTCGTGATGCTTGTC；
(6) the YvbW free expression vector pHY-yvbW is electrically transformed into the Bacillus amyloliquefaciens LX-12, a transformant is obtained by screening in a culture medium containing tetracycline resistance at the temperature of 37 ℃, and colony PCR verification is carried out on the transformant (the used primers are pHY-F and pHY-R). If the result of PCR verification of the transformant is as follows: an electrophoresis band appears at 2496bp, which proves that the free expression vector pHY-yvbW is successfully transferred into the bacillus amyloliquefaciens LX-12, and at the moment, the transformant is a positive transformant, namely the bacillus amyloliquefaciens LX-12/pHY-yvbW transferred into the YvbW expression vector pHY-yvbW.
Example 2:
the application of the Bacillus amyloliquefaciens LX-12/pHY-yvbW with yvbW gene enhanced expression in high yield of indoleacetic acid is as follows:
the fermentation media used in this example were as follows, each containing 1g/LKH of the medium, except for the components shown in Table 12PO41g/L KCl and 1g/LMgSO4·7H2O, pH of the medium was 7.2.
TABLE 1 fermentation Medium formulation
| Number of fermentation Medium | L-Tryptophan (g/L) | Glucose (g/L) | L-monosodium glutamate (g/L) | Yeast extract (g/L) |
| 1 | 0.5 | 20 | 5 | 1 |
| 2 | 1 | 20 | 5 | 1 |
| 3 | 1.5 | 20 | 5 | 1 |
| 4 | 1 | 15 | 5 | 1 |
| 5 | 1 | 25 | 5 | 1 |
| 6 | 1 | 20 | 4 | 1 |
| 7 | 1 | 20 | 6 | 1 |
| 8 | 1 | 20 | 5 | 0.5 |
| 9 | 1 | 20 | 5 | 1.5 |
Wherein, the bacillus amyloliquefaciens LX-12/pHY-yvbW and the bacillus amyloliquefaciens contrast strain LX-12/pHY-300 which is transferred into pHY-300 empty plasmid are all constructed by adopting the method in the embodiments;
the seed fermentation comprises the following specific steps: the bacillus amyloliquefaciens is firstly activated, namely inoculated into LB liquid culture medium containing 5mL by 1 percent of glycerol tubes in volume percentage, and cultured for 12 hours at the temperature of 37 ℃ at 230 r/min. Then, the activated bacterial solution was inoculated into a seed fermentation medium in a volume percentage (1%) and cultured at 37 ℃ at 230r/min for 12 hours to obtain a seed solution (the formulation of the seed fermentation medium used herein was LB medium (10g/L peptone, 5g/L yeast powder, 10g/L NaCl, pH 7.20)).
The fermentation of the indoleacetic acid comprises the following specific steps: 50mL of fermentation medium is filled into a 250mL triangular flask, then the seed liquid is inoculated into the fermentation medium according to the inoculum size of 2 percent (volume percentage), the fermentation culture speed is 120r/min, the temperature is 30 ℃, and the fermentation culture is carried out for 72 hours, thus obtaining the fermentation liquid.
The yield of indoleacetic acid in the fermentation broth of the above examples was determined by High Performance Liquid Chromatography (HPLC). The measurement conditions are specifically as follows: detecting by using an Agilent 1260 liquid chromatograph; the chromatographic column was Hypersil BDS C18(5 μm,4.6 mm. times.250 mm); the mobile phase is A, B is 50:50(A phase is methanol, B phase is 0.8% glacial acetic acid solution); flow rate: 1.0 mL/min; the column temperature is 30 ℃; wavelength of ultraviolet detector: 221 nm; the amount of the sample was 20. mu.L. According to the standard curve made by the indole acetic acid standard product, the indole acetic acid yield in the fermentation liquor is calculated (see table 2).
TABLE 2 Indolylacetic acid production by different strains
As can be seen from Table 2, under the same seed culture and fermentation production conditions, compared with the Bacillus amyloliquefaciens LX-12/pHY-300 in the prior art, the content of the indoleacetic acid in the fermentation liquid of the enhanced YvbW expression Bacillus amyloliquefaciens LX-12/pHY-yvbW is greatly improved (by more than 39 percent), and the technical scheme of the invention has great application value in the aspect of improving the yield of the indoleacetic acid of the Bacillus amyloliquefaciens.
Sequence listing
Application of <120> enhancement expression yvbW gene in improvement of yield of indoleacetic acid of bacillus amyloliquefaciens
<160> 9
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1368
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
atggagaaag acatgcagaa gctcgagcgc acaatgacat cgcggcatat tatgatgatg 60
gcattgggcg gagccattgg agcaggatta tttaaaggaa gcagcaaagc gatcgatttg 120
gcggggcctt cggtcatgat cgcctacttg atcggcggcg tgattttgct gtttatcatg 180
caggggcttg ccgagatggc tgtccgaaac agtgaagcca gaacattcag ggatcttgtt 240
caatcaatat tagggccgta tgccgcttat tttttagact ggatatactg gaaaatgtgg 300
gttctcaata ttgcggcaga ggctgttgtc gccgcgatat ttttgcagta ctggctgccg 360
gggctgccga tctgggtgct ggcgctgttc gtttcactcg tcattacgag cgtgaatttg 420
ctttctgtca aaagctttgc cgagacggaa tactggcttg cccttattaa aatcacagtg 480
attgtcgtct ttattatatc cggatttatc ttgttatttt tctcttttgg acaacactca 540
gctgttggtt ttactcattt gacagaccat ggcggcttct tcccgaatgg cgccggaggg 600
ctgattacag ccatgctagt tgtgatctat tcctatggcg gaaccgaaat tatcggggtg 660
acactggcgg aaaccaaaaa ccctgagaag gtcgtgccta aagccgtgcg tggaacgttg 720
acgcgcatta ttgcttttta tcttctgccg tttttcgtga tcgtcagctt gattccatgg 780
aatcaagtca acggtgtgtc ggagagtcct tttgttatgg tctttaagat gatcggcatt 840
cccggagcgg atcatttgat gaatgcggtc attttactgg cggtcatttc ttcgatgaac 900
tcagggcttt acggcgcctc ccgaataatg tatacacagg catcagacgg aagaatgccg 960
aaaatctttt cgagactttc cgtgagaaaa gtgccggttt attcgattct attatgtact 1020
tctttcttat acttgggcgt attgttttca ctgtttgccg gcagccaaac gtttgaatat 1080
ttgatggggt ctctcggcta taccgtcctt gtgatctgga tgctgattgc cgctgcccat 1140
ttaaaatcga ggaaacggaa tcaaacagcg gggaacggct actatgtcaa atggttccct 1200
tatacgactt ggctggcaat catttcactg acagcgatac tgatcggtgt catcctgacc 1260
acatcgattg tcattacatt ggtgacggcg ggaatctatc tgctcattag cgctgcttat 1320
ttctttaaag gaaggaacca gacagccggc caaacgtccg cttcttaa 1368
<210> 2
<211> 36
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
taagagagga atgtacacat ggagaaagac atgcag 36
<210> 3
<211> 36
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
tccgtcctct ctgctctttt aagaagcgga cgtttg 36
<210> 4
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
ggtctagatg ataggtggta tgtttt 26
<210> 5
<211> 36
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
ctgcatgtct ttctccatgt gtacattcct ctctta 36
<210> 6
<211> 36
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
caaacgtccg cttcttaaaa gagcagagag gacgga 36
<210> 7
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
gggagctccg caataatgcc gtcgca 26
<210> 8
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
gtttattatc cataccctta c 21
<210> 9
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
cagatttcgt gatgcttgtc 20
Claims (5)
1. Expression enhancementyvbWApplication of gene in improving yield of indoleacetic acid of bacillus amyloliquefaciens and application of gene in improving yield of indoleacetic acid of bacillus amyloliquefaciensyvbWThe nucleotide sequence of the gene is shown in SEQ ID NO. 1.
2. The use of claim 1, wherein the Bacillus amyloliquefaciens is a Bacillus amyloliquefaciens with indoleacetic acid in the substitution product.
3. The use of claim 1, wherein the Bacillus amyloliquefaciens has a preservation number of CCTCC NO: m2015234.
4. The application according to claim 2, wherein the application process is:
(1) PCR amplification is carried out by taking Bacillus licheniformis DW2 genome DNA as templateyvbWA gene fragment;
(2) the P43 promoter was amplified by overlap extension PCR,yvbWThe gene and the amylase terminator are connected together to form a target gene expression frame, and the target gene expression frame is arranged in the sequence: p43 promoteryvbWGene-amylase terminator;
(3) by usingSacI andXbacarrying out double enzyme digestion on a target gene expression frame by using restriction endonuclease to obtain an enzyme digested gene expression frame;
(4) plasmid pHY-300 was prepared, and the same was usedSacI andXbai, carrying out double enzyme digestion on the plasmid pHY-300 by using restriction endonuclease to obtain a linear plasmid fragment;
(5) connecting the enzyme digestion gene expression frame obtained in the step (3) with the linear plasmid fragment obtained in the step (4) through DNA ligase to obtainyvbWFree expression plasmid pHY-yvbW；
(6) Will be provided withyvbWFree expression plasmid pHY-yvbWTransferring into Escherichia coli DH5 alpha, screening to obtain positive transformant with tetracycline resistance as screening marker, performing colony PCR verification, electrically converting plasmid of positive transformant with successful verification into Bacillus amyloliquefaciens LX-12, screening to obtain positive transformant with tetracycline resistance as screening marker, performing colony PCR detection to obtain strainyvbWBacillus amyloliquefaciens LX-12/pHY-yvbWAnd (3) strain.
5. The use of claim 2, wherein the expression is enhanced during the application processyvbWWhen the gene bacillus amyloliquefaciens strain is fermented to produce the indoleacetic acid, the formula of a fermentation medium is as follows: 15-25g/L glucose; 4-6g/L L-monosodium glutamate; 0.5-1g/L L-tryptophan; 0.5-1.5g/L yeast powder; 0.5-1.5 g/LKH2PO4(ii) a 0.5-1g/L KCl and 0.5-1g/LMgSO4·7H2O, pH7.00-7.20, and the balance of water.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011237251.3A CN112359004B (en) | 2020-11-09 | 2020-11-09 | Application of enhanced expression yvbW gene in improvement of indoleacetic acid yield of bacillus amyloliquefaciens |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011237251.3A CN112359004B (en) | 2020-11-09 | 2020-11-09 | Application of enhanced expression yvbW gene in improvement of indoleacetic acid yield of bacillus amyloliquefaciens |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112359004A true CN112359004A (en) | 2021-02-12 |
| CN112359004B CN112359004B (en) | 2022-07-08 |
Family
ID=74508936
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011237251.3A Active CN112359004B (en) | 2020-11-09 | 2020-11-09 | Application of enhanced expression yvbW gene in improvement of indoleacetic acid yield of bacillus amyloliquefaciens |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112359004B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1926431A (en) * | 2004-01-09 | 2007-03-07 | 诺维信股份有限公司 | Bacillus licheniformis chromosome |
| CN108559708A (en) * | 2018-03-23 | 2018-09-21 | 绿康生化股份有限公司 | The preparation method and obtained strains of the bacillus licheniformis of reinforcing YvbW expression and its application |
| CN109913488A (en) * | 2018-04-28 | 2019-06-21 | 湖北大学 | A method of improving bacillus iturin yield |
-
2020
- 2020-11-09 CN CN202011237251.3A patent/CN112359004B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1926431A (en) * | 2004-01-09 | 2007-03-07 | 诺维信股份有限公司 | Bacillus licheniformis chromosome |
| CN108559708A (en) * | 2018-03-23 | 2018-09-21 | 绿康生化股份有限公司 | The preparation method and obtained strains of the bacillus licheniformis of reinforcing YvbW expression and its application |
| CN109913488A (en) * | 2018-04-28 | 2019-06-21 | 湖北大学 | A method of improving bacillus iturin yield |
Non-Patent Citations (1)
| Title |
|---|
| D. CAI ET AL: "Systematic engineering of branch chain amino acid supply modules for the enhanced production of bacitracin from Bacillus licheniformis", 《METABOLIC ENGINEERING COMMUNICATIONS》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112359004B (en) | 2022-07-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7130284B2 (en) | Yeast producing tyrosol and hydroxytyrosol and method for producing the same | |
| CN114958888B (en) | Valine-producing strain and construction method thereof | |
| CN106635937B (en) | Genetic engineering strain for high-yield phenazine-1-formamide and construction method thereof | |
| CN113373180B (en) | Nano-selenium synthesized active bacterial liquid of bacillus amyloliquefaciens, and preparation method and application thereof | |
| CN111004815B (en) | Method for improving yield of bacillus subtilis surfactant by mutating degU gene | |
| CN108456652B (en) | Sphingosine monad gene engineering bacterium and construction method and application thereof | |
| CN113930347A (en) | Trichoderma viride engineering bacterium capable of synthesizing melatonin as well as construction method and application thereof | |
| WO2018036479A1 (en) | Genetically engineered strain of high yield phenazine-1-carboxamide, construction method for same, and uses thereof | |
| CN116904379A (en) | Gene recombination strain for high yield tetrahydropyrimidine and construction method and application thereof | |
| CN108277191B (en) | Application of bacillus licheniformis DW2 delta ccpN in bacitracin production | |
| CN112359004B (en) | Application of enhanced expression yvbW gene in improvement of indoleacetic acid yield of bacillus amyloliquefaciens | |
| CN111304235B (en) | Bacillus licheniformis for enhancing expression of cysP as well as preparation method and application thereof | |
| CN110713964B (en) | Saccharopolyspora whiskers engineering strain with cspA gene doubled and application thereof | |
| CN114736918B (en) | Recombinant escherichia coli for producing salidroside by integrated expression and application thereof | |
| CN114891806B (en) | Citrobacter welchii yqjH gene knockout mutant strain and application thereof | |
| CN108588108B (en) | Preparation method and application of bacillus for efficiently metabolizing glycerol | |
| CN113801834B (en) | Gene engineering streptomyces diastatochromogenes for high yield of toyocamycin and construction method and application thereof | |
| CN115197957A (en) | Gene fragment for improving crop straw decomposition of trichoderma guizhouense NJAU4742 in adversity and application thereof | |
| CN109182240B (en) | Application of bacillus licheniformis DW2 delta phoP in bacitracin production | |
| CN110029081B (en) | Engineering bacterium for over-expressing carbon catabolite repression effect transcription inhibitor gene and construction method thereof | |
| CN108441508B (en) | Application of bacillus licheniformis DW2 DeltalrPC in bacitracin production | |
| CN111549050A (en) | Vitreoscilla hemoglobin expression frame suitable for bacillus and application | |
| CN112359007A (en) | Exogenous introduction edd gene bacillus licheniformis for producing bacitracin and application | |
| CN117106836B (en) | Application of phosphatidyl glycerol phosphatase coding gene in fermentation production of cytidine | |
| CN114540351B (en) | sRNA of targeted klebsiella pneumoniae MdtABC efflux pump and application thereof in preparation of tetracycline antibiotic resistant strain |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |