CN112321620B

CN112321620B - Keap1-Nrf2 PPI inhibitor prodrug, preparation method and application

Info

Publication number: CN112321620B
Application number: CN202011244101.5A
Authority: CN
Inventors: 尤启冬; 姜正羽; 王小鹿; 吕逸菲; 张贤; 陆朦辰; 郭小可; 徐晓莉; 王磊
Original assignee: China Pharmaceutical University
Current assignee: China Pharmaceutical University
Priority date: 2020-11-10
Filing date: 2020-11-10
Publication date: 2022-03-29
Anticipated expiration: 2040-11-10
Also published as: CN112321620A

Abstract

The invention discloses a Keap1-Nrf2 PPI inhibitor prodrug, a preparation method and application thereof. The prodrug P-168 provided by the invention seals polar carboxylic acid groups of an active compound 168, improves fat solubility, and effectively improves membrane permeability and pharmacy; the prodrug P-168 is reduced under the condition of high ROS, a pharmacophore 168 and a fluorescent group coumarin are released, the expression of Nrf2 and downstream genes thereof is activated, the anti-inflammatory activity is exerted, and the fluorescence is released to realize visual monitoring.

Description

Keap1-Nrf2 PPI inhibitor prodrug, preparation method and application

Technical Field

The invention belongs to the field of medicinal chemistry, and particularly relates to a Keap1-Nrf2 PPI inhibitor prodrug, a preparation method and application thereof.

Background

One of the most important protection mechanisms of cells is the Keap1-Nrf2-ARE signaling pathway, which regulates oxidative stress in vivo and maintains redox balance. The signaling pathway regulates the expression of over 100 genes and functions associated with oxidative stress and cell survival, including direct antioxidant proteins, phase I and II electrophilic detoxification enzymes, free radical metabolism, inhibition of inflammation, glutathione homeostasis, proteasome function, recognition of DNA damage, and expression of various related growth factors and transcription factors. The discovery of Keap1-Nrf2 PPI inhibitors has become a promising strategy for developing novel molecules against a variety of stresses.

The subject group has found the first compound 168 with nanomolar inhibitory activity against Keap1-Nrf2 PPI, having an EC of₅₀It was 28.6 nM. However, the compound contains polar carboxylic acid group, so that the fat solubility is poor, and the membrane permeability and the drug property are influenced.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides a Keap1-Nrf2 PPI inhibitor prodrug, a preparation method and application thereof. The above purpose of the invention is realized by the following technical scheme:

a Keap1-Nrf2 PPI inhibitor prodrug having the chemical structure:

the preparation method of the Keap1-Nrf2 PPI inhibitor prodrug comprises the following steps:

the reagents and reaction conditions for each step were as follows:

(a) refluxing and stirring the compound 5 and a proper amount of sodium propionate, propionic anhydride and piperidine at 120 ℃ for 6 hours;

(b) CCl to Compound 6₄Adding a proper amount of NBS and AIBN into the solution, carrying out thermal reflux reaction for 8 hours, and removing the solvent under reduced pressure; adding a proper amount of NaOAc and acetic acid into the obtained residue, and carrying out a thermal reflux reaction for 12 hours; subsequently, an appropriate amount of hydrochloric acid was added to the hot reaction mixture, the reaction was continued for 30 minutes, and stirred at room temperature overnight;

(c) dissolving the compound 7 and an appropriate amount of pyridine in dichloromethane, stirring in an ice bath for 10 minutes, slowly adding an appropriate amount of trifluoromethanesulfonic anhydride, and stirring the reaction mixture for 2 hours;

(d) adding an appropriate amount of compound 8 to stirred bis (pinacolato) diboron, Pd (dppf) Cl₂·CH₂Cl₂And KOA in dioxane, the reaction mixture was refluxed under nitrogen for 8 hours; after completion of the reaction, the solvent was removed under reduced pressure, and the reaction mixture was diluted with EtOAc, washed with brine, anhydrous Na₂SO₄Drying, filtering, and removing the solvent under reduced pressure; the crude product was dissolved in MeOH and the appropriate amount of NaBH added₄Stirring and reacting for 1 hour at normal temperature;

(e) dissolving the compound 168 in dichloromethane, adding a proper amount of DMAP and DCC, stirring for half an hour at normal temperature, adding a proper amount of a compound 9, and stirring overnight;

wherein the chemical structural formula of the compound 168 in the step (e) is:

the application of the Keap1-Nrf2 PPI inhibitor prodrug in preparing anti-inflammatory drugs.

The application of the Keap1-Nrf2 PPI inhibitor prodrug in preparing the medicines for resisting inflammation and monitoring the inflammation relieving degree.

Has the advantages that:

1. the prodrug P-168 provided by the invention seals polar carboxylic acid groups of an active compound 168, improves fat solubility, and effectively improves membrane permeability and pharmacy;

2. the prodrug P-168 provided by the invention contains three functional fragments: (1) active compound 168, a Keap1-Nrf2 PPI inhibitor with superior activity; (2) a coumarin fluorophore; (3) an ROS activatable phenylboronate group; the compound is reduced under the condition of high ROS, a pharmacophore 168 and a fluorescent group coumarin are released, the expression of Nrf2 and downstream genes thereof is activated, the anti-inflammatory activity is exerted, meanwhile, fluorescence is released to realize visual monitoring, and the reduction of fluorescence intensity indicates that inflammation is relieved;

3. the prodrug P-168 provided by the invention is coupled with H₂O₂Is more selective than other biologically relevant ROS (e.g., hydroxyl radical, t-butoxy radical, superoxide, hypochlorite anion, and t-butyl hydroperoxide), and H₂O₂Is the most typical ROS in inflammation, thus ensuring that the prodrug P-168 is not easily interfered with for the selectivity of the visible monitoring of inflammation.

Drawings

FIG. 1A is H₂O₂Schematic HPLC peak profile of the activated prodrug P-168 to release prodrug and coumarin group; 1B is a time gradient technical release curve detected by HPLC; 1C is the fluorescence spectrum of the prodrug P-168 under the time gradient (0-60min), and the fluorescence intensity at the wavelength of 465nm is taken to draw a time gradient release curve; 1D is H₂O₂The fluorescence spectrum of prodrug P-168 under the concentration trend (0-10mM) is taken to plot the fluorescence intensity at 465nm as H₂O₂Concentration gradient release profile.

FIG. 2A is a fluorescence spectrum of prodrug P-168 detected in the presence of various ROS; 2B is the calculated percentage of prodrug P-168 released in the presence of each ROS.

FIG. 3A shows the effect of prodrug P-168 and prodrug 168 on H₂O₂LC-MS analysis after pretreatment of RAW264.7 cells; 3B is the prodrug P-168 acting on H₂O₂The fluorescence intensity (fold) after pretreatment of RAW264.7 cells was varied with time gradient; 3C acting on H as prodrug P-168₂O₂The fluorescence intensity (fold) after pretreatment of RAW264.7 cells was varied with concentration gradient.

FIG. 4 is a comparison of the ARE inducing activity and selectivity of LPS activation, with 4A being the ARE inducing activity of prodrugs P-168 and 168 in HepG2-ARE-C8 cells; 4B is the ARE induction activity of P-168 in RAW264.7 cells under different concentrations of LPS; 4C is ARE induction activity of adding P-168 with different concentrations after LPS treatment in RAW264.7 cells; d is the time trend of ARE induction activity by the addition of P-168 after LPS treatment in RAW264.7 cells.

FIGS. 5A-D are real-time quantitative PCR analyses of Nrf2(A), HO-1(B), NQO1(C) and GCLM (D) in RAW264.7 cells; 5E is the determination of GSH/GSSG levels in RAW264.7 cells; 5F is the Western blot analysis of Nrf2 downstream protein and inflammatory factors IL-1 beta and IL-6 in RAW264.7 cells.

FIGS. 6A-B are real-time quantitative PCR analyses of IL-1. beta. (A) and IL-6(B) in RAW264.7 cells; C-F the concentrations of IL-1 β (D), IL-6(E), TNF- α (F) and NO (G) in the culture supernatants of RAW264.7 cells were investigated for ELISA assays.

FIG. 7 is the chemical structural formula of prodrug P-168.

Detailed Description

The following detailed description of the present invention is provided with reference to the accompanying drawings, which are not intended to limit the scope of the present invention.

Firstly, synthesis and structure confirmation of target compound

1.1 Experimental instruments and general rules

All chemicals purchased from commercial suppliers were used as received, unless otherwise indicated. All solvents were reagent grade, purified and dried by standard methods if necessary. All reactions were monitored by Thin Layer Chromatography (TLC) on a visual silica gel plate (GF-254). Melting points were determined on a Mel-TEMP II melting point apparatus without calibration. Determined on a Bruker Avance-300 Instrument¹HNMR and¹³CNMR spectroscopy. Using CDCl₃Or DMSO-d6 as solvent, and the chemical shifts (δ) reported are parts per million (ppm) of Tetramethylsilane (TMS). HR-MS spectra were recorded on a Water Q-Tof micro mass spectrometer. Flash column chromatography was performed on 100-200 mesh silica gel to obtain chromatographically and spectroscopically pure compounds. The purity of the compounds was verified by HPLC studies performed on an Agilent C18(4.6mm X150 mm, 3.5 μm) column using a mixture of solvents methanol/water at a flow rate of 0.5mL/min and monitored by UV absorption at 254 nm.

1.2 Synthesis and characterization of Compounds

The synthetic route is as follows:

Reagents and conditions:(a)NH₂OH·HCl,ethanol,MeOH,60℃,2h；(b)Pd/C,H₂,rt,4h；(c)4-Methoxybenzenesulfonyl chloride,toluene,pyridine,100℃,2h；(d)DMF,K₂CO₃,ethyl bromoacetate,rt,3h；(e)NaOH,MeOH,H₂O,2h.

Reagents and conditions:(a)propionic anhydride,piperidine,reflux,6h；(b)(1)NBS,CCl₄,reflux,8h；(2)NaOAc,AcOH,reflux,12h；(3)2N HCl,reflux,rt,overnight；(c)Tf₂O,Py,DCM,2h；(d)(1)Bis(pinacolatol)diboron,PdCl₂dppf,KOAc,dioxane,reflux,8h；(2)NaBH₄,MeOH,rt,1h；(e)DCC,DMAP,DCM,rt,overnight.

synthesis of 4-nitronaphthalen-1-amine (2):

alpha-nitronaphthalene (1) (3g, 11.5mmol) and hydroxylamine hydrochloride (5g, 72mmol) were dissolved in 150ml 95% ethanol, heated to 60 ℃ and stirred for 1 hour. A solution of 10g of potassium hydroxide in 60ml of methanol was gradually added with stirring. Stirring was continued for one hour and the warm solution was poured slowly into ice water. The solid was filtered and washed with water. Recrystallization from acetonitrile gave compound 2 as a yellow solid in 55% yield. m.p. 191-192 ℃.¹H-NMR(300MHz，DMSO-d6)：δ8.89(d，1H，J＝8.9)，8.37(d，1H，J＝9.0)，8.30(d，1H，J＝8.9)，7.74(dd，1H，J＝6.9，1.0)，7.52(dd，1H，J＝6.9，1.0)，7.11(s，1H)，6.67(d，1H，J＝9.0).HRMS(ESI)：189.0659[M+H]⁺.

Synthesis of N, N' - (naphthalene-1, 4-diyl) bis (4-methoxybenzenesulfonamide) (3):

to a solution of 4-nitro-1-naphthylamine (2) (1.81g, 10mmol) in THF was added Pd/C. The reaction mixture was stirred under hydrogen for 4 hours. The solution was filtered through celite to remove the catalyst. The filtrate was concentrated under reduced pressure to give a pale yellow oil. The crude naphthalene-1, 4-diamine was not further purified. 4-Methoxybenzenesulfonyl chloride (3.75g, 22mmol) and pyridine (2.37g, 30mmol) were added to a solution of naphthalene-1, 4-diamine in toluene. The reaction mixture was stirred at 100 ℃ for 2 hours under nitrogen. After cooling to room temperature, the reaction mixture was diluted by pouring 20mL of petroleum ether. After filtration, the solid was collected and recrystallized from acetonitrile to give compound 3 as a grey solid in 54% yield. m.p.: 217 ℃ to 219 ℃.¹HNMR(300MHz，DMSO-d6)：δ10.04(s，2H)，7.95(dd，2H，J＝6.5±3.2)，7.55(d，4H，J＝8.9)，7.39(dd，2H，J＝6.5±3.2)，7.00(m，6H)，3.77(s，6H).HRMS(ESI)：521.1026[M+Na]⁺.

Synthesis of diethyl 2, 2' - (naphthalene-1, 4-diylbis (((4-methoxyphenyl) sulfonyl) aza) diacetate (4):

to a solution of compound 3(997mg, 2mmol) in DMF (5ml) was added K₂CO₃(830mg, 6mmol) followed by ethyl bromoacetate (836mg, 5 mmol). After stirring at room temperature for 3 hours, the reaction mixture was then poured into 30mL of water and adjusted to pH 5 with 2M hydrochloric acid. Filtration gave the crude product which was recrystallized from ethyl acetate/n-hexane to give a light pink solid 4 in 64% yield. m.p.: 71-73 ℃.¹H-NMR(300MHz，DMSO-d6)：δ8.30(m，1H)，8.18(m，1H)，7.58(m，6H)，7.11(m，4H)，7.04(s，1H)，6.86(s，1H)，4.48(m，4H)，4.01(m，4H)，3.88(s，3H)，3.84(s，3H)，1.06(m，6H).HRMS(ESI)：693.1558[M+Na]⁺.

Synthesis of 2' - (naphthalene-1, 4-diylbis (((4-methoxyphenyl) sulfonyl) azenediyl)) diacetic acid (168):

compound 4(670mg, 1mmol) was added to NaOH (4g) in MeOH/H₂O (20/20ml) solution. The reaction mixture was heated in an oil bath at 65 ℃ for 2 hours, then adjusted to pH 2 with 2M hydrochloric acid and diluted with 75mL of water. The precipitate was filtered, washed with 5X 10mL of water and dried to give 168 as a white solid in 64% yield. m.p.: 236 ℃ and 238 ℃.¹H-NMR(300MHz，DMSO-d6)：δ12.8(s，2H)，8.30(m，1H)，8.18(m，1H)，7.58(m，6H)，7.16(d，4H，J＝9.5)，7.05(s，1H)，6.89(s，1H)，4.38(m，4H)，3.88(s，3H)，3.84(s，3H)；HRMS(ESI)：637.0934[M+Na]⁺.

Synthesis of 3-methyl-2-oxo-2H-chromen-7-yl propionate (6):

a mixture of 2, 4-dihydroxybenzaldehyde (3.0g, 21.72mmol), sodium propionate (4.59g, 47.78mmol), propionic anhydride (7.63g, 58.64mmol) and piperidine (0.4ml) was stirred at 120 ℃ under reflux for 6 hours. The reaction solution was poured into ice water, the precipitate was collected by filtration and dissolved in EtOAc, and the organic layer was washed with water and 1N HCl, followed by anhydrous Na₂SO₄And (5) drying. Subjecting the residue to column chromatography to obtain compoundProduct 6 was a white crystal with a yield of 50%. m.p.: 110 ℃ and 112 ℃.¹H NMR(300MHz，CDCl₃)δ7.50(s，1H)，7.40(d，1H，J＝8Hz)，7.08(d，1H，J＝2Hz)，7.00(dd，1H，J＝8.2Hz)，2.64-2.59(2H)，2.20(s，3H)，1.29-1.25(3H)；HRMS(ESI)：233.0808[M+H]⁺.

Synthesis of 7-hydroxy-2-oxo-2H-chromene-3-carbaldehyde (7):

to compound 6(2.7g, 11.9mmol) in 75mL CCl₄NBS (5.31g, 29mmol) and a catalytic amount of AIBN were added to the solution in (1), and the mixture was refluxed. After 8 hours of reaction, the solvent was removed under reduced pressure. To the resulting residue were added NaOAc (8.78g, 107mmol) and acetic acid (80mL), and the mixture was heated under reflux for 12 hours. Subsequently, 2N HCl (60mL) was added to the hot reaction mixture and the reaction was allowed to continue for 30 minutes and stirred at room temperature overnight. The reaction mixture was then evaporated to dryness and the residue was directly purified by column chromatography to give compound 7 as a yellow powder in 50% yield. m.p.: 118 ℃ and 120 ℃.¹HNMR(300MHz，DMSO-d6)δ10.86(s，1H)，8.20(s，1H)，7.89(d，1H，J＝8.2Hz)，7.23(dd，1H，J＝8.2，2Hz)，7.21(d，1H，J＝2Hz)。HRMS(ESI)：191.0339[M+H]⁺.

Synthesis of 3-formyl-2-oxo-2H-chromen-7-yl trifluoromethanesulfonate (8):

compound 7(100mg, 0.52mmol) and pyridine (0.06mL, 0.73mmol) were dissolved in 20mL of dichloromethane and stirred in an ice bath for 10 min. Trifluoromethanesulfonic anhydride (106. mu.L, 0.63mmol) was added slowly. The reaction mixture was stirred for 2 hours. After completion of the reaction, the reaction mixture was diluted with dichloromethane, washed twice with brine, over anhydrous Na₂SO₄Dried and then filtered, and the solvent removed under reduced pressure. The crude product was purified by silica gel column chromatography. Compound 8 was obtained as a white solid in 71% yield. m.p.: 130 ℃ and 131 ℃.¹HNMR(300MHz，CDCl₃)：δ7.24-7.31(m，1H)，7.34(d，J＝2.0Hz，1H)，7.80(d，J＝8.6Hz，1H)，8.40(s，1H)，10.23(s，1H)。HRMS(ESI)：322.9837[M+H]⁺.

Synthesis of 3- (hydroxymethyl) -7- (4, 4, 5, 5-tetramethyl-1, 3, 2-dioxaborolan-2-yl) -2H-pyran-2-one (9):

compound 8(100mg, 0.31mmol) is added to stirred bis (pinacolato) diboron (95mg, 0.37mmol), Pd (dppf) Cl₂·CH₂Cl₂(12mg, 0.01mmol) and KOAc (91mg, 0.93mmol) in dioxane (5 mL). The reaction mixture was refluxed for 8 hours under nitrogen blanket. After completion of the reaction, the solvent was removed under reduced pressure, and the reaction mixture was diluted with EtOAc, washed twice with brine, over anhydrous Na₂SO₄Dry, filter, and remove the solvent under reduced pressure. The crude product was not further purified. The crude product (180mg) was dissolved in 10mL MeOH, then NaBH was added₄(38mg, 1.02 mmol). The reaction mixture was stirred at room temperature for 1 hour. The reaction mixture was quenched with saturated ammonium chloride solution, then diluted with EtOAc, washed twice with brine, over anhydrous Na₂SO₄Drying, filtering and removing the solvent to obtain the compound 9. The crude product was not purified.

Synthesis of target compound P-168 (chemical structural formula shown in fig. 7):

compound 168(0.5g, 0.813mmol) was dissolved in dichloromethane, DMAP (0.15g, 1.22mmol) and DCC (0.25g, 1.22mmol) were added, and after stirring at room temperature for half an hour, compound 9(0.27g, 0.89mmol) was added and stirring was continued overnight. After the reaction was completed, the by-product solid was removed by filtration, the filtrate was washed with brine, and the organic phase was collected and dried. The compound P-168 is obtained by column chromatography as a yellow solid with a yield of 46%. m.p.: 210 ℃ and 211 ℃.¹HNMR(300MHz，DMSO-d6)δ7.91–7.84(m，2H)，7.70–7.65(m，2H)，7.58–7.52(m，2H)，7.52–7.44(m，3H)，7.01–6.95(m，2H)，5.14(d，J＝0.9Hz，2H)，4.67(s，1H)，3.78(s，2H)，1.24(s，9H)。HRMS(ESI)：1183.3541[M+H]⁺.

Release study of prodrug P-168

2.1 Experimental methods

2.1.1 HPLC methods study prodrug Compound Release in buffer

Prodrug compound was dissolved in DMSO to make a final concentration of 10mM stock solution, stored at-20 ℃. The prodrugsThe compound stock solution (10mM) was added to Phosphate Buffered Saline (PBS) (10mM, pH 7.4) to a final concentration of 50. mu.M, followed by addition of H₂O₂After vortex mixing, the solution was incubated at 37 ℃ and repeated three times. Samples were taken at each time point and analyzed by HPLC injection, and peak areas were recorded to calculate the percent of compound. Using Agilent 1260HPLC and DAD detector, chromatographic conditions: agilent C18 column (4.6X 150mm, 3.5 μm); mobile phase: methanol: water 7: 3; flow rate: 0.5 mL/min. A standard curve of percent compound release versus concentration is plotted and the release rate is calculated from the standard curve.

2.1.2 fluorescent Spectroscopy study of prodrug Compound Release

In PBS buffer: prodrug compound stock solution (10mM) was added to PBS (10mM, pH 7.4) to a final concentration of 0.5. mu.M, added to a 96-well plate, and then added to concentration gradient H₂O₂Three multiple wells were set, incubated at 37 ℃ for 30min and then subjected to fluorescence detection using a Molecular Devices SpectraMax i3 multifunctional microplate reader. In the cell: RAW264.7 cells were seeded into 96-well plates and H was added₂O₂The treatment was carried out for 12 hours. Control group was not added H₂O₂The other culture conditions were the same. After 12h, the medium was discarded and washed three times with PBS, and prodrug compound solution (0.5. mu.M) was added and incubation continued at 37 ℃ for 30 min. Fluorescence detection was performed using a Molecular Devices SpectraMax i3 multifunctional microplate reader.

2.1.3 study of prodrug Compound reactivity with other related ROS

Superoxide (O)₂ ^-) The concentration used was 5mM and the other reactive ROS was 100. mu.M. Solid KO for superoxide₂(ii) a Hydrogen peroxide (H)₂O₂) Tert-butyl hydroperoxide (TBHP) and hypochlorite ion (OCl)^-) Commercial 30%, 70% and 5% aqueous solutions were used; by Fe²⁺(1mM) with TBHP (100. mu.M) or H₂O₂(100. mu.M) reaction to prepare tert-butoxy (. O) respectively^tBu) and hydroxyl (. OH). The prodrug compound was incubated with each of the above solutions in PBS for 30min, and then samples were taken for HPLC analysis and fluorescence spectroscopy analysis.

2.1.4LC-MS method for determining the intracellular Release of prodrug Compounds

RAW264.7 cells were plated in large dishes overnight and cultured with H₂O₂Cells were stimulated (10mM) for 12 hours, then washed with fresh medium and treatment with 10. mu.M prodrug compound was continued for 12 hours. After the administration was completed, the cells were washed with fresh medium, 1mL of methanol was added to the cell pellet, the mixture was mixed well by vortexing, the polymer component was removed by high-speed centrifugation for 10 minutes, and the supernatant was subjected to LC-MS analysis and stored at-80 ℃. Analysis was performed using an LC-MS/MS spectrometer (6410Triple Quad LC/MS/MS, Agilent Technologies, Willington) equipped with a chromatography column (Agilent C18 column 4.6X 150mm, 3.5 μm).

2.2 results of the experiment

2.2.1 prodrug Compound P-168 in buffer by H₂O₂Activation

First, to confirm H₂O₂The phenylboronate group can be activated and release the original drug, and the release behavior of the prodrug is researched and a release curve is drawn by a High Performance Liquid Chromatography (HPLC) method. The prodrug was incubated with Phosphate Buffered Saline (PBS) and H was added₂O₂Activation, the solution was analyzed by HPLC injection to observe the appearance of the prodrug and prodrug peaks. As shown in fig. 1A and 1B, consumption of prodrug P-168 and production of the active compound can be observed, and the release profile is time dependent, with time the prodrug is activated and after 60 minutes the prodrug is completely released.

In addition, the application also researches the release of the prodrug by adopting fluorescence spectroscopy to verify H₂O₂The boronic ester moiety in the prodrug can be activated and thus release the coumarin fluorophore. First, the prodrug pair H was examined₂O₂Time responsiveness of (C), as shown in FIG. 1C, when not activated (H)₂O₂Concentration 0mM), the prodrug showed weak fluorescence centered at 460nm, in PBS buffer via H₂O₂The fluorescence after the treatment is rapidly and smoothly recovered, the maximum wavelength is slightly red-shifted, and the fluorescence intensity at the position of lambda max being 465nm is obviously enhanced. The fluorescence intensity at λ max of 465nm is also determined by the time gradientGradually enhanced and released fluorescence and original drug with time dependence, indicating that the prodrug has H₂O₂Has good responsiveness. Subsequently, H was investigated₂O₂Effect of concentration on prodrug release behavior, as shown in FIG. 1D, with H₂O₂The concentration increased and the fluorescence intensity at λ max 465nm increased progressively, indicating that the boronic ester moiety of the prodrug is susceptible to being substituted by H₂O₂Activating to release coumarin fluorescence and original medicine in a concentration-dependent mode.

2.2.2 prodrug pairs H₂O₂Is more selective than other biologically relevant ROS species

To assess the potential for additional interference, prodrug P-168 was reacted with other classes of ROS, including hydroxyl radicals, t-butoxy radicals, superoxide, hypochlorite anion, and t-butyl hydroperoxide. In and H₂O₂Other ROS were tested under the same reaction conditions and fluorescence intensity was monitored. When the prodrug is reacted with H₂O₂Upon reaction, an increase in fluorescence intensity was observed, whereas no significant change in fluorescence intensity was observed upon addition of the other ROS (see fig. 2A), indicating that the prodrug can react with H₂O₂And (4) carrying out selective reaction.

2.2.3 prodrug P-168 is substituted with H in cells₂O₂Activated release of prodrug and coumarin fluorescence

LC-MS analysis was used to further confirm that prodrug P-168 was able to be activated in cells to produce the active compound. Selecting mouse mononuclear macrophage leukemia cell RAW264.7 cell and using H₂O₂Pretreatment for 12 hours, then replacing the medium with fresh medium. Prodrug P-168 is added to the filtrate H₂O₂Treated cells and untreated control cells were incubated and cell lysates were analyzed by LC-MS. As shown in fig. 3A, there is a mass spectrum peak of the prodrug compound in the activated cells, which is the same as the standard prodrug peak in the unactivated cells, indicating that the prodrug compound is easily taken up by the cells and activated by ROS to produce the prodrug. In addition, H was performed on RAW264.7 cells₂O₂Pretreatment followed by prodrug administration and detection of intracellular coumarin fluorescence generation, prodrugs P-1, as shown in FIGS. 3B and 3C68 can release coumarin fluorescence in a concentration-dependent and time-dependent manner, and the trend of the original drug compound is not existed.

Third, evaluation of biological Effect

3.1 Experimental methods

3.1.1 ARE luciferase reporter Gene assays

HepG2-ARE-C8 cell culture at 4X 10⁴Cell/well density was seeded into 96-well plates and incubated overnight. Concentration gradients of test prodrug compound were formulated with fresh medium and added to cells and incubated for 12 hours. DMSO was negative control, luciferase cell lysis reagent was blank. After dosing was complete, the medium was discarded and 100 μ L of pre-cooled PBS was added to each well to wash the cells, which was repeated three times. PBS was removed, 30. mu.L luciferase cell lysis reagent was added, cells were harvested after 15 minutes of ice lysis and centrifuged, and 20. mu.L of supernatant was collected by Thermo Scientific Luminoskan according to protocol supplied by Promega^TMAnd (4) performing luciferase activity determination on the Ascent, repeating the determination three times in parallel, and calculating the determination data and the ratio of the control group to obtain the induction multiple.

3.1.2 real-time fluorescent quantitative PCR

RNA extraction: after dosing RAW264.7 cells, the old medium was discarded and washed three times with PBS. After trypsinization, the cells were collected into 1.5mL EP tubes and centrifuged at 3000rpm for 5 minutes. The supernatant was discarded, 1ml of PBS was added to resuspend the cells, centrifuged at 3000rpm for 5 minutes, and the supernatant was discarded. 1ml of LTrizol was added to each tube, and the cells were blown off and lysed on ice for 15 minutes. Add 200. mu.L of chloroform to each tube, after standing for 10 minutes, shake vigorously for 15 seconds, stand at room temperature for 2-3 minutes, and centrifuge at 12000rpm for 15 minutes at 4 ℃. Absorbing 500 mu L of upper-layer water phase, adding isopropanol with the same volume, uniformly mixing, standing at room temperature for 10 minutes, centrifuging at 4 ℃ and 12000rpm for 15 minutes, and removing supernatant. Adding 75% ethanol (prepared with DEPC water), and centrifuging at 7500rpm for 3min at 4 deg.C. Alcohol was evaporated on ice, 20. mu.L of DEPC water was added to each tube to dissolve RNA, and the mixture was mixed well to quantify nucleic acid. Reverse transcription: according to

III RT Supermix for qPCR (+ gDNAwiper) instructions. Amplification: in the qPCR reactionmu.L DEPC water, 0.5. mu.L forward primer, 0.5. mu.L reverse primer, 2. mu.L cDNA, 10. mu.L 2 xchamQ SYBR Master Mix (High ROX premix) were added to the plate in this order. In Thermo StepOne&The amplification and quantification process is completed by StepOneNus Real-Time PCR Systems. The primers used for qRT-PCR were as follows: nrf2 (forward primer: AACCACCCTGAAAGCACGC; reverse primer: TGAAATGCCGGAGTCAGAATC); HO-1 (forward primer: ATGGCCTCCCTGTACCACATC, reverse primer: TGGTGCGCTCAATCTCCTCCT); NQO1 (forward primer: CGCAGACCTTGTGATATTCCAG, reverse primer: CGTTTCTTCCATCCTTCCAGG); GCLM (forward primer: TTGGAGTTGCACAGCTGGATTC, reverse primer: TGGTTTTACCTGTGCCCACTG).

3.1.3 Western immunoblotting

Protein sample preparation was performed after administration of RAW264.7 cells, the old medium was discarded and washed three times with PBS, 1mL of trypsinized cells were added to each dish, collected into 1.5mL EP tubes, and centrifuged at 3000rpm for 5 min. The supernatant was discarded, 1ml of LPBS was added to resuspend the cells, and the cells were centrifuged at 3000rpm for 5 min. The supernatant was discarded, 100. mu.L of a lysate (containing a proteasome inhibitor) was added to each tube, lysed on ice for 45 minutes, centrifuged at 12000rpm for 15 minutes, collected, and 1. mu.L of the supernatant was diluted ten-fold with up water for BCA quantification. Adding one fourth of 5Xprotein loading buffer into the residual supernatant, mixing, and boiling for 10 min. SDS-PAGE: after being aligned, the dry and clean glass plate is placed into a clamp for clamping, and after being vertically clamped on a frame, glue is poured. The glue is poured until the water is close to the center line of the green band without generating bubbles in the glue pouring process. Sealing with isopropanol, removing isopropanol after gelation, washing with deionized water, filling with concentrated gel, and inserting into comb. After the concentrated gel is solidified, the comb is carefully pulled out. The loading was done at a total protein of 100. mu.g per well, constant voltage of 60V until Marker separation, and increasing voltage to 120V until completion. Film transfer: the PVDF membrane is used for membrane conversion. The process of assembling the transfer film is carried out in a wet transfer buffer. The whole process must be ensured to be bubble-free, and the film is transferred in an ice bath. The film transfer condition is 300mA,2 h. And (3) sealing: after the membrane transfer is finished, taking out the PVDF membrane, dyeing the PVDF membrane for 30s, and washing away excessive Lichun by deionized water. The region corresponding to the molecular weight is reduced to bands, deionized and washed clean ponceau. The strips were soaked in 5% skim milk (TBST configuration) and shaken slowly for 1 hour. Primary antibody hybridization: after blocking, the PVDF membrane was placed in a hybridization bag, an appropriate amount of primary antibody solution was added, sealed, and slowly shaken overnight on a shaker at 4 ℃. And (3) hybridization of a second antibody: after the primary antibody incubation was complete, the PVDF membrane was removed and washed three times with TBST, 10min each time. Then, the PVDF membrane was soaked in the prepared corresponding fluorescent secondary antibody (secondary antibody: blocking solution: 1:20000), and incubated on a shaker for 1 hour slowly in the absence of light. And (3) detection: after the secondary antibody incubation was completed, the PVDF membrane was removed and washed three times with TBST for 10min each time. Detection of scanned membrane Imaging was performed by the Bio-Rad ChemiDoc XRS + Imaging Workstation and Tanon 5200 Multi Imaging Workstation. anti-Nrf 2(ab62352), anti-IL-1 β (ab45692) antibodies were purchased from Abcam Technology. anti-HO-1 (SC-136960) and anti-NQO 1(SC-271116) antibodies were purchased from Santa Cruz Biotechnology. Anti- β -Actin (60008-1-lg), anti-GCLM (14241-1-AP) antibody was purchased from Proteitech Group.

3.1.4 detection of IL-1 β, IL-18, IL-6, TNF- α and NO

IL-1 β (Mouse IL-1 β ELISA kit, EK0394, Boster), IL-18(Mouse IL-18 ELISA kit, EMC011, Neobioscience), IL-6(Mouse IL-6ELISA kit EK0411, Boster), TNF- α (Mouse TNF- α ELISA kit, EK0527, Boster) and NO (nitrate/nitrite assay kit, S0023, Beyotime) were all detected using commercially available kits according to the manufacturer' S instructions.

3.2 results of the experiment

3.2.1 LPS-induced prodrug activation of the Keap1-Nrf2-ARE signaling pathway

Lipopolysaccharide (LPS) is a widely used inflammatory inducer that induces the production of intracellular ROS. To mimic the high level ROS environment of inflamed tissues, cells are exposed to LPS to induce the production of high levels of ROS, which can be used to endogenously activate prodrugs. To verify that the prodrug is effective at activating Nrf2 at the cellular level, it was tested using the ARE luciferase reporter assay. HepG2-ARE-C8 cells were used, and when not induced by LPS, the ARE-inducing activity of the compound was examined after the prodrug/prodrug compound was added to act. In addition, cells were pretreated with LPS to generate endogenous ROS, and the effect was continued by adding a gradient prodrug compound to test ARE activity. As shown in fig. 4A, the prodrug had no significant ARE-inducing activity even at the highest concentrations when not activated, and Nrf2 was not activated when the prodrug was not released. After LPS induction, the prodrug releases original drug in cells, ARE induction activity is obviously enhanced, and Nrf2 can be effectively activated at a cellular level (as shown in figure 4B). Furthermore, the induction activity was shown to be enhanced in the concentration dependence of the original drug compound and LPS, and also time-dependent (see FIGS. 4C and 4D). In conclusion, the prodrug can be selectively activated by LPS (LPS) to generate ROS (reactive oxygen species), and active medicaments ARE released so as to activate a Keap1-Nrf2-ARE signal pathway.

3.2.2 LPS-induced prodrug-activated Nrf2 antioxidant System

mRNA levels of Nrf2 and regulatory genes, heme-oxygenase-1 (HO-1), glutamylcysteine ligase (GCLM) and NAD (P) H quinone oxidoreductase 1(NAD (P) H dehydrogenase, quinone 1, NQO-1), were determined by qRT-PCR. RAW264.7 cells were pretreated with LPS (10ng/mL), and the effect was continued by adding prodrug (500nM), and then the gene was detected using the qRT-PCR assay. As shown in fig. 5A-D, prodrug P-168 was able to significantly activate transcription of Nrf2 and its downstream genes under activation of endogenous ROS. Furthermore, protein levels of the above genes were detected by western blotting (fig. 5F), and the experimental results were consistent with mRNA levels of these genes, and LPS-induced prodrug activation significantly increased Nrf2 and downstream antioxidant enzyme protein levels, more potent than the parent drug at the same concentration. Subsequently, to continue to investigate the effect of the prodrug on antioxidant capacity under inflammatory conditions, the GSH/GSSG ratio was examined, an important marker indicative of oxidative stress. As shown in fig. 5E, exposure to LPS resulted in a large decrease in the GSH/GSSG ratio, indicating that LPS can cause oxidative stress, and the addition of prodrug P-168 can restore these indices to almost normal and exhibit concentration dependence.

3.2.3 prodrugs reduce LPS-induced inflammatory factor production in RAW264.7 cells

mRNA levels of IL-1 β and IL-6, which were inhibited by Nrf2, were measured using the qRT-PCR assay. As shown in FIGS. 6A and 6B, the expression of IL-1. beta. and IL-6mRNA in RAW264.7 cells was significantly increased after stimulation with 20ng/mL LPS for 8 h. Treatment with prodrug P-168 significantly inhibited the transcription of IL-1. beta. and IL-6 in RAW264.7 cells. Several inflammatory mediators closely related to ROS were subsequently evaluated by ELISA, including IL-1 β, IL-6, TNF- α and NO. All inflammatory factor levels were significantly increased after LPS treatment compared to the control group. The prodrug P-168 shows obvious advantages in inhibiting IL-1 beta, IL-6 and TNF-alpha production, and remarkably reduces the increase of extracellular NO concentration caused by LPS stimulation. In conclusion, the prodrug P-168 can be activated by ROS induced by LPS in RAW264.7 cells, and plays a remarkable role in cytoprotection and anti-inflammation.

In conclusion, it can be seen that:

The above-described embodiments are intended to be illustrative of the nature of the invention, but those skilled in the art will recognize that the scope of the invention is not limited to the specific embodiments.

Claims

1. A Keap1-Nrf2 PPI inhibitor prodrug is characterized in that the chemical structure is as follows

2. A process for the preparation of a Keap1-Nrf2 PPI inhibitor prodrug as claimed in claim 1, comprising the steps of:

the reagents and reaction conditions for each step were as follows:

wherein the chemical structural formula of the compound 168 in the step (e) is:

3. use of a Keap1-Nrf2 PPI inhibitor prodrug as claimed in claim 1 for the preparation of an anti-inflammatory drug.

4. Use of a Keap1-Nrf2 PPI inhibitor pro-drug as claimed in claim 1 for the manufacture of a medicament for anti-inflammatory and monitoring the degree of inflammatory remission.