CN112353941B - Application of miR-34a-5p in preparation of medicine for treating cadmium-induced nerve injury - Google Patents

Application of miR-34a-5p in preparation of medicine for treating cadmium-induced nerve injury Download PDF

Info

Publication number
CN112353941B
CN112353941B CN202011344162.9A CN202011344162A CN112353941B CN 112353941 B CN112353941 B CN 112353941B CN 202011344162 A CN202011344162 A CN 202011344162A CN 112353941 B CN112353941 B CN 112353941B
Authority
CN
China
Prior art keywords
mir
cdcl
cadmium
expression
induced
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202011344162.9A
Other languages
Chinese (zh)
Other versions
CN112353941A (en
Inventor
李大鹏
郝日礼
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shandong Agricultural University
Original Assignee
Shandong Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shandong Agricultural University filed Critical Shandong Agricultural University
Priority to CN202011344162.9A priority Critical patent/CN112353941B/en
Publication of CN112353941A publication Critical patent/CN112353941A/en
Application granted granted Critical
Publication of CN112353941B publication Critical patent/CN112353941B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P39/00—General protective or antinoxious agents
    • A61P39/02—Antidotes

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Epidemiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biochemistry (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Toxicology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The invention discloses application of miR-34a-5p in preparation of a medicine for treating cadmium-induced nerve injury, and belongs to the technical field of biological medicines. The first research of the invention discovers that miR-34a-5p participates in cadmium-induced nerve cell damage in CdCl2The expression of miR-34a-5p in the treated PC12 cell is up-regulated, and the expression of miR-34a-5p in the PC12 cell is knocked out or inhibited, so that CdCl can be remarkably reduced2Morphological damage of induced PC12 cells. Therefore, miR-34a-5p is used as a molecular intervention target, and a drug with the effect of reducing miR-34a-5p expression is designed or screened, so that a novel therapeutic drug for nerve damage caused by cadmium poisoning is provided.

Description

Application of miR-34a-5p in preparation of medicine for treating cadmium-induced nerve injury
Technical Field
The invention relates to the technical field of biological medicines, and in particular relates to application of miR-34a-5p in preparation of a medicine for treating cadmium-induced nerve injury.
Background
Cadmium (Cd) is a non-essential and toxic element for human bodies, has strong biological effect due to long biological half-life, can be accumulated in human bodies through direct contact or through food chains, and has great influence on health, particularly on toxic action on nerves. Cd can cause morphological change and dysfunction of the central nervous system, which can lead to hypomnesis, mental retardation and the like, and can induce nervous system diseases such as Alzheimer's disease, Parkinson and the like. Therefore, the heavy metal cadmium pollution is a serious environmental problem which endangers health, and the nerve damage caused by cadmium poisoning is well appreciated.
The micro RNA molecules (micro RNA, miRNA) are non-coding RNA molecules, have the size of about 20-25 nucleotides, and play a role in regulating and controlling the gene expression of eukaryotic cells, the cell development differentiation, the individual development and other aspects. Thousands of miRNAs have been isolated and found in nematode, drosophila, mouse and human cells, however, functional studies of miRNAs are relatively slow compared to frequent discovery of new miRNAs. Although bioinformatics approaches predict the effect of a series of miRNAs on target genes, few miRNAs have given direct evidence to demonstrate the target genes and their function of miRNAs. Therefore, how to determine the function of miRNA has become one of the most difficult and urgent tasks in this field.
The miR-34a-5p belongs to the miR-34 family, and the prior research shows that: miR-34a-5p is widely involved in chemotherapy resistance of various tumors such as prostate cancer, osteosarcoma and the like, and is expressed in ovarian cancer cells to inhibit cell proliferation and promote cell apoptosis. However, the effect on cadmium-induced nerve damage has not been reported.
Disclosure of Invention
Aiming at the prior art, the invention aims to provide the application of miR-34a-5p in the preparation of the medicine for treating cadmium-induced nerve injury. The research of the invention finds that CdCl2Up-regulation of miR-34a-5p expression in treated PC12 cells; the miR-34a-5p in PC12 cells is knocked out or miR-34a-5p inhibitor is adopted to reduce the expression of miR-34a-5p, so that CdCl can be reduced2Morphological damage of induced PC12 cells.
Based on the research, the invention provides the following technical scheme:
the first aspect of the invention provides application of miR-34a-5p in preparation of a medicine for treating cadmium-induced nerve injury.
Preferably, the nucleotide sequence of the miR-34a-5p is 5'-TGGCAGTGTCTTAGCTGGTTGT-3'; (SEQ ID NO. 1).
Preferably, the medicament takes miR-34a-5p as a target, silences or down-regulates the expression of miR-34a-5p, and reduces cadmium-induced nerve cell injury.
In a second aspect of the invention, the application of the miR-34a-5p inhibitor in preparing a medicament for treating cadmium-induced nerve injury is provided.
Preferably, the miR-34a-5p inhibitor is selected from antisense nucleic acid of miR-34a-5p, an expression vector containing miR-34a-5p antisense nucleic acid or a substance for down-regulating miR-34a-5p expression.
Preferably, the inhibitor of miR-34a-5p treats cadmium-induced nerve damage by down-regulating p-tau protein expression and up-regulating NEP protein expression.
Preferably, the cadmium-induced nerve damage is CdCl2Induced PC12 cell damage.
In the third aspect of the invention, the medicine for treating cadmium-induced nerve injury is provided, and the medicine takes the miR-34a-5p inhibitor as an active ingredient.
Preferably, the miR-34a-5p inhibitor is selected from antisense nucleic acid of miR-34a-5p, an expression vector containing miR-34a-5p antisense nucleic acid or a substance for down-regulating miR-34a-5p expression.
The invention has the beneficial effects that:
the first research of the invention discovers that miR-34a-5p participates in cadmium-induced nerve cell damage in CdCl2The expression of miR-34a-5p in the treated PC12 cell is up-regulated, and the expression of miR-34a-5p in the PC12 cell is knocked out or inhibited, so that CdCl can be remarkably reduced2Morphological damage of induced PC12 cells. Therefore, miR-34a-5p is used as a molecular intervention target, and a drug with the effect of reducing miR-34a-5p expression is designed or screened, so that a novel therapeutic drug for nerve damage caused by cadmium poisoning is provided.
Description of the drawings:
FIG. 1: a is CdCl with different concentrations2Treatment of effects on neural cell survival; b is a crystal violet dyeing result; c and D are western blot analysis results.
FIG. 2: CdCl of different concentrations2Influence of treatment on the expression level of miR-34a-5p in nerve cells.
FIG. 3: a is the influence of different inhibitor treatments on the expression quantity of miR-34a-5p in nerve cells; b is the survival rate of nerve cells of different treatment groups; c is the crystal violet dyeing result of different treatment groups; d and E are western blot analysis results for different treatment groups.
Detailed Description
It should be noted that the following detailed description is exemplary and is intended to provide further explanation of the disclosure. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.
As described in the background section, the functional studies of mirnas are relatively slow, and how to determine the function of mirnas has become one of the most difficult and urgent tasks in this field. miR-34a-5p has been reported to have multiple applications, but the role of miR-34a-5p in cadmium-induced nerve injury is still blank in current research.
Based on the above, the invention deeply researches the function of miRNA in cadmium-induced nerve injury. Cadmium is a heavy metal with strong toxicity, and in vitro studies using neurons and glial cells as models show that the mu M cadmium has neurotoxicity. Regarding the nerve damage mechanism of Cd, relevant studies mainly suggest: cd causes nerve damage by breaking intracellular calcium homeostasis, inducing apoptosis, interfering with relevant signal pathways, inducing oxidative stress damage, accumulating in vivo in combination with metallothionein, and the like.
The invention takes PC12 cells as a nerve cell model and adopts CdCl with different concentrations2The cells were treated, and as a result, CdCl was found2The activity of PC12 cells is reduced in a dose-dependent manner, and CdCl2The expression level of miR-34a-5p in the treated PC12 cells is up-regulated. It is speculated that miR-34a-5p possibly participates in CdCl2Induced neuro-cytotoxicity.
To further verify that miR-34a-5p is in CdCl2The invention discloses a function of induced nerve cell injury, the expression of miR-34a-5p in PC12 cells is down-regulated by a miR-34a-5p inhibitor, and the result shows that the inhibition of miR-34a-5p can reduce CdCl2Morphological damage of induced PC12 cells. Further action mechanism research shows that the miR-34a-5p inhibitor down-regulates p-tau protein expression and up-regulates NEP protein expression in PC12 cells.
In conclusion, experimental research proves that miR-34a-5p participates in CdCl2Induced nerve cell toxicity, and reduction of expression of miR-34a-5p can reduce CdCl2Morphological damage of induced PC12 cells.
In order to make the technical solutions of the present application more clearly understood by those skilled in the art, the technical solutions of the present application will be described in detail below with reference to specific embodiments.
The test materials used in the examples of the present invention are all conventional in the art and commercially available.
Example 1:
1. test materials:
PC12 cells were purchased from Tongpai Biological Technology Company (Shanghai, China); CdCl2Purchased from Sigma Aldrich Company.
mimetics and inhibitors of miR-34a-5p are designed and synthesized by GenePharma (Shanghai, China); wherein:
the sequence of the miR-34a-5p inhibitor is as follows: ACAACCAGCUAAGACACUGCCA, respectively; (SEQ ID NO.2)
Sequence of miR-34a-5p mimetic: UGGCAGUGUCUUAGCUGGUUGU, respectively; (SEQ ID NO.3)
Sequence of inhibitor NC: CAGUACUUUUGUGUAGUACAA are provided. (SEQ ID NO.4)
2. The test method comprises the following steps:
2.1 cell culture:
PC12 cells were cultured in RPMI-1640 medium at 37 ℃ and supplemented with a mixture of 10% Fetal Bovine Serum (FBS) and 1% penicillin (100U/mL) -streptomycin (100. mu.g/mL).
2.2 CdCl2Treatment and MTT analysis:
cultured PC12 cells were cultured at 1X 105Cell/well Density in 96-well plates, 0, 0.5. mu.M, 1. mu.M, 1.5. mu.M, 2. mu.M, 2.5. mu.M, 3. mu.M, 3.5. mu.M, 4. mu.M, 4.5. mu.M and 5. mu.M CdCl2And treating for 24 h.
Cell viability was determined by MTT assay for the different treatments described above.
2.3 cell morphology observation, Western blot analysis and miR-34a-5p expression analysis:
the cultured PC12 cells were divided into three groups, each with 0, 2. mu.M and 4. mu.M CdCl2Treating for 24 h; of treated PC12 cells Using Crystal Violet assayAnd (3) observing the morphology, analyzing the expression of p-tau protein and NEP protein by Western blot analysis, and detecting the expression quantity of miR-34a-5p by a PCR (polymerase chain reaction) experiment, wherein the method comprises the following steps:
2.3.1 Crystal Violet staining:
after treatment, the supernatant was removed and the cells were washed 3 times with PBS, fixed with 4% paraformaldehyde for 15 minutes, and stained with 0.5% crystal violet (Beyotime) for 10 minutes. The cell morphology was observed under a microscope (Nikon Instruments, tokyo, japan).
2.3.2 Western blot analysis:
cells were treated with cadmium for 24 hours and then lysed in ice-cold buffer supplemented with the protease inhibitor PMSF (Beyotime biotech research institute, Jiangsu, China). And protein concentration was measured using the BCA method. The main antibodies used were: (p-tau, Ser202), NEP (Servicbio, GB111120, 1/500), β -actin (Abcam, ab179467, 1/5000).
2.3.3PCR assay for detecting the expression level of miR-34a-5 p:
designing and synthesizing forward and reverse primer sequences according to the sequence of miR-34a-5p, and specifically comprising the following steps:
forward sequence: TGGCAGTGTCTTAGCTGGTTGT, respectively; (SEQ ID NO.5)
Reverse sequence: GCGAGCACAGAATTAATACGAC are provided. (SEQ ID NO.6)
U6 was chosen as the internal reference.
After tissue is cracked by TRIzol, chloroform and isopropanol are extracted and centrifuged, the tissue is rinsed for 2 times by 70 percent ethanol, the tissue is volatilized at room temperature for 20min, DEPC water is added to extract total RNA, and the RNA concentration is measured. Reverse transcription into cDNA was performed according to the reverse transcription kit instructions. Each group of cDNA was loaded with 1. mu.L + DEPC water 3.2. mu.L + pre-and post-primers 0.4. mu.L + TB Green 5. mu.L ═ 10. mu.L, and 3 wells were repeated to carry out RCR reaction by thermal cycling. The conditions were as follows: initial denaturation at 95 ℃ for 30s, 40 cycles (5 s at 95 ℃ and 30s at 60 ℃), thawing phase (15 s at 95 ℃, 30s at 60 ℃ and 15s at 95 ℃), and detection on Roche PCR instrument. The above experiment was repeated three times, and U6 was selected as the internal reference, according to 2-△△CTThe relative expression level of each gene was calculated.
U6-F：CTCGCTTCGGCAGCAGCACA；(SEQ ID NO.7)
U6-R：AACGCTTCACGAATTTGCGT。(SEQ ID NO.8)
And (4) suggesting supplement: the system composition of PCR reaction and PCR reaction program.
2.4 inhibition of expression of miR-34a-5p on CdCl2Examination of the effects of induced neurocytotoxicity:
the cultured PC12 cells were divided into four groups, each: CK group, Inhibitor NC group, CdCl2Treatment group, CdCl2+ Inhibitor miR-34a-5p treatment group, wherein: CK group is blank control without any treatment; the Inhibitor NC group is processed for 6h by adding only the Inhibitor NC; CdCl2The treatment group was performed with 4. mu.M CdCl2Treating for 24 h; CdCl2The + Inhibitor miR-34a-5p treatment group was 4. mu.M CdCl2After treatment for 24h, adding Inhibitor miR-34a-5p for treatment for 6 h.
3. And (3) test results:
3.1 CdCl of different concentrations2Effect of treatment on cell viability:
as shown in FIG. 1A, CdCl2(0, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5 or 5. mu.M) exposure for 24h resulted in a dose-dependent decrease in cell viability and CdCl2IC on PC12 cells50About 4. mu.M.
Selection of CdCl based on the results of MTT experiments2The concentrations of (2. mu.M and 4. mu.M) were used in subsequent experiments.
3.2 cell morphology observation, Western blot analysis and miR-34a-5p expression analysis results:
crystal violet staining indicated CdCl2(2. mu.M and 4. mu.M) induced cell damage, while 4. mu.M CdCl2Was more severe than 2 μ M (FIG. 1B). CdCl2Exposure (2. mu.M and 4. mu.M) significantly increased p-tau protein expression and decreased NEP protein expression compared to controls, and 4. mu.M CdCl2The change in (A) was significantly greater than 2. mu.M (FIG. 1C and FIG. 1D).
As shown in FIG. 2, upregulation of miR-34a-5p expression in PC12 cells after CdCl2 treatment and by 4 μ M CdCl2The induced change was significantly greater than 2 μ M.
3.3 MiR-34a-5p knockout can alleviate CdCl2InducedCytotoxicity and neurotoxicity
To explore the existence of miR-34a-5p in CdCl2Role in induced injury, we inhibited miR-34a-5p in PC12 cells. An inhibitor of miR-34a-5p can significantly down-regulate the level of miR-34a-5p in PC12 cells (FIG. 3A). FIG. 3B shows the reaction with CdCl2Compared with treatment, the miR-34a-5p inhibitor increases cell viability. CdCl can be reduced by inhibiting miR-34a-5p2Morphological damage of induced PC12 cells (fig. 3C). Simultaneously, with CdCl2In contrast to exposure, miR-34a-5p inhibitors down-regulated p-tau protein expression and up-regulated NEP protein expression in PC12 cells (fig. 3D and 3E). Meanwhile, inhibitor NC has no influence on miR-34a-5p level, p-tau protein level, NEP protein level and the like in PC12 cells.
The above description is only a preferred embodiment of the present application and is not intended to limit the present application, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, improvement and the like made within the spirit and principle of the present application shall be included in the protection scope of the present application.
SEQUENCE LISTING
<110> Shandong university of agriculture
Application of <120> miR-34a-5p in preparation of medicine for treating cadmium-induced nerve injury
<130> 2020
<160> 8
<170> PatentIn version 3.5
<210> 1
<211> 22
<212> DNA
<213> Artificial sequence
<400> 1
tggcagtgtc ttagctggtt gt 22
<210> 2
<211> 22
<212> DNA
<213> Artificial sequence
<400> 2
acaaccagcu aagacacugc ca 22
<210> 3
<211> 22
<212> DNA
<213> Artificial sequence
<400> 3
uggcaguguc uuagcugguu gu 22
<210> 4
<211> 21
<212> DNA
<213> Artificial sequence
<400> 4
caguacuuuu guguaguaca a 21
<210> 5
<211> 22
<212> DNA
<213> Artificial sequence
<400> 5
tggcagtgtc ttagctggtt gt 22
<210> 6
<211> 22
<212> DNA
<213> Artificial sequence
<400> 6
gcgagcacag aattaatacg ac 22
<210> 7
<211> 20
<212> DNA
<213> Artificial sequence
<400> 7
ctcgcttcgg cagcagcaca 20
<210> 8
<211> 20
<212> DNA
<213> Artificial sequence
<400> 8
aacgcttcac gaatttgcgt 20

Claims (4)

  1. Application of miR-34a-5p inhibitor in preparation of medicine for treating cadmium-induced nerve injury.
  2. 2. The use of claim 1, wherein the inhibitor of miR-34a-5p is selected from the group consisting of an antisense nucleic acid to miR-34a-5p, an expression vector comprising an antisense nucleic acid to miR-34a-5p, and a substance that down-regulates expression of miR-34a-5 p.
  3. 3. The use of claim 1, wherein the inhibitor of miR-34a-5p treats cadmium-induced nerve damage by down-regulating p-tau protein expression and up-regulating NEP protein expression.
  4. 4. The use of claim 1, wherein the cadmium-induced nerve damage is CdCl2Induced PC12 cell damage.
CN202011344162.9A 2020-11-26 2020-11-26 Application of miR-34a-5p in preparation of medicine for treating cadmium-induced nerve injury Active CN112353941B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202011344162.9A CN112353941B (en) 2020-11-26 2020-11-26 Application of miR-34a-5p in preparation of medicine for treating cadmium-induced nerve injury

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202011344162.9A CN112353941B (en) 2020-11-26 2020-11-26 Application of miR-34a-5p in preparation of medicine for treating cadmium-induced nerve injury

Publications (2)

Publication Number Publication Date
CN112353941A CN112353941A (en) 2021-02-12
CN112353941B true CN112353941B (en) 2021-08-17

Family

ID=74532858

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202011344162.9A Active CN112353941B (en) 2020-11-26 2020-11-26 Application of miR-34a-5p in preparation of medicine for treating cadmium-induced nerve injury

Country Status (1)

Country Link
CN (1) CN112353941B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113230267A (en) * 2021-03-22 2021-08-10 四川大学华西医院 Application of microRNA sequence in preparation of malignant melanoma gene therapy drug

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106492223A (en) * 2016-09-29 2017-03-15 哈尔滨医科大学 Application of the microRNA 34a 5p inhibitor in drugs for rheumatoid arthritis is prepared
CN111419866A (en) * 2020-03-02 2020-07-17 南通大学 Application of miR-29a-3p in preparation of medicine for treating peripheral nerve injury

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106492223A (en) * 2016-09-29 2017-03-15 哈尔滨医科大学 Application of the microRNA 34a 5p inhibitor in drugs for rheumatoid arthritis is prepared
CN111419866A (en) * 2020-03-02 2020-07-17 南通大学 Application of miR-29a-3p in preparation of medicine for treating peripheral nerve injury

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
Icariside II Promotes the Differentiation of Adipose Tissue-Derived Stem Cells to Schwann Cells to Preserve Erectile Function after Cavernous Nerve Injury;Tao Zheng,et al;《Molecules and Cells》;20181231;第41卷(第6期);第553-561页 *
Induction of the Endoplasmic-Reticulum-Stress Response: MicroRNA-34a Targeting of the IRE1α-Branch;Lena Krammes,et al;《cells》;20200610;第9卷(第1442期);第1-13页 *
Long non-coding RNA Mirt2 relieves lipopolysaccharide-induced injury in PC12 cells by suppressing miR-429;Li,et al;《Journal of Physiology and Biochemistry》;20190715 *
miR-34a-5p and miR-125b-5p attenuate Aβ-induced neurotoxicity through targeting BACE1;P.Li,et al;《Journal of the Neurological Sciences》;20200320;第413卷;第1-9页 *

Also Published As

Publication number Publication date
CN112353941A (en) 2021-02-12

Similar Documents

Publication Publication Date Title
Liu et al. miR-222 is necessary for exercise-induced cardiac growth and protects against pathological cardiac remodeling
Oh et al. The Parkinson's disease gene product DJ-1 modulates miR-221 to promote neuronal survival against oxidative stress
Fernandes et al. Aerobic exercise training promotes physiological cardiac remodeling involving a set of microRNAs
Simionescu-Bankston et al. Noncoding RNAs in the regulation of skeletal muscle biology in health and disease
Xu et al. Attenuation of microRNA‐22 derepressed PTEN to effectively protect rat cardiomyocytes from hypertrophy
Chu-Tan et al. MicroRNA-124 dysregulation is associated with retinal inflammation and photoreceptor death in the degenerating retina
Larsson et al. Discovery of microvascular miRNAs using public gene expression data: miR-145 is expressed in pericytes and is a regulator of Fli1
Ge et al. MicroRNA-350 induces pathological heart hypertrophy by repressing both p38 and JNK pathways
Yu et al. MicroRNA-125b-5p improves pancreatic β-cell function through inhibiting JNK signaling pathway by targeting DACT1 in mice with type 2 diabetes mellitus
EP2077326A1 (en) Novel nucleic acid
Wang et al. MicroRNA-31 regulating apoptosis by mediating the phosphatidylinositol-3 kinase/protein kinase B signaling pathway in treatment of spinal cord injury
Kang et al. Hydrogen sulfide protects cardiomyocytes against apoptosis in ischemia/reperfusion through MiR-1-regulated histone deacetylase 4 pathway
Tang et al. Targeting of microRNA-21-5p protects against seizure damage in a kainic acid-induced status epilepticus model via PTEN-mTOR
Han et al. Retracted: Protective effects of microRNA‐431 against cerebral ischemia‐reperfusion injury in rats by targeting the Rho/Rho‐kinase signaling pathway
Deng et al. miR-21 reduces hydrogen peroxide-induced apoptosis in c-kit+ cardiac stem cells in vitro through PTEN/PI3K/Akt signaling
Zhou et al. Roles of microRNAs in pressure overload-and ischemia-related myocardial remodeling
Okuyan et al. LncRNAs in osteoarthritis
Xu et al. MiR-650 inhibits the progression of glioma by targeting FAM83F.
KR20190132182A (en) Composition for preventing or treating neurodegenerative disease comprising miR-493-3p inhibitor with inhibitory effect of cell death in hippocampal neural stem cells
Li et al. Role of lncRNA NEAT1 mediated by YY1 in the development of diabetic cataract via targeting the microRNA-205-3p/MMP16 axis.
CN112353941B (en) Application of miR-34a-5p in preparation of medicine for treating cadmium-induced nerve injury
CN111455059A (en) Application of reagent for detecting and targeting biomarkers in oral squamous cell carcinoma
Biyashev et al. E2F and microRNA regulation of angiogenesis
CN114209700A (en) New application of Salubrinal in preparation of medicines for treating bone marrow mesenchymal stem cell aging
Kong et al. MicroRNA-221 promotes myocardial apoptosis caused by myocardial ischemia-reperfusion by down-regulating PTEN.

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant