CN112322708B - Method for improving detection efficiency of dcaps marks - Google Patents
Method for improving detection efficiency of dcaps marks Download PDFInfo
- Publication number
- CN112322708B CN112322708B CN202011118509.8A CN202011118509A CN112322708B CN 112322708 B CN112322708 B CN 112322708B CN 202011118509 A CN202011118509 A CN 202011118509A CN 112322708 B CN112322708 B CN 112322708B
- Authority
- CN
- China
- Prior art keywords
- mixed solution
- primer
- dcaps
- gene
- leaf rust
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a method for improving detection efficiency of dcaps markers, and relates to the technical field of molecular biology. The method for improving detection efficiency of dcaps markers comprises the following steps: s1, selecting a target gene sequence: extracting a known wheat leaf rust resistance gene Lr67 and a wild type pathogenic gene thereof, designing primers S2 and dCAPS: extracting a wheat leaf rust resistance gene Lr67 in S1, preparing a primer with a normal sequence length by matching with dCAPS Finder2.0 equipment, and amplifying the sequence length of the primer in S3: and (3) amplifying the primer prepared in the S2 for a certain sequence length. According to the method for improving detection efficiency of dCAPS markers, enzyme cutting sites are introduced into dCAPS primers, the length of the primers is generally about 20bp, fragments which are about 20bp shorter than the original fragments are generated after PCR enzyme cutting, polyacrylamide gel electrophoresis is generally adopted for separating 20bp fragment differences, and a tail sequence of more than 30bp is added to the 5' end of the primers, so that the size difference of wild type fragments and mutant fragments after enzyme cutting is increased to more than 50 bp.
Description
Technical Field
The invention relates to the technical field of molecular biology, in particular to a method for improving detection efficiency of dcaps markers.
Background
Single Nucleotide Polymorphisms (SNPs) are the most widely distributed and numerous genetic markers, and can be detected using the Cleaved Amplified Polymorphic Sequences (CAPS) technique when the SNP site is located exactly at the restriction enzyme site, but this is less (depleted cleaned Amplified Polymorphic Sequences, dCAPS) technique is an extension of CAPS, and detection is performed by introducing a mismatch when designing a primer near the SNP, thereby generating or removing the restriction enzyme recognition site, and almost all SNP sites can be detected by the CAPS and dCAPS techniques, but in the prior art, the mismatch base introduced in the asp technique is in the primer sequence, i.e., the cleavage site is near the primer end, and the general primer length is about 20bp, so the fragment size difference of the cleavage product is generally about 20bp, which is very difficult to separate using electrophoresis, and if the agarose gel separation is high, the gel separation is more time is required, and the gel detection is complicated, and the gel detection is complicated, and thus the gel detection is complicated.
Disclosure of Invention
The invention aims to provide a method for improving detection efficiency of dcaps markers, which can effectively simplify the actual detection process, shorten the actual electrophoresis time, facilitate the dyeing of target genes and further effectively improve the actual detection efficiency.
In order to achieve the purpose, the invention is realized by the following technical scheme: a method for improving detection efficiency of dcaps markers comprises the following steps:
s1, selecting a target gene sequence: extracting known wheat leaf rust resistance gene Lr67 and wild type disease-sensitive gene thereof.
Designing primers of S2 and dCAPS: extracting the wheat leaf rust resistance gene Lr67 in S1 to prepare a primer with normal sequence length by matching with dCAPS Finder2.0 equipment.
S3, primer sequence length amplification: and (3) carrying out certain sequence length amplification on the primer prepared in the S2.
S4, PCR amplification of the wheat leaf rust resistance gene Lr67: and (3) normally carrying out PCR amplification on the wheat leaf rust resistance gene Lr67 by using a PCR amplification device through the primer in the S3.
S5, agarose gel preparation: adding 1g of agarose into every 100ml of TAE electrophoresis buffer solution, mixing and shaking up the mixed solution, placing the mixed solution into heating equipment, heating until the agarose is completely dissolved, taking out the mixed solution, cooling the mixed solution to 60 ℃, adding EB dye solution, and shaking up the mixed solution.
S6, preparing electrophoresis conditions: and (3) injecting the mixed solution in the step (S4) into the rubber plate with the two ends sealed by the adhesive tape, selecting a comb with proper specification to be inserted into the rubber plate, waiting for the mixed solution to solidify at room temperature, taking down the adhesive tape at the two ends of the rubber plate after the mixed solution solidifies, placing the solidified mixed solution into an electrophoresis tank, adding TAE electrophoresis buffer solution into the electrophoresis tank, and then pulling out the comb in the vertical direction.
S7, marking genes and detecting: sucking the wild type disease-sensitive gene in S1 and the wheat leaf rust resisting gene Lr67 in S4 on a sealing film by a pipettor, adding a sample-carrying buffer solution, uniformly mixing the mixed solution, injecting the mixed solution into a sample application hole, starting an electrophoresis tank, taking out the solid mixed solution after electrophoresis treatment, placing the solid mixed solution in EB dye solution for dyeing treatment, properly rinsing the solid mixed solution after dyeing treatment by using clear water, and placing the solid mixed solution on an ultraviolet projection detector for comparison and observation of the marking effect.
As a further scheme of the invention: the sequence length is amplified by introducing a primer of Hinfl enzyme cutting site into the sequence of the wheat leaf rust resistant gene Lr67, and adding polypurine or polypyrimidine of 30bp-40bp to the 5' end of the introduced primer of the Hinfl enzyme cutting site to prepare the primer of which the sequence length is increased.
As a further scheme of the invention: the polypurine and the polypyrimidine are any one or more of poly-adenine and poly-thymine.
As a further scheme of the invention: the agarose content is 2%, the consumption of the EB dye solution is 100 mu l, and the concentration of the EB dye solution is 0.5mg/ml.
As a further scheme of the invention: the liquid level of the TAE electrophoresis buffer solution covers the solid mixed solution and the height of the solid mixed solution is 1-2mm.
As a further scheme of the invention: the temperature of the mixed solution injected into the rubber plate is 45-50 ℃.
As a further scheme of the invention: the dosage of the wild type disease-sensitive gene and the wheat leaf rust resistance gene Lr67 is 4 mul.
As a further scheme of the invention: the loading buffer was 6 times the normal concentration and the loading buffer was used in an amount of 2. Mu.l.
As a further scheme of the invention: the starting duration of the electrophoresis tank is 30-60min, and the starting voltage is 3-5V.
As a further scheme of the invention: the EB dye liquor is used for dyeing for 5-10min.
The invention provides a method for improving detection efficiency of dcaps marks. The method has the following beneficial effects:
according to the method for improving dCAPS marker detection efficiency, a restriction enzyme site is introduced into a primer of dCAPS, the length of the primer is generally about 20bp, fragments which are about 20bp shorter than the original fragments are generated after PCR restriction, the fragment difference of 20bp is generally separated by adopting polyacrylamide gel electrophoresis, a tail sequence of more than 30bp is added to the 5' end of the primer, the size difference of fragments of a wild type and a mutant after restriction enzyme is increased to more than 50bp, and then 2% of agarose gel electrophoresis can be used for simple, convenient and rapid separation.
Drawings
FIG. 1 is a flow chart of the present invention;
Detailed Description
The invention is illustrated below with reference to specific examples. It will be understood by those skilled in the art that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention in any way.
Embodiment 1, a method for improving detection efficiency of dcaps markers, comprising the steps of: step one, selecting a target gene sequence: extracting a known wheat leaf rust resistance gene Lr67 and a wild type pathogenic gene thereof, providing basic raw materials required by an experiment, and designing a dCAPS primer: extracting the wheat leaf rust resistance gene Lr67 in the first step to prepare a primer with a normal sequence length by matching with dCAPS Finder2.0 equipment, preparing raw materials required by an experiment, and amplifying the sequence length of the primer in the third step: and (2) performing certain sequence length amplification on the primer prepared in the step (II), wherein the sequence length amplification is to introduce a primer of a Hinfl enzyme cutting site into the sequence of the wheat leaf rust resistant gene Lr67, and add polypurine or polypyrimidine of more than 30bp to the 5' end of the introduced primer of the Hinfl enzyme cutting site to prepare a primer with the length of an increased sequence, wherein the polypurine and the polypyrimidine are any one or more of poly-adenine and poly-thymine, the whole sequence of the primer is increased, so that a longer effective target gene sequence can be effectively amplified by PCR amplification, and the step (IV) is to amplify the wheat leaf rust resistant gene Lr67 by PCR: using PCR amplification equipment to normally carry out PCR amplification on the wheat leaf rust resistance gene Lr67 by using the primers in the third step, preparing a detection raw material, and carrying out agarose gel preparation: adding 1g of agarose into every 100ml of TAE electrophoresis buffer solution, mixing and shaking up the mixed solution, placing the uniformly mixed solution into heating equipment, heating until the agarose is completely dissolved, taking out the solution, cooling the mixed solution to 60 ℃, adding EB dye solution, shaking up, wherein the content of the agarose is 2%, the using amount of the EB dye solution is 100 mu l, the concentration of the EB dye solution is 0.5mg/ml, preparing for effective detection of the marker gene through agarose gel electrophoresis, and preparing the electrophoresis conditions: injecting the mixed solution in the fourth step into the rubber plate with two ends sealed by the adhesive tape, selecting a comb with proper specification to be inserted into the rubber plate, waiting for the mixed solution to solidify at room temperature, taking down the adhesive tape at the two ends of the rubber plate after the mixed solution solidifies, placing the solidified mixed solution into an electrophoresis tank, adding a TAE electrophoresis buffer solution into the electrophoresis tank, pulling out the comb in the vertical direction, covering the liquid level of the TAE electrophoresis buffer solution with the solid mixed solution at the height of 1-2mm, injecting the mixed solution into the rubber plate at the temperature of 45-50 ℃, preparing for electrophoresis treatment of the solidified mixed solution, marking genes and detecting: sucking the wild type disease-sensitive genes and the wheat leaf rust resistant genes Lr67 in the first step and the fourth step on a sealing film by a pipette, adding a sample-carrying buffer solution, uniformly mixing the mixed solution, injecting the mixed solution into a sample application hole, starting an electrophoresis tank, taking out the solid mixed solution after electrophoresis treatment, placing the solid mixed solution into an EB dye solution for dyeing treatment, properly rinsing the solid mixed solution after dyeing treatment by using clear water, placing the rinsed solid mixed solution on an ultraviolet projection detector for comparison and observation of the marking effect, wherein the use amount of the wild type disease-sensitive genes and the wheat leaf rust resistant genes Lr67 is 4 mu l, the use amount of the sample-carrying buffer solution is 6 times of the normal concentration, the use amount of the sample-carrying buffer solution is 2 mu l, the starting duration time of the electrophoresis tank is 30-60min, the starting voltage is 3-5V, and the dyeing time of the EB dye solution is 5-10min, so that the gene can be efficiently marked by agarose gel electrophoresis.
When the primer is used, a tail sequence of 30bp-40bp is added at the 5' end of the primer, so that the difference of the sizes of the wild type and the mutant fragments after enzyme digestion is increased to more than 50bp, and then 2% agarose gel electrophoresis can be used for simple and rapid separation.
To further illustrate the beneficial effects of the present invention, the present inventors selected the known wheat leaf rust resistance gene Lr67 and the susceptible gene with SNP differences, and obtained the following data, which are detailed in table 1:
the wheat leaf rust gene Lr67 susceptible sequence is selected as (SEQ ID No. 1): ATCCTGGCAGGCATCCTGCTTTGGTTGCGGCGTCGGCTTCGCCAACCAGGTTAGCA；
The sequence of the wheat leaf rust resistance gene Lr67 is selected as (SEQ ID No. 2): ATCCTGGCAGGCATCCTGCTTTCGTTGCGGCGTCGGCTTCGCCAACCAGGTTAGCA；
And the actual detection time of the actual polyacrylamide gel electrophoresis is longer than the detection time of the agarose gel electrophoresis.
TABLE 1 Experimental data sheet
The experimental data show that the embodiment 1 can replace polyacrylamide gel electrophoresis with agarose gel electrophoresis for dCAPS detection, so that a dCAPS detection mode is simplified, the detection time is shortened, and the dCAPS detection efficiency is improved.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various changes and modifications can be made without departing from the inventive concept of the present invention, and these changes and modifications are all within the scope of the present invention.
Sequence listing
<110> institute of agricultural sciences of Shandong province
<120> method for improving detection efficiency of dcaps marks
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 55
<212> DNA
<213> wheat (Triticum aestivum)
<400> 1
atcatcggca ggatcctgct tggttgcggc gtcggcttcg ccaaccaggt tagca 55
<210> 2
<211> 55
<212> DNA
<213> wheat (Triticum aestivum)
<400> 2
atcatcggca ggatcctgct tcgttgcggc gtcggcttcg ccaaccaggt tagca 55
<210> 3
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
atcatcggca ggatcctgat t 21
<210> 4
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
ctttgatact accgtggg 18
<210> 5
<211> 59
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaat catcggcagg atcctgatt 59
Claims (9)
1. A method for increasing detection efficiency of dcaps markers, comprising the steps of:
s1, selecting a target gene sequence: extracting a known wheat leaf rust resistance gene Lr67 and a wild type disease-sensitive gene thereof;
designing primers of S2 and dCAPS: extracting a wheat and wheat leaf rust resistance gene Lr67 in S1 to prepare a primer with a normal sequence length by matching with dCAPS Finder2.0 equipment; the normal sequence length primer sequences are SEQ ID No.3 and SEQ ID No.4;
s3, primer sequence length amplification: amplifying the primers prepared in the S2 for a certain sequence length; the sequence length amplification is to introduce a primer of a Hinfl enzyme cutting site into a sequence of a wheat leaf rust resistant gene Lr67, and add polypurine or polypyrimidine of 30bp-40bp to the 5' end of the introduced primer of the Hinfl enzyme cutting site to prepare a primer with the increased sequence length, wherein the primer sequence is SEQ ID No.5;
s4, PCR amplification of a wheat leaf rust resistance gene Lr67: using PCR amplification equipment to ensure that the primers in the S3 normally carry out PCR amplification on the wheat leaf rust resistance gene Lr 67;
s5, agarose gel preparation: adding 1g of agarose into every 100ml of TAE electrophoresis buffer solution, mixing and shaking up the mixed solution, placing the uniformly mixed solution into heating equipment, heating until the agarose is completely dissolved, taking out the solution, cooling the mixed solution to 60 ℃, adding EB dye solution, and shaking up;
s6, preparing electrophoresis conditions: injecting the mixed solution obtained in the step (S4) into a rubber plate with two ends sealed by an adhesive tape, inserting a comb with proper specification into the rubber plate, waiting for the mixed solution to solidify at room temperature, taking off the adhesive tape at the two ends of the rubber plate after the mixed solution solidifies, placing the solidified mixed solution into an electrophoresis tank, adding a TAE electrophoresis buffer solution into the electrophoresis tank, and then pulling out the comb in the vertical direction;
s7, marking genes and detecting: sucking the wild type disease-sensitive gene in S1 and the wheat leaf rust resisting gene Lr67 in S4 on a sealing film by a pipettor, adding a sample-carrying buffer solution, uniformly mixing the mixed solution, injecting the mixed solution into a sample application hole, starting an electrophoresis tank, taking out the solid mixed solution after electrophoresis treatment, placing the solid mixed solution in EB dye solution for dyeing treatment, properly rinsing the solid mixed solution after dyeing treatment by using clear water, and placing the solid mixed solution on an ultraviolet projection detector for comparison and observation of the marking effect.
2. The method of claim 1, wherein the polypurine and polypyrimidine are any one or more of poly-adenine and poly-thymine.
3. The method of claim 1, wherein the agarose content is 2%, the EB dye solution is used in an amount of 100 μ l, and the EB dye solution concentration is 0.5mg/ml according to the operation step in S5.
4. The method of claim 1, wherein the TAE running buffer level covers 1-2mm of the height of the solid-state mixed solution according to the step of S6.
5. The method of claim 1, wherein the temperature of the mixed solution injected into the gel plate is 45 ℃ to 50 ℃ according to the step of S6.
6. The method of claim 1, wherein the wild-type susceptibility gene and the wheat leaf rust resistance gene Lr67 are both used in an amount of 4 μ l, based on the procedure of S7.
7. The method of claim 1, wherein the loading buffer is 6 times the normal concentration and the loading buffer is 2 μ l according to the step of S7.
8. The method of claim 1, wherein the electrophoresis chamber has an actuation duration of 30-60min and an actuation voltage of 3-5V according to the operation of S7.
9. The method of claim 1, wherein the EB stain is stained for 5-10min according to the procedure in S7.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011118509.8A CN112322708B (en) | 2020-10-19 | 2020-10-19 | Method for improving detection efficiency of dcaps marks |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011118509.8A CN112322708B (en) | 2020-10-19 | 2020-10-19 | Method for improving detection efficiency of dcaps marks |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112322708A CN112322708A (en) | 2021-02-05 |
| CN112322708B true CN112322708B (en) | 2022-11-01 |
Family
ID=74313180
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011118509.8A Active CN112322708B (en) | 2020-10-19 | 2020-10-19 | Method for improving detection efficiency of dcaps marks |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112322708B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108796053A (en) * | 2018-06-29 | 2018-11-13 | 四川农业大学 | A kind of identification method of arabidopsis gene mutant |
-
2020
- 2020-10-19 CN CN202011118509.8A patent/CN112322708B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108796053A (en) * | 2018-06-29 | 2018-11-13 | 四川农业大学 | A kind of identification method of arabidopsis gene mutant |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112322708A (en) | 2021-02-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Yue et al. | A simple and affordable method for high‐throughput DNA extraction from animal tissues for polymerase chain reaction | |
| Ohshima et al. | Nucleotide sequences of mouse genomic loci including a gene or pseudogene for U6 (4.8 S) nuclear RNA | |
| CN102858995A (en) | Methods of targeted sequencing | |
| CN106939342B (en) | SNP marker linked with millet beige, primer and application | |
| CN107354211B (en) | Forest musk deer four-base microsatellite genetic marker locus and screening method thereof | |
| CN109706236A (en) | A method of utilizing micrococcal nuclease plant identification genome open chromatin site | |
| CN110923333B (en) | Haplotype marker related to lambing number in first intron of goat ZBP1 gene and application thereof | |
| CN110747282B (en) | Low-salt-resistant molecular marker C22 of portunus trituberculatus and application thereof | |
| CN111254203A (en) | Saline-alkali-resistant molecular marker C325 of portunus trituberculatus and application thereof | |
| CN112322708B (en) | Method for improving detection efficiency of dcaps marks | |
| CN107447026B (en) | Specific molecular marker primer for identifying brown planthopper resistant gene BPH3 genotype of rice and application thereof | |
| CN107254542A (en) | Watermelon color traits major gene loci and its InDel molecular labelings and application | |
| CN104099423B (en) | For the molecular labeling of cutter long-tailed anchovy different ecological type population identification | |
| CN109234435B (en) | Method for identifying wheat straw wall thickness and primer thereof | |
| CN108642209B (en) | Wheat plant thousand grain weight judgment marker and application thereof | |
| CN108977435B (en) | Construction method of old blood trace miRNA high-throughput sequencing library | |
| CN116200472A (en) | Application of cattle SCN9A gene InDel marker in early selection of meat quality traits | |
| CN113373241B (en) | Microsatellite marker of fishes in loach, and amplification primer and application thereof | |
| CN106222268B (en) | POU1F1 haplotype molecular marker related to duck growth traits and application | |
| CN112430675B (en) | Method for identifying anti-cysticercosis trait of bee colony by using SNP marker KZ 288474.1-322717 | |
| CN104073562B (en) | A kind of molecular marker for cutter long-tailed anchovy different ecological type population identification | |
| CN109576388B (en) | China fir EST-SSR molecular marker combination | |
| Zhou et al. | Direct fluorescent primers are superior to M13-tailed primers for Pinus taeda microsatellites | |
| CN108913784B (en) | Detection method of EC12 SNP marker of exopalaemon carinicauda | |
| CN108570509B (en) | Detection method of EC16SNP marker of exopalaemon carinicauda |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |