CN112342227B - Rice anther development regulation gene EDT1 and application thereof - Google Patents

Abstract

The invention discloses a rice anther development regulatory gene EDT1 and application thereof, wherein the DNA sequence of the gene EDT1 is shown as SEQ ID NO. 1. According to the invention, a gene EDT1 for regulating and controlling the development of rice anther is obtained through the research on the male sterile mutant EDT 1. The discovery can provide excellent seed sources to culture high-quality rice varieties with high yield, strong stress resistance and wide adaptability, thereby having important application value in plant breeding.

Description

Rice anther development regulation gene EDT1 and application thereof

Technical Field

The invention belongs to the technical field of plant genetic engineering, and relates to a rice anther development related protein EDT1 and application of a coding gene thereof.

Technical Field

Rice fertility is a key factor affecting rice yield, and in flowering plants, male gamete reproductive development is an important biological process and is also a growth process commonly experienced by higher plants. In the research of plant male development, anther is an important research object, and abnormal changes of external environment or intracellular substances at any stage of anther development can cause male sterility. During the development of pollen, the innermost layer of the anther wall, the tapetum layer which can directly contact and interact with the microspore, plays a crucial role. Cytological experimental methods were used earlier to study the specific functions of the tapetum and are described in relative detail. With the development of molecular biology in recent years, some genes related to tapetum development are cloned in arabidopsis thaliana and rice, so that the functions of tapetum and the correlation between tapetum and pollen grain are more clearly known^[1]。

In the generation alternation of higher plants, to form functional male gametophyte, the PCD of anther tapetum cell is needed to provide nutrition for the development of pollen, and whether the PCD of tapetum is advanced or delayed, pollen abortion can be caused^[2-4]. ROS participate in the tapetum PCD process, which in rice, when the balance of ROS in the anther is disrupted, results in the premature or delayed occurrence of tapetum PCD^[5]. Furthermore, it is important for pollen activity to have a mature and well-developed pollen wall. The pollen wall can protect male gametes from living in severe external environment^[6]. Meanwhile, the pollen wall can also identify self pollen and other pollen, so that incompatibility and embryo death are avoided, and genetic disorder is generated^[7]. However, the specific mechanism of occurrence of the PCD process of the anther tapetum mediated by reactive oxygen species needs to be further explored and studied.

The discovery and utilization of the rice male sterile gene can provide excellent seed sources to culture rice varieties with high yield, excellent quality, wide adaptability and strong stress resistance, thereby having important application value in plant breeding.

In recent years, research on plant ATP-citrate lyase (ACL) has focused on its structure, enzymatic activity and accumulation of lipids, phytohormones, carbohydrates and stressSome progress has been made in the regulation of response and the like^[8-10]. According to previous studies, overexpression of ACL in Arabidopsis resulted in a 30% increase in wax content in the stem, while overexpression of chimeric homologous ACL in dandelion roots resulted in a 4-fold increase in rubber content^[10]. This series of studies could ultimately be used to increase rubber production through genetic engineering. In addition, some molecules derived from acetyl-CoA, such as the polyester polyhydroxybutyrate, are of high industrial value in the pharmaceutical and chemical industries^[11]Furthermore, how to control the carbon flux of acetyl-CoA is an important topic for many biotechnological applications^[12]However, ACLs are otherwise less studied.

Reference documents:

[1]Niu N,Liang W,Yang X,et al.2013.EAT1 promotes tapetal cell death by regulating aspartic proteases during male reproductive development in rice.Nature Communications[J],4:1445.

[2]Sanders P M,Bui A Q,Weterings K,et al.1999.Anther developmental defects in Arabidopsisthaliana male-sterile mutants.Sexual Plant Reproduction[J],11:297-322.

[3]Wilson Z A,Zhang D B 2009.From Arabidopsis to rice:pathways in pollen development.J Exp Bot[J],60:1479-1492.

[4]Parish R W,Li S F 2010.Death of a tapetum:a programme of developmental altruism.Plant Science[J],178:73-89.

[5]Luo D,Xu H,Liu Z,et al.2013.A detrimental mitochondrial-nuclear interaction causes cytoplasmic male sterility in rice.Nature Genetics[J],45:573.

[6]Lee J Y,Lee D H 2003.Use of serial analysis of gene expression technology to reveal changes in gene expression in Arabidopsis pollen undergoing cold stress.Plant Physiology[J],132: 517-529.

[7]Piffanelli P,Ross J H E,Murphy D J 1998.Biogenesis and function of the lipidic structures of pollen grains.Sexual Plant Reproduction[J],11:65-80.

[8]Rangasamy D,Ratledge C 2000.Compartmentation of ATP:citrate lyase in plants.Plant Physiol[J],122:1225-1230.

[9]Fatland B L,Ke J,Anderson M D,et al.2002.Molecular characterization of a heteromeric ATP-citrate lyase that generates cytosolic acetyl-coenzyme A in Arabidopsis.Plant Physiology[J], 130:740-756.

[10]Xing S,Deenen N,Magliano P,et al.2014.ATP citrate lyase activity is post-translationally regulated by sink strength and impacts the wax,cutin and rubber biosynthetic pathways.Plant Journal[J],79:270-284.

[11]Mazur L P,Silva D D D,Grigull V H,et al.2009.Strategies of biosynthesis of poly(3-hydroxybutyrate)supplemented with biodiesel obtained from rice bran oil.Materials Science&Engineering C[J],29:583-587.

[12]Balcke G U,Bennewitz S,Bergau N,et al.2017.Multi-omics of tomato glandular trichomes reveals distinct features of central carbon metabolism supporting high productivity of specialized metabolites.Plant Cell[J],29:960-983.

disclosure of Invention

The invention aims to provide an ATP-citrate lyase EDT 1.

The second purpose of the invention is to provide a rice anther development regulatory gene EDT 1.

The invention also aims to provide application of the anther development regulatory gene EDT 1.

The purpose of the invention is realized by the following technical scheme:

the invention provides a rice anther development regulatory protein EDT1, which is an ATP-citrate lyase A subunit protein EDT 1. In the cytosol, this enzyme relies on ATP to catalyze the conversion of citrate and CoA across the citrate transport system to acetyl-CoA and oxaloacetate, which is the only pathway for the production of cytoplasmic acetyl-CoA. The protein size of EDT1 is 55kD, containing two domains that are highly conserved in various species: the amino acid sequences of the ATP-grapp domain at the N terminal and the citrate-bind domain at the C terminal are shown in SEQ ID NO. 2.

The invention also provides a rice male sterile mutant edt1 obtained by tissue culture, which is characterized in that the plant height is shortened, anthers are reduced and white, mature and fertile pollen grains are not generated, and finally the rice male sterile mutant is completely sterile.

The invention also provides a rice anther development regulatory gene EDT1, the DNA sequence of which is shown in SEQ ID NO. 1. The CDS of EDT1 has a full length of 1272bp, and comprises 11 exons and 10 introns. EDT1 mutant is caused by large fragment deletion of EDT1 gene and its surrounding DNA sequence.

The invention also provides an exploration of the mechanism of action of the EDT1 gene and the protein coded by the gene in regulating the development process of anthers, particularly the programmed death process of tapetum cells and the formation of pollen walls.

The invention also provides the application of the EDT1 gene and the rice male sterile mutant EDT1 in rice breeding work.

The invention also provides a related research method of the EDT1 gene and the rice male sterile mutant EDT1, and application of the EDT1 gene and the rice male sterile mutant in the research of other rice male sterile mutants.

The invention also provides the value of EDT1 gene and ATP-citrate lyase EDT1 in pharmaceutical and chemical industries.

The invention also provides a recombinant expression vector, an expression cassette, a transgenic cell line or a recombinant bacterium containing the gene.

The invention also provides application of at least one of the gene EDT1, the protein EDT1, a recombinant expression vector, an expression cassette, a transgenic cell line or a recombinant bacterium in rice breeding.

The invention also provides application of at least one of the gene EDT1, the protein EDT1, a recombinant expression vector, an expression cassette, a transgenic cell line or a recombinant bacterium in breeding rice with normal anther development.

The invention also provides application of at least one of the gene EDT1, the protein EDT1, a recombinant expression vector, an expression cassette, a transgenic cell line or a recombinant bacterium in the research of culturing rice male sterile mutants.

The invention also provides a method for cultivating rice with normal anther development, and the gene is introduced into rice varieties with abnormal anther development.

The gene is introduced into a rice variety with abnormal anther development through a recombinant expression vector containing the gene.

Through research on the male sterile mutant EDT1, the gene EDT1 for regulating and controlling the development of rice anther is obtained. The discovery and utilization of the rice male sterile gene can provide excellent seed sources to culture high-quality rice varieties with high yield, strong stress resistance and wide adaptability, thereby having important application value in plant breeding. One of the catalytic reaction products of the ATP-citrate lyase EDT1 is acetyl coenzyme A, which is a two-carbon raw material for synthesizing other derivatives such as downstream fatty acid, stilbenes, flavonoids and the like, so that research and genetic modification can be carried out on the acetyl coenzyme A to achieve a specific production value.

Drawings

FIG. 1 morphological comparison between wild type and edt1 mutant;

FIG. 2 development observations of microspores and tapetum in wild type and edt1 mutant;

FIG. 3 Transmission Electron microscopy of wild type and edt1 mutant anthers;

FIG. 4TUNEL assay for DNA fragmentation in wild type and edt1 mutant anthers;

FIG. 5 comet assay detects nuclear DNA fragmentation;

FIG. 6 superoxide anion level analysis of wild type and edt1 mutant anthers;

FIG. 7 detection of energetic species in anthers;

FIG. 8 Fine positioning of EDT 1;

FIG. 9 detection of genes within the deletion interval;

FIG. 10pCAMBIA1305.1 genome complementation vector;

FIG. 11 transgenic complementation phenotype identification;

fig. 12CRISPR-Cas9 knock-out vector;

FIG. 13 phenotypic identification of transgenic knockdown (CRISPR/Cas 9);

FIG. 14 determination of ATP citrate lyase activity and citric acid and oxaloacetic acid in vitro of EDT 1;

FIG. 15EDT1 interacts with ACLB-1;

FIG. 16 detection of fatty acid content in anthers at heading stage;

FIG. 17qRT-PCR analysis of anther fatty acid-related gene expression.

Detailed Description

EXAMPLE 1 phenotypic Observation of 1EDT1 mutant and map-based cloning of the EDT1 Gene

(1) The edt1 mutant was phenotypically observed to clarify its mutation type

edt1 mutant is obtained by tissue culture of indica rice variety IR64, and it was observed in field that the mutant has stable defect phenotype (high strain height, short anther and white flower) (FIG. 1, A, plant phenotype of wild type and edt1 mutant after ear emergence; B, ear of wild type and edt1 mutant after husk removal; C, anther of wild type and edt1 at ear emergence; D, anther of wild type and edt1 is iodine-potassium iodide (I)₂KI) solution staining), the mutant is eventually completely sterile because it cannot form normal fertile pollen grains. It was found that in the edt1 mutant, after completion of meiosis, microspores were released from the tetrads as in the wild type but subsequently arrested in development and eventually degraded gradually, as in the edt1 mutant (FIG. 2, A-E is wild type, F-J is edt1 mutant; A and F, stage 8B; B and G, stage 9 a; C and H, stage 9B; D and I, stage 10; E and J, stage 14). It was found by half-microtomy that edt1 tapetum was not concentrated and stained less early in stage 9, and it appeared that the inclusion material was undergoing degradation (FIG. 2, K-N is wild type, O-R is edt1 mutant; L and P, stage 9 a; M and Q, stage 9 b; N and R, stage 10). This hypothesis was verified by transmission electron microscopy experiments, which observed that the cytoplasm of wild-type tapetum cells was concentrated at stage 9, but the internal structure of the mutant tapetum cells was loose and the content of the contents decreased, and that the mitochondrial debris remaining after degradation was found by magnification observation (FIGS. 3, A and C, stage 8; stages E and G, stage 9; I, stage 10, K, stage 11; edt1 anthers at different developmental stages: B and D, stage 8; F and H, stage 9; I,a 10 th period; l, period 11. Where C and D are enlarged views of tapetum cells of A and B, respectively. G and H are enlargements of tapetum cells at stage 9, showing mitochondria (Mt) and other organelles. Arrows in H indicate mitochondrial degeneration, arrows in E and K indicate wustite (Ub). The microspore walls of M and N, WT (M) and edt1(N) are shown In cross-section at stage 10 with the outer wall (Te), inner wall (I) (Ne), skeleton (Ba), inner wall (II) (End) and inner wall (In). O and P, cross sections of wild type (O) and edt1(P) microspores at stage 12).

(2) Genetic analysis and map-based cloning of EDT1

F Using sterile mutant/wild type IR64₂In the population, we detected the segregation ratio in the positive season of Nanjing in 2013 as: 13 pollen completely sterile plants and 77 normal pollen plants. Likewise, 279F were randomly selected in 4 months 2014₂In the investigation and separation conditions of the Hainan Ling water base, 27 pollen completely sterile single plants and 252 pollen normal single plants are obtained. Both segregating populations deviated from the 3:1 segregation ratio (χ for the 2013 Nanjing population²＝4.8＞χ² _0.05,1＝3.84，P<0.05; for the Hainan population of 2014, χ²＝34.1＞χ² _0.05,1＝3.84， P<0.05)。

To isolate and identify the EDT1 gene, we mapped it between the two InDel molecular markers B3 and B4 on chromosome 11 using the map-based cloning method. In fine mapping, we identified and analyzed 742 mutants from the F2 mapping population (a population obtained by crossing the edt1 mutant with 02428 japonica rice variety and selfing, about 8000 strains). According to the DNA sequences of 11 th chromosomes of indica rice and japonica rice published in NCBI and Gramme databases, a new marker is developed between B3 and B4, 10 pairs of molecular markers with better polymorphism are selected, the positions of homologous chromosomes of each crossover individual are further determined to be subjected to cross exchange, finally EDT1 is positioned in a 543kb region between primers B9 and B10 (figure 8), and through PCR identification and DNA sequencing, the DNA fragment deletion of 147kb at most exists in the region.

(3) Determination of candidate genes within a localization interval

The site predicts that the deletion interval contains 8 annotated genes and 7 genes encoding unknown functional proteins. Through website analysis (RiceXPro) and real-time fluorescence quantification experiments in anthers, we found that a gene Os11g0696200 (shown in SEQ ID NO.1 as ORF5) encoding citrate lyase has the highest expression level in anthers compared with other genes, and then we performed later experiments using it as a candidate gene (FIG. 9, A, detection of fragment deletion in WT and edt1 mutants by PCR method, P1-P4 is a molecular marker designed in the deletion interval, P5 is a primer for amplifying UBQ gene as a positive control; B, analysis of gene expression in the deletion interval in wild-type anthers (stage 9) by qRT-PCR experiments, and experiments using UBQ as a control).

(4) Relevant transgene validation of EDT1

Complementary vectors were constructed by amplifying 3.2kb of Os11g0696200 gene DNA plus 3kb upstream of the start codon and 1.5kb downstream of the stop codon (FIG. 10, primer design 1305-HB-EDT 1-F: TTACGAATTCGAGCTCATGAGATATACCTGGAAGGG; 1305-HB-EDT 1-R: TGCTCACCATGGATCCCACATGCCCATAATCTGGTT). Since edt1 was completely sterile and no mature seeds were available for callus, the complementation vector was introduced into the wild type and edt1 mutant-engineered F1 seeds. After obtaining the transgenic seedlings, primers B9 and B10 are used for identifying the mutant background, and then a hygromycin solution soaking method and a primer amplification method are used for identifying and obtaining four functional complementary transgenic families (COM1-COM 4). As a result, the pollen fertility, the protein level and the mRNA level of the pollen are restored to different degrees, wherein the COM1 family phenotype is restored to the highest degree and reaches the wild type level, so that the COM1 is selected as a representative to carry out subsequent experiments (figure 11, A, phenotypes of wild type and complementary family COM1 after ear emergence; B-D, the ears of wild type and edt1 mutants and COM1 after inner and outer palea are removed; E-G, wild type and edt1 mutants and the anther of COM1 are iodine-potassium iodide (I) for pollen fertility, protein level and mRNA 1₂-KI) solution staining; h, identifying transgene complementation by a PCR method; i, detecting the EDT1 protein content of wild type, EDT1 mutant and each complementary family by a Western blot method (the lower part is total protein content)Horse brilliant blue staining); j, qRT-PCR method identified the expression level of EDT1 for wild type, EDT1 mutant and each complementary pedigree).

We knocked out EDT1 gene using CRISPR/Cas9 technology with vector (FIG. 12, primer design EDT 1-cri-1F: GGCAATACTACCTTTCTATTGTCT; EDT 1-cri-1R: AAACAGACAATAGAAA GGTAG TAT) to get two homozygous single strains with the same mutation at the same position, named c-EDT1, and one more base A is added between 1306 and 1307 nucleotides (on the third exon) of Os11g0696200 genome, and the GT changes into GAT to cause amino acid frame shift and premature translation termination. c-edt1 the anther is thin and white, I₂KI staining revealed complete male sterility (FIG. 13, A, phenotype of wild type after ear emergence and C-edt 1; B and C, removal of spikelets of wild type after inner and outer palea and C-edt 1; D-G, anthers of wild type (transgenic negative plants) and C-edt1 iodine-potassium iodide (I)₂KI) solution dyeing and pollen fertility statistics; h, sequencing verification of transgene knockout; i, schematic representation of the transgene knockout site) whose phenotype is consistent with that of the edt1 mutant.

Example 2 the involvement of EDT1 in the degradation of the tapetum layer of anthers

We analyzed the anther wall of the wild-type and edt1 mutant anthers by TUNEL assay and comet assay, respectively. Experimental results found that in wild-type tapetum cells, TUNEL positive signals only begin to appear during phase 8 (meiotic phase) and strong TUNEL signals are detected during phase 9 (microspore phase). In the mutant, however, we detected a TUNEL positive signal at stage 7, with the TUNEL signal being strongest by stage 8, and then the signal gradually disappeared (FIG. 4, detection of anther DNA fragmentation from stage 5 (S5) to stage 10 (S10) for wild-type (A-C, G-I) and edt1 mutant (D-F, J-L). Red fluorescence indicates Propidium Iodide (PI) stained nuclei.yellow fluorescence is a superposition of TUNEL positive nuclear staining (green) and propidium iodide (red). the arrow in F, G, H, J shows a TUNEL positive signal in tapetum cells). Comet experiments quantified this result (FIG. 5, evaluation of DNA damage levels in WT (A, B) and edt1 mutant (C, D) anthers at stages 8-9 (A, C) and 10-11 (B, D.) units 0, 1, 2 and 3 represent the degree of DNA damage per nucleus as shown by the insets in E. Final DNA damage values were obtained by adding 50 nuclear damage units per slide). The results show that the lack of edt1 function leads to advancement of tapetum PCD.

Example 3EDT1 influences the oxidation-reduction equilibrium state and energy metabolism in anthers

Anther staining experiments with NBT dye found at edt1, O₂ ^.-The content remained high all the time (fig. 6A). Subsequently, we observed the anthers of stage 9 in paraffin sections and found O₂ ^.-Mainly in tapetum cells (FIGS. 6B-C). To quantitatively detect O₂ ^.-The content of (A) was quantitatively determined by WST treatment to find O at the S10 and S11 stages in edt1 anthers₂ ^.-The deletion was significantly higher than wild type (fig. 6D). Based on the above experimental results, we hypothesized that edt1 differs from the wild type in the way tapetum degradation, which may be due to insufficient energy in the cell. The amount of ATP in the edt1 mutant was significantly lower than the wild type at both stages 8 and 9 as determined by hplc; and at stages 9 and 10, the amounts of ADP, AMP in the edt1 mutant were significantly higher than in the wild type (fig. 7A-C). The energy charge values of the anthers at different stages were calculated and found to be lower than that of the wild type in the anthers at stages 8 to 11 of edt1 (FIG. 7D), which suggests that the edt1 mutant tapetum may be due to premature degradation caused by insufficient energy.

Example 4 analysis of the composition and enzymatic Activity of ACL in Rice

Through a series of in vivo and in vitro experiments (FIG. 15, A, yeast two-hybrid (Y2H) to detect the interaction of EDT1 and ACLB-1, DDO, two-deficient medium (SD/-Trp-Leu), QDO, four-deficient medium (SD/-Trp-Leu-His-Ade), AD, active domain representing pGADT7 vector, BD, binding domain representing pGBKT7 vector, B, bimolecular fluorescence complementation (BiFC) to detect the interaction of EDT1 with itself and ACLB-1 in the tobacco leaf epidermal cells of the family Bengale, YFP: yellow fluorescent protein, C, in vitro pull-down experiment to detect the interaction of two recombinant proteins (GST-EDT1 and MBP-ACLB-1), D, in vitro pull-down experiment to detect the interaction of two recombinant proteins (GST-EDT1 and MBP-EDT1), ACL in rice A is verified, B two proteins interact and ACL is a cytoplasmic enzyme, consistent with the dicotyledonous model crop arabidopsis thaliana.

In addition, we also performed in vitro enzyme activity assays by malate dehydrogenase coupling (FIGS. 14A-B). The experimental result shows that the realization of the activity of the ACL enzyme requires the existence of two subunits of A and B at the same time, and one of the subunits of A and B is not available. We also examined the levels of substrate and product of ACL-catalyzed reactions (citric acid and oxaloacetate), respectively, and the results showed that the levels of citric acid increased significantly and oxaloacetate decreased significantly during periods 8 through 10 in the anthers (fig. 14C-D). It is shown that the deletion of EDT1 results in the failure of the A subunit of citrate lyase to form normally, and finally results in the accumulation of citric acid and the reduction of oxaloacetate content.

Example 5EDT1 Effect on the fatty acid content of anthers

Since acetyl-coa, a substrate of ACL, is a two-carbon raw material for synthesizing fatty acids, in order to determine whether the fatty acid content in anthers is affected by the deletion of EDT1, we extracted the fatty acids in anthers and examined them by gas chromatography-mass spectrometry (GC-MS) method. The results show that edt1 almost all fatty acid content was reduced compared to the wild type, especially palmitic (C16.0), linoleic (C18.2N6C) and alpha-linolenic (C18.3N3) acid content (FIG. 16, C10.0: capric acid; C12.0: lauric acid; C14.0: myristic acid; C15.0: pentadecanoic acid; C16.0: palmitic acid; C17.0: margaric acid; C18.0: stearic acid; C18.2N6C: linoleic acid; C18.3N3: alpha-linolenic acid; C20.0: arachidic acid; C21.0: heneicosanoic acid; C22.0: behenic acid; C24.0: lignoceric acid). According to previous reports, the absence of these three fatty acids in the pollen layer leads to rapid dehydration of the pollen grains (Xue et al, 2018). This result indicates that premature degradation of tapetum and reduction of acetyl-coa results in the failure of the internal fatty acids to be normally transported to the forming microspores, thereby forming the pollen exine, which may be another important cause of microspore development defect.

Subsequently, we examined the expression of fatty acid-related genes in the anthers at stage 9. It was found that the expression level of pollen cuticle and fatty acid synthesis related genes CYP704B2 and DPW, and the expression level of lipid transporter gene C6, which are involved in the formation of pollen wall, were down-regulated in the edt1 mutant. It was demonstrated that both the fatty acid content and its synthesis and transport processes were affected in the edt1 mutant anthers, which correlated with the phenotype of the mutant pollen outer wall synthesis defect. In addition, the expression levels of the protease genes CP1 and AP25 for regulating the PCD process of the rice tapetum were also reduced to some extent (FIG. 17).

Sequence listing

<110> Nanjing university of agriculture

<120> rice anther development regulation gene EDT1 and application thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 3922

<212> DNA

<213> Indica Rice variety IR64(Indica rice variety International Rice64)

<400> 1

actagtcact agtctgtctg gtgtgttgtt ctccttaata acgtaattaa tccatccact 60

gtcaaaccaa gaaacaccaa aagatggaaa aggaaaccga aggcagaaac cattaattct 120

cgcacagcac aatgtatctg gtccgattgg tgtagttagc tccagaccag ctggtcataa 180

acatggtctc atcctcatac agggtgtgca aatcacaata tcttcagtag acaattaatt 240

caggaggatg catatcacaa ttagcagtag tttagtcaat taattaatgc ttcttttcta 300

cactgatgct gcaggttgct tacttagtag atccaatcta gaacacagcg agtcatcttc 360

tttatattca ttccattcct cccaaagacg caacgtgcac acaccaccac caccttcatc 420

tcggtggctt cgttcactcc gcctacctac ctacctttgc agttggtttg ctgaaccctc 480

ctcaagaacc cacgcgcctc tcgcggcagc agctaaccaa gccatggcgc gcaagaagat 540

ccgggagtac gactccaagc gcctcctcaa ggagcacctc aagcgcctcg ccggtatcga 600

cctccagatc ctctccgccc aggttcgatt ctttcttctt cttcttcttg atctcaaagt 660

tttagctttt gtttccggtg atccctggct ggtttggcgt tttttcattt ttggcctgat 720

ttgggcccgc gtgatttggc ctggttgcgt gtaaagatct ggtttttctt tttttttgtt 780

cgctattcat tactcaatga ggcattggca tctgtgaatt catgacaaaa tagttctctg 840

tttagggtaa aatgcgatgc tttaagatga tagtatgaaa tggggatctg gctacaagtc 900

gtatgaagat gcaatttttc tgctgttggg cattgtggat gggctcactt acaggatttt 960

aattttagaa tggaaatgtt cttggttctg tatgcgagtt atggcttgaa ctagtacgac 1020

ttatggttgc ttgcagtttg gtacttgcag tagtattagg tgatactcca tatagtgcaa 1080

aagcatcaat tcctttgtta gatctggagc tttgtcttgc agcattgttt ttgttttttt 1140

ctatgtgtaa attgttagtt aactctcgtt actggtgtcc gtatggtggt gaactggtta 1200

tgatgttgac acttgaatgt tgtcctgatg caaagtgatt tcctctgaaa taaataacag 1260

tacatggact acgtacaagc agatatttcc ttttgttaca ttcacacatt tggggtcact 1320

agggagcctt catacatttt aaactgactg attttgaatt atacaaactg tactatgtgt 1380

gaaattaatc gtaattacgg ttctcgtttg acatagcata tttttgtttg aagttaaaaa 1440

tatcggtttg gctgattctg ggatttgtaa aaaggttaca caatcgacgg acttcacaga 1500

gctggtaaac cagcagccat ggctgtcaac catgaagttg gtcgtgaagc ccgacatgct 1560

gttcgggaag cgtggcaaga gcggacttgt ggccctcaac ctagatattg ctcaagtcaa 1620

ggagtttgtg aaggagaggc tgggagttga ggtagttcaa ttttgctatc gcctttaaaa 1680

tctgacttat tctctgttcg cttgataaat taagttgttc tgtcctattg tggctattca 1740

ggtcgagatg ggtggctgca aggctccaat caccaccttc attgtggagc catttgtacc 1800

ccatgatcaa gaatactacc tttctattgt ctcggagagg ctgggcagca ccattagctt 1860

ctcggaatgt ggaggaatag aaattgagga gaactgggac aaggttaaga caatttttct 1920

tcccactgag aagccaatga cacctgatgc atgtgctccc ttgattgcta cccttccatt 1980

ggaggtattt gtactgttaa aattatttgc cattgtacct tgttcagttg atttcatttg 2040

aggagtactt ccatttgtca catgcttata ataattgaac tgtacatttc gacatcaggc 2100

acgtggaaaa attggtgatt tcattaaagg agtctttgct gttttccaag gtattaaaga 2160

tgcatataga attcactttt catttgttgt aatgttttag ttgtaaatgt aataaacgta 2220

ttggtctatc atgtatccat aacaatatgc tcccattaca gacttagatt tctcatttct 2280

cgagatgaac ccatttacca tcgtgaatgg agagccgtat cctctggaca tgagaggaga 2340

attagatgac acagcagctt tcaaaaactt caagaagtaa gtcccattgc ttctctagca 2400

tacatgcctc tgtgcgaata ttttattaag catttcttgt cactgttcag gtggggaaat 2460

atcgaattcc cactaccatt cggtagagtt ctcagttcta cagaaggctt tatccatgac 2520

ttggatgaga aggtatccac atctcaaatt acacgtttca catttcaagc ctcctcccca 2580

atcttattta agtatgagtt gcctgtataa tatcatcagt aggtttgcac atgaattcag 2640

ataggagtgc tggcagtctg gctcagtact atatgttttt ttgaattatt ttctaaatgt 2700

gatatgatgt ccttattctt tcagacaagt gcatctctga agttcaccgt tttgaaccca 2760

aaggggcgca tctggacaat ggttgctgga ggtggtgcca gtgtcatata tgctgataca 2820

gtaagctttg agttcctccc ttgttttaac ttagctgttc agggatttca tgctactgtc 2880

atgaaattaa cttttttttt tcttatttac caggtcggag atttgggata tgcttcagaa 2940

ttaggaaact atgcagagta tagcggtgct cccaatgagg aggaggttct gcagtatgct 3000

agagtagtac ttgatgtaag cactcaagat ataaccataa ccacatttct ctccactccc 3060

ttgttatgtc aatttgttaa tgataacatt caatgcagtg tgcgactgct gatcctgatg 3120

gccgcaagag agctcttctc attggagggg gtatagctaa cttcaccgac gtcggggcca 3180

catttagcgg catcattcgg gccttaagag agaaggtagc tatgctgacc cctaaatcta 3240

gaattgtggc caatgttctc taaaacttat caccagttcc acatgttcat ctgattgatt 3300

gactgtcaac tgaatctgaa acttgctttc aggaatccaa gttgaaggct gcaaggatgc 3360

acatctatgt ccgacgtggt ggtccaaatt accaaactgg gctggctaaa atgcgcaagc 3420

ttggcgcaga actcggcgtc ccgattgagg tacggatcta ctgtctccta ctgcacctct 3480

ctctttgcta tgcaagacct gttatatctg aagttcataa atgcaaatgg gcaaacctat 3540

cagtttgttg ttggtggttc tgaatcacta tcctgaccat cccctcacac aacacggatg 3600

agctgatttc tgtttgaaca acccatcact gcaggtgtat gggccagaag cgacgatgac 3660

tggaatctgc aagcaagcaa ttgaatgcgt tatggccgca gcataaatga agatgcaagt 3720

tctgggatct gcaggcaaga tgctgaatgc gtgatgggtg cgacatggat gagagtgtgg 3780

tgtagttgca gtagttctct gcagatggct gatttgtttc ttgatacatg ttatacttgg 3840

acgagatctg gataggttat tgatgtactg aaactactac tgcgatgcaa taaaagtgag 3900

agtagcgttt cctgatttgt tc 3922

<210> 2

<211> 502

<212> PRT

<213> Indica Rice variety IR64(Indica rice variety International Rice64)

<400> 2

Met Leu Leu Phe Tyr Thr Asp Ala Ala Gly Cys Leu Leu Ser Arg Ser

1 5 10 15

Asn Leu Glu His Ser Glu Ser Ser Ser Leu Tyr Ser Phe His Ser Ser

20 25 30

Gln Arg Arg Asn Val His Thr Pro Pro Pro Pro Ser Ser Arg Trp Leu

35 40 45

Arg Ser Leu Arg Leu Pro Thr Tyr Leu Cys Ser Trp Phe Ala Glu Pro

50 55 60

Ser Ser Arg Thr His Ala Pro Leu Ala Ala Ala Ala Asn Gln Ala Met

65 70 75 80

Ala Arg Lys Lys Ile Arg Glu Tyr Asp Ser Lys Arg Leu Leu Lys Glu

85 90 95

His Leu Lys Arg Leu Ala Gly Ile Asp Leu Gln Ile Leu Ser Ala Gln

100 105 110

Val Thr Gln Ser Thr Asp Phe Thr Glu Leu Val Asn Gln Gln Pro Trp

115 120 125

Leu Ser Thr Met Lys Leu Val Val Lys Pro Asp Met Leu Phe Gly Lys

130 135 140

Arg Gly Lys Ser Gly Leu Val Ala Leu Asn Leu Asp Ile Ala Gln Val

145 150 155 160

Lys Glu Phe Val Lys Glu Arg Leu Gly Val Glu Val Glu Met Gly Gly

165 170 175

Cys Lys Ala Pro Ile Thr Thr Phe Ile Val Glu Pro Phe Val Pro His

180 185 190

Asp Gln Glu Tyr Tyr Leu Ser Ile Val Ser Glu Arg Leu Gly Ser Thr

195 200 205

Ile Ser Phe Ser Glu Cys Gly Gly Ile Glu Ile Glu Glu Asn Trp Asp

210 215 220

Lys Val Lys Thr Ile Phe Leu Pro Thr Glu Lys Pro Met Thr Pro Asp

225 230 235 240

Ala Cys Ala Pro Leu Ile Ala Thr Leu Pro Leu Glu Ala Arg Gly Lys

245 250 255

Ile Gly Asp Phe Ile Lys Gly Val Phe Ala Val Phe Gln Asp Leu Asp

260 265 270

Phe Ser Phe Leu Glu Met Asn Pro Phe Thr Ile Val Asn Gly Glu Pro

275 280 285

Tyr Pro Leu Asp Met Arg Gly Glu Leu Asp Asp Thr Ala Ala Phe Lys

290 295 300

Asn Phe Lys Lys Trp Gly Asn Ile Glu Phe Pro Leu Pro Phe Gly Arg

305 310 315 320

Val Leu Ser Ser Thr Glu Gly Phe Ile His Asp Leu Asp Glu Lys Thr

325 330 335

Ser Ala Ser Leu Lys Phe Thr Val Leu Asn Pro Lys Gly Arg Ile Trp

340 345 350

Thr Met Val Ala Gly Gly Gly Ala Ser Val Ile Tyr Ala Asp Thr Val

355 360 365

Gly Asp Leu Gly Tyr Ala Ser Glu Leu Gly Asn Tyr Ala Glu Tyr Ser

370 375 380

Gly Ala Pro Asn Glu Glu Glu Val Leu Gln Tyr Ala Arg Val Val Leu

385 390 395 400

Asp Cys Ala Thr Ala Asp Pro Asp Gly Arg Lys Arg Ala Leu Leu Ile

405 410 415

Gly Gly Gly Ile Ala Asn Phe Thr Asp Val Gly Ala Thr Phe Ser Gly

420 425 430

Ile Ile Arg Ala Leu Arg Glu Lys Glu Ser Lys Leu Lys Ala Ala Arg

435 440 445

Met His Ile Tyr Val Arg Arg Gly Gly Pro Asn Tyr Gln Thr Gly Leu

450 455 460

Ala Lys Met Arg Lys Leu Gly Ala Glu Leu Gly Val Pro Ile Glu Val

465 470 475 480

Tyr Gly Pro Glu Ala Thr Met Thr Gly Ile Cys Lys Gln Ala Ile Glu

485 490 495

Cys Val Met Ala Ala Ala

500

Claims (4)

1, SEQ ID NO.1EDT1And the protein shown as SEQ ID NO.2EDT1Or at least one of a recombinant expression vector, an expression cassette or a recombinant bacterium containing the gene shown by SEQ ID NO.1 in rice breeding.

2, SEQ ID NO.1EDT1And the protein shown as SEQ ID NO.2EDT1Or a recombinant expression vector, an expression cassette or a recombinant expression vector containing the gene shown in SEQ ID NO.1The application of at least one recombinant strain in breeding rice with normal anther development.

3. A method for culturing the rice with anther growing normally features that the gene shown by SEQ ID NO.1 is introduced to the rice variety with anther growing abnormally.

4. The method according to claim 3, wherein the gene represented by SEQ ID NO.1 is introduced into a rice variety with abnormal anther development by a recombinant expression vector containing the gene.

Images