CN112301150A - Method for detecting respiratory viruses by direct fluorescence PCR - Google Patents
Method for detecting respiratory viruses by direct fluorescence PCR Download PDFInfo
- Publication number
- CN112301150A CN112301150A CN201910681170.3A CN201910681170A CN112301150A CN 112301150 A CN112301150 A CN 112301150A CN 201910681170 A CN201910681170 A CN 201910681170A CN 112301150 A CN112301150 A CN 112301150A
- Authority
- CN
- China
- Prior art keywords
- pcr
- reaction
- detection
- nucleic acid
- fluorescent
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 238000000034 method Methods 0.000 title claims abstract description 48
- 241000700605 Viruses Species 0.000 title claims abstract description 25
- 230000000241 respiratory effect Effects 0.000 title claims abstract description 22
- 238000001514 detection method Methods 0.000 claims abstract description 45
- 102000039446 nucleic acids Human genes 0.000 claims abstract description 18
- 108020004707 nucleic acids Proteins 0.000 claims abstract description 18
- 150000007523 nucleic acids Chemical class 0.000 claims abstract description 18
- 238000012408 PCR amplification Methods 0.000 claims abstract description 8
- 238000003752 polymerase chain reaction Methods 0.000 claims abstract description 7
- 238000010306 acid treatment Methods 0.000 claims abstract 3
- 238000006243 chemical reaction Methods 0.000 claims description 33
- 102000053602 DNA Human genes 0.000 claims description 19
- 108020004414 DNA Proteins 0.000 claims description 19
- 230000003321 amplification Effects 0.000 claims description 15
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 15
- 108010014303 DNA-directed DNA polymerase Proteins 0.000 claims description 9
- 102000016928 DNA-directed DNA polymerase Human genes 0.000 claims description 9
- 229920002477 rna polymer Polymers 0.000 claims description 9
- 238000012545 processing Methods 0.000 claims description 4
- 206010036790 Productive cough Diseases 0.000 claims description 2
- 238000000605 extraction Methods 0.000 claims description 2
- 238000007403 mPCR Methods 0.000 claims description 2
- 210000003802 sputum Anatomy 0.000 claims description 2
- 208000024794 sputum Diseases 0.000 claims description 2
- 230000003612 virological effect Effects 0.000 claims 2
- 230000000977 initiatory effect Effects 0.000 claims 1
- 239000006210 lotion Substances 0.000 claims 1
- 239000003814 drug Substances 0.000 abstract description 3
- 239000000523 sample Substances 0.000 description 34
- 239000000243 solution Substances 0.000 description 14
- 238000000137 annealing Methods 0.000 description 12
- 244000052769 pathogen Species 0.000 description 10
- 238000004925 denaturation Methods 0.000 description 8
- 230000036425 denaturation Effects 0.000 description 8
- 239000012530 fluid Substances 0.000 description 8
- 230000001717 pathogenic effect Effects 0.000 description 7
- 239000011535 reaction buffer Substances 0.000 description 7
- 238000012257 pre-denaturation Methods 0.000 description 6
- 241000701161 unidentified adenovirus Species 0.000 description 6
- 238000013461 design Methods 0.000 description 5
- 239000003755 preservative agent Substances 0.000 description 5
- 230000002335 preservative effect Effects 0.000 description 5
- 241000712431 Influenza A virus Species 0.000 description 4
- TWRXJAOTZQYOKJ-UHFFFAOYSA-L magnesium chloride Substances [Mg+2].[Cl-].[Cl-] TWRXJAOTZQYOKJ-UHFFFAOYSA-L 0.000 description 4
- 229910001629 magnesium chloride Inorganic materials 0.000 description 4
- 102100034343 Integrase Human genes 0.000 description 3
- 108010092799 RNA-directed DNA polymerase Proteins 0.000 description 3
- FAPWRFPIFSIZLT-UHFFFAOYSA-M Sodium chloride Chemical compound [Na+].[Cl-] FAPWRFPIFSIZLT-UHFFFAOYSA-M 0.000 description 3
- 239000003153 chemical reaction reagent Substances 0.000 description 3
- 238000001821 nucleic acid purification Methods 0.000 description 3
- 238000002360 preparation method Methods 0.000 description 3
- 238000011160 research Methods 0.000 description 3
- 238000005406 washing Methods 0.000 description 3
- 101100508406 Caenorhabditis elegans ifa-1 gene Proteins 0.000 description 2
- 101100508407 Caenorhabditis elegans mua-6 gene Proteins 0.000 description 2
- 208000035473 Communicable disease Diseases 0.000 description 2
- 241001465754 Metazoa Species 0.000 description 2
- 101100409308 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) adv-1 gene Proteins 0.000 description 2
- 238000007796 conventional method Methods 0.000 description 2
- 239000012154 double-distilled water Substances 0.000 description 2
- 239000007850 fluorescent dye Substances 0.000 description 2
- 238000012544 monitoring process Methods 0.000 description 2
- 210000003800 pharynx Anatomy 0.000 description 2
- 238000010791 quenching Methods 0.000 description 2
- 230000000171 quenching effect Effects 0.000 description 2
- 238000010839 reverse transcription Methods 0.000 description 2
- 230000035945 sensitivity Effects 0.000 description 2
- 238000012163 sequencing technique Methods 0.000 description 2
- NTIZESTWPVYFNL-UHFFFAOYSA-N Methyl isobutyl ketone Chemical compound CC(C)CC(C)=O NTIZESTWPVYFNL-UHFFFAOYSA-N 0.000 description 1
- 241000051135 Morella rubra Species 0.000 description 1
- 101100018862 Mus musculus Ifnar1 gene Proteins 0.000 description 1
- 235000014631 Myrica rubra Nutrition 0.000 description 1
- 108700001094 Plant Genes Proteins 0.000 description 1
- 108020000999 Viral RNA Proteins 0.000 description 1
- 244000052616 bacterial pathogen Species 0.000 description 1
- 239000007853 buffer solution Substances 0.000 description 1
- 238000005336 cracking Methods 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 238000003745 diagnosis Methods 0.000 description 1
- 230000029087 digestion Effects 0.000 description 1
- 229940079593 drug Drugs 0.000 description 1
- 241001493065 dsRNA viruses Species 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 238000001215 fluorescent labelling Methods 0.000 description 1
- 235000013305 food Nutrition 0.000 description 1
- 208000015181 infectious disease Diseases 0.000 description 1
- 239000003112 inhibitor Substances 0.000 description 1
- 239000000463 material Substances 0.000 description 1
- 244000005700 microbiome Species 0.000 description 1
- 238000002156 mixing Methods 0.000 description 1
- 238000003793 prenatal diagnosis Methods 0.000 description 1
- 238000004321 preservation Methods 0.000 description 1
- 239000003761 preservation solution Substances 0.000 description 1
- 108090000623 proteins and genes Proteins 0.000 description 1
- 238000000746 purification Methods 0.000 description 1
- 238000003753 real-time PCR Methods 0.000 description 1
- 210000002345 respiratory system Anatomy 0.000 description 1
- 238000004904 shortening Methods 0.000 description 1
- 239000011780 sodium chloride Substances 0.000 description 1
- 238000001179 sorption measurement Methods 0.000 description 1
- 238000010998 test method Methods 0.000 description 1
- 238000012800 visualization Methods 0.000 description 1
- 238000010792 warming Methods 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a method for qualitatively detecting respiratory viruses by direct fluorescence polymerase chain reaction (fluorescence PCR), wherein a template used for the fluorescence PCR amplification is a clinically collected specimen containing the respiratory viruses. Belongs to the field of biotechnology and medicine. The method of the invention skips the process of sample nucleic acid treatment, so that the whole detection process is smooth and rapid, the chance of mutual pollution is reduced, and the obtained PCR detection result is accurate and reliable.
Description
The technical field is as follows:
the invention relates to the fields of biotechnology and medicine, in particular to a fluorescence PCR detection method of respiratory virus nucleic acid, which has the characteristics of safety, rapidness, sensitivity and accuracy.
Background art:
the fluorescence polymerase chain reaction (fluorescence PCR) is characterized in that a PCR product is labeled and tracked through a fluorescent dye or a fluorescence-labeled specific probe, the reaction process is monitored on line in real time, the product can be analyzed by combining with corresponding software, and the condition of nucleic acid in a detected sample can be judged qualitatively, quantitatively or semi-quantitatively in real time. The fluorescence PCR detection technology integrates the PCR technology, the fluorescence labeling technology, the laser technology and the digital visualization technology, and has the advantages of high detection sensitivity, good linear relation, wide linear range and the like.
The fluorescent PCR detection technology is developed for nearly 20 years, and the fluorescent PCR method is widely applied to the fields of pathogen detection, noninvasive prenatal diagnosis, drug efficacy detection, virus variation monitoring, food safety and medical molecular biology research by being matched with a fluorescent quantitative PCR instrument, and plays an irreplaceable role in the diagnosis and monitoring processes of a plurality of infectious disease microorganisms. Meanwhile, along with the aggravation of global warming, germs pass through extreme weather and climatic events, the epidemic situation of infectious diseases is expanded, and the harm to human health is increased.
Up to thousands of fluorescent PCR detection reagents and methods have been clinically used at present; the conventional method for detecting pathogen nucleic acid by fluorescence PCR generally requires two independent processes, namely preparation of pathogen DNA or RNA nucleic acid template and addition of the nucleic acid template into a reaction system for PCR amplification detection. The reagents and methods used and established for nucleic acid processing in various laboratories are not completely consistent, depending on the structure of the various pathogens. But the treatment process is basically consistent, and a plurality of steps such as digestion cracking, adsorption purification, washing and collection are required. The processing of a single sample often takes tens of minutes, and when a large number of samples need to be processed, it takes even longer than a PCR detection reaction. Due to the multiple operation steps, mutual pollution among samples cannot be avoided in the large sample treatment process; because of improper protection, it is also common for humans to become infected with pathogens during the treatment process.
The direct PCR technology adopts an optimized PCR buffer solution system and special DNA polymerase, reduces the interference of various inhibitors existing in a sample on PCR reaction, and has the characteristics of strong activity, high stability, strong tolerance and the like. The technology does not need to carry out an expensive and time-consuming nucleic acid extraction process, and can be directly used for PCR amplification identification by using an animal specimen or a pathogen preservation solution, thereby greatly shortening the detection time and simplifying the operation steps. The direct PCR technology is being applied to the research of various animal and plant genes, and the development of molecular biology research is actively promoted. In the field of medical detection of direct fluorescence PCR technology, a small amount of reports exist, and the reported application method does not need the step of nucleic acid purification, but generally needs to simply process a sample for PCR detection. The sample is directly used as a nucleic acid template for amplification detection, and no feasible report exists yet.
The invention content is as follows:
the invention aims to provide a method for qualitatively detecting respiratory viruses by direct fluorescent polymerase chain reaction (fluorescent PCR), which shortens PCR detection time and simplifies operation steps.
The invention provides a method for qualitatively detecting respiratory viruses by direct fluorescence polymerase chain reaction (fluorescence PCR), wherein a template used for the fluorescence PCR amplification is a clinically collected specimen containing the respiratory viruses.
The invention is realized as follows:
a method for qualitatively detecting pathogen nucleic acid by direct fluorescent polymerase chain reaction (fluorescent PCR) comprises the following detection steps:
uniformly mixing clinical samples containing the respiratory viruses, and adding 2-10 microliters of the clinical samples serving as amplification templates into the fluorescent PCR reaction solution;
the clinical sample containing the pathogen refers to pharyngeal swabs containing respiratory viruses, or sputum.
The fluorescent PCR may be reverse transcription fluorescent PCR using ribonucleic acid (RNA) as an initial amplification object or fluorescent PCR using deoxyribonucleic acid (DNA) as an initial amplification object according to the respiratory virus type.
Specifically, when the fluorescence PCR is reverse transcription fluorescence PCR using RNA as an initial amplification object, the reaction solution components comprise: dNTPs, specific primer, specific taqman probe, optimized DNA polymerase and matched reaction buffer solution, reverse transcriptase and Mg2+、ddH2O。
Specifically, when the fluorescent PCR uses DNA as an initial amplification object, the reaction solution components include: dNTPs, specific primer, specific taqman probe, optimized DNA polymerase, reaction buffer solution matched with the optimized DNA polymerase and Mg2+、ddH2O。
And (3) PCR reaction conditions: and a PCR amplification reaction stage containing 1-6 cycles is carried out between the DNA polymerase function starting stage and the detection signal collecting stage, and the detection signal is not collected in the amplification reaction at the stage.
The PCR reaction may be a single PCR reaction or a multiplex PCR reaction according to actual needs.
The invention establishes a method for qualitatively detecting pathogen nucleic acid by direct fluorescent polymerase chain reaction (fluorescent PCR), uses an innovative PCR reaction process, and has the advantages that: the method is simple, rapid and practical. The method skips the sample nucleic acid processing process, so that the whole detection process is smooth and rapid, the chance of mutual pollution is reduced, and the obtained PCR detection result is accurate and reliable. The chance of infecting pathogens in a sample by people is greatly reduced, and the social and economic benefits are higher.
Description of the drawings:
FIG. 1 shows the fluorescence PCR results of respiratory adenovirus in two specimens tested for oropharyngeal-ragvirus preservative fluid by the method of the present invention.
FIG. 2 shows the fluorescence PCR results of respiratory adenovirus in two specimens of oropharyngeal-ragvirus preservative fluid detected by conventional fluorescence PCR method.
FIG. 3 is the fluorescence PCR results of two pharyngeal-swab saline wash specimens tested for influenza A virus using the method of the invention.
FIG. 4 is the fluorescent PCR results for detection of influenza A virus in two pharyngeal-swab saline-wash specimens using a conventional fluorescent PCR method.
The specific implementation mode is as follows:
the test methods used in the following examples are conventional methods unless otherwise specified
The materials, reagents and the like used in the following examples are commercially available without specific reference
The 6# DNA polymerase and the reaction buffer solution matched with the same are purchased from Shanghai Qihai Biotechnology limited company
Example 1, direct fluorescence PCR detection of respiratory adenovirus (genotype 7) in a orofacial tissue virus preservative fluid specimen, which is characterized by the following detection steps:
first, primer design
Adenovirus genome sequence is analyzed, and specific primer probes are designed in hexon coding genes. Specific primer probes were designed using the primer probe in-line design tool http:// www.yeastgenome.org/cgi-bin/web-primer. Considering the specificity and the amplification efficiency comprehensively, a group of primer probe sequences are finally selected as follows:
designing a primer sequence as follows:
advF:catcgccggacaggatgcttc(SEQ ID No.1);
advR:tacggtcggtggtcacatcgtg(SEQ ID No.2);
the probe sequence was designed as follows: and (5) advP: catcgatgctgccccagtgggca (SEQ ID No.3), FAM fluorescent group and BHQ1 quenching group are marked at two ends of the probe
Second, sample preparation
The samples tested in this example were 2 samples of orofacial pappy virus preservative fluid, accession numbers ADV1 and ADV 2. Sequencing to determine that the samples all contain 7 type respiratory adenovirus. In order to compare with the traditional fluorescent PCR method, sucking 200 microliters of samples, using a virus DNA nucleic acid purification kit to extract and purify DNA nucleic acid, respectively obtaining 50 microliters of DNA solution with the number ADV1-D, ADV2-D, and storing at 4 ℃; preserving the residual pharynx paper virus preserving fluid specimen at 4 ℃;
thirdly, PCR detection is carried out
Direct fluorescence PCR detection system: 2. mu.L of 10mM dNTPs, 0.5. mu.L of each 10. mu.M primer, 0.2. mu.L of 10. mu.M probe, 1.5. mu.L of 6# DNA polymerase, 5. mu.L of matched reaction buffer, and 25mM MgCl 22 μ L, specimen 4 μ L, ddH2Make up to 25. mu.L of O.
Traditional fluorescent PCR detection systems: 2. mu.L of 10mM dNTPs, 0.5. mu.L of each 10. mu.M primer, 0.2. mu. L, DNA of polymerase with 10. mu.M probe, 2.5. mu.L of a reaction buffer matched with the probes, and 25mM MgCl 22 μ L, specimen 4 μ L, ddH2Make up to 25. mu.L of O.
And 4 mu L of the sample prepared in the second step is added into the reaction solution. Adding 4 mu L of normal saline washing solution into a direct fluorescence PCR system; mu.L of the DNA solution was added to a conventional fluorescent PCR system. During the sample application process, air bubbles should be avoided as much as possible so as not to affect the PCR reaction.
The reaction conditions of the direct fluorescence PCR are as follows: pre-denaturation at 95 ℃ for 10min → (denaturation at 95 ℃ 5S → annealing at 60 ℃ for 35S) × 3 cycles → (denaturation at 95 ℃ 10S → annealing at 58 ℃ for 40S) × 40 cycles, and the fluorescence collection point is the annealing temperature point at 58 ℃.
The reaction conditions of the traditional fluorescent PCR are as follows: pre-denaturation at 95 ℃ for 10min → (denaturation at 95 ℃ 5S → annealing at 60 ℃ for 35S) × 3 cycles → (denaturation at 95 ℃ 10S → annealing at 58 ℃ for 40S) × 40 cycles, and the fluorescence collection point is the annealing temperature point at 58 ℃.
And (3) detection results: the detection results of the two methods for the two samples show typical amplification, and the amplification is positive. Wherein Ct values of ADV1 and ADV2 detected by direct fluorescence PCR are 20.2 and 23.7 respectively; the Ct values of ADV1-D, ADV2-D detected by traditional fluorescent PCR are 20.5 and 23.4 respectively, and the detection results of the two methods are basically consistent. The method for detecting the respiratory tract DNA by the direct fluorescence PCR method is effective and feasible.
Example 2, direct fluorescence PCR detection of influenza a virus in a yangmei virus preservation fluid specimen is characterized by the following detection steps:
first, primer design
Analyzing the genome sequence of the influenza A virus, and selecting a conservative section to design a universal specific primer probe. Specific primer probes were designed using the primer probe in-line design tool http:// www.yeastgenome.org/cgi-bin/web-primer. Considering the specificity and the amplification efficiency comprehensively, a group of primer probe sequences are finally selected as follows:
designing a primer sequence as follows: IFAF: AAGACCRATYYTGTCACCTCTRACTAAG (SEQ ID NO. 4);
IFAR:CAAANCGTCTACGYTGCAGTCC(SEQ ID No.5);
the probe sequence was designed as follows: IFAP: TCACTGGGCACGGTGAGYGTRAA (SEQ ID No.6), FAM fluorescent group and BHQ1 quenching group are marked at two ends of the probe
Second, sample preparation
The samples tested in this example were 2 samples of orofacial pappy virus preservative fluid, accession numbers IFA1 and IFA 2. Sequencing to determine that the samples all contain 7 type respiratory adenovirus. In order to compare with the traditional fluorescent PCR method, sucking 200 microliters of samples, using a viral RNA nucleic acid purification kit to extract and purify RNA nucleic acid, respectively obtaining 50 microliters of RNA solution with the number IFA1-R, IFA2-R, and storing at 4 ℃; preserving the residual pharynx paper virus preserving fluid specimen at 4 ℃;
thirdly, PCR detection is carried out
Direct fluorescence PCR detection system: 2. mu.L of 10mM dNTPs, 0.5. mu.L of each 10. mu.M primer, 0.2. mu.L of 10. mu.M probe, 1.5. mu.L of 6# DNA polymerase, 5. mu.L of matched reaction buffer, 0.3. mu.L of reverse transcriptase and 25mM MgCl 22 μ L, specimen 4 μ L, ddH2Make up to 25. mu.L of O.
Traditional fluorescent PCR detection systems: 2. mu.L of 10mM dNTPs, 0.5. mu.L of each 10. mu.M primer, 0.2. mu. L, DNA of polymerase, 0.5. mu.L of reaction buffer, 0.2. mu.L of reverse transcriptase, and 25mM MgCl 22 μ L, specimen 4 μ L, ddH2Make up to 25. mu.L of O.
And 4 mu L of the sample prepared in the second step is added into the reaction solution. Adding 4 mu L of normal saline washing solution into a direct fluorescence PCR system; mu.L of the RNA solution was added to a conventional fluorescent PCR system. During the sample application process, air bubbles should be avoided as much as possible so as not to affect the PCR reaction.
The reaction conditions of the direct fluorescence PCR are as follows: 45 ℃ pre-denaturation 15min → 95 ℃ pre-denaturation 10min → (95 ℃ denaturation 5S → 61 ℃ annealing 35S) × 3 cycle → (95 ℃ denaturation 10S → 59 ℃ annealing 40S) × 40 cycle, and the fluorescence collection point is the 59 ℃ annealing temperature point.
The reaction conditions of the traditional fluorescent PCR are as follows: 45 ℃ pre-denaturation 15min → 95 ℃ pre-denaturation 10min → (95 ℃ denaturation 5S → 61 ℃ annealing 35S) × 3 cycle → (95 ℃ denaturation 10S → 59 ℃ annealing 40S) × 40 cycle, and the fluorescence collection point is the 59 ℃ annealing temperature point.
And (3) detection results: the detection results of the two methods for the two samples show typical amplification, and the amplification is positive. Wherein Ct values of IFA1 and IFA2 detected by direct fluorescence PCR are 25.5 and 35.1 respectively; the Ct values of IFA1-R, IFA2-R detected by traditional fluorescent PCR are 25.2 and 34.8 respectively, and the detection results of the two methods are basically consistent. The method for detecting the respiratory RNA virus by the direct fluorescence PCR method is effective and feasible.
Sequence listing
<110> Hangzhou Danwei Biotechnology Ltd
<120> method for detecting respiratory viruses by direct fluorescence PCR
<130> 19-100070-00013375
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
catcgccgga caggatgctt c 21
<210> 2
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
tacggtcggt ggtcacatcg tg 22
<210> 3
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
catcgatgct gccccagtgg gca 23
<210> 4
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
aagaccraty ytgtcacctc tractaag 28
<210> 5
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
caaancgtct acgytgcagt cc 22
<210> 6
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
tcactgggca cggtgagygt raa 23
Claims (7)
1. A method for qualitatively detecting respiratory viruses by direct fluorescent polymerase chain reaction (fluorescent PCR) is characterized in that a nucleic acid processing step is not needed, and a clinically collected specimen containing viruses can be directly added into a fluorescent PCR detection reaction system as an amplification template of PCR for detection.
2. The method of claim 1, wherein the PCR reaction conditions used in the qualitative detection of respiratory viruses include a PCR amplification reaction stage comprising 1-6 cycles between the initiation stage of DNA polymerase function and the detection signal collection stage, and the detection signal is not collected during the amplification reaction of the PCR amplification reaction stage.
3. The method for qualitatively detecting respiratory viruses by direct fluorescence PCR as claimed in claim 1, wherein the nucleic acid treatment or extraction step is a process of extracting and purifying viral nucleic acid from the sample outside the PCR detection reaction system.
4. The method of claim 1, wherein the viral nucleic acid treatment and the PCR detection reaction are integrated into the same reaction system.
5. The method of claim 1, wherein the nucleic acids comprise ribonucleic acid (RNA) and deoxyribonucleic acid (DNA).
6. The method of claim 1, wherein the sample used as the template for PCR amplification comprises a pharyngeal swab lotion or sputum containing the respiratory virus.
7. The method of any one of claims 1 to 6, wherein the fluorescent PCR reaction is a single PCR reaction or a multiplex PCR reaction.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201910681170.3A CN112301150A (en) | 2019-07-26 | 2019-07-26 | Method for detecting respiratory viruses by direct fluorescence PCR |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201910681170.3A CN112301150A (en) | 2019-07-26 | 2019-07-26 | Method for detecting respiratory viruses by direct fluorescence PCR |
Publications (1)
Publication Number | Publication Date |
---|---|
CN112301150A true CN112301150A (en) | 2021-02-02 |
Family
ID=74329579
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201910681170.3A Pending CN112301150A (en) | 2019-07-26 | 2019-07-26 | Method for detecting respiratory viruses by direct fluorescence PCR |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN112301150A (en) |
Citations (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101713002A (en) * | 2009-11-19 | 2010-05-26 | 戴立忠 | Fluorescent quantitative PCR detection method of pathogen nucleic acid by one-step method |
CN104818338A (en) * | 2015-05-15 | 2015-08-05 | 王海滨 | Direct real-time fluorescent quantitative PCR method |
CN105463130A (en) * | 2015-12-22 | 2016-04-06 | 菲鹏生物股份有限公司 | Quantitative real-time polymerase chain reaction (q(RT)-PCR) method |
CN105695564A (en) * | 2015-04-29 | 2016-06-22 | 汕头国际旅行卫生保健中心 | Rapid nucleic acid sequencing method based on fluorescence PCR |
CN105779647A (en) * | 2014-12-24 | 2016-07-20 | 上海星耀医学科技发展有限公司 | Quantitative RT-PCR detection kit for ebola virus nucleic acid through one-step method |
CN107090522A (en) * | 2017-07-03 | 2017-08-25 | 武汉科技大学 | A kind of method that virus is quantitatively detected based on digital pcr |
CN108315481A (en) * | 2018-03-21 | 2018-07-24 | 深圳市康百得生物科技有限公司 | A kind of diagnostic method and dedicated kit detecting Porcine epidemic diarrhea virus using direct expansion method |
-
2019
- 2019-07-26 CN CN201910681170.3A patent/CN112301150A/en active Pending
Patent Citations (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101713002A (en) * | 2009-11-19 | 2010-05-26 | 戴立忠 | Fluorescent quantitative PCR detection method of pathogen nucleic acid by one-step method |
CN105779647A (en) * | 2014-12-24 | 2016-07-20 | 上海星耀医学科技发展有限公司 | Quantitative RT-PCR detection kit for ebola virus nucleic acid through one-step method |
CN105695564A (en) * | 2015-04-29 | 2016-06-22 | 汕头国际旅行卫生保健中心 | Rapid nucleic acid sequencing method based on fluorescence PCR |
CN104818338A (en) * | 2015-05-15 | 2015-08-05 | 王海滨 | Direct real-time fluorescent quantitative PCR method |
CN105463130A (en) * | 2015-12-22 | 2016-04-06 | 菲鹏生物股份有限公司 | Quantitative real-time polymerase chain reaction (q(RT)-PCR) method |
CN107090522A (en) * | 2017-07-03 | 2017-08-25 | 武汉科技大学 | A kind of method that virus is quantitatively detected based on digital pcr |
CN108315481A (en) * | 2018-03-21 | 2018-07-24 | 深圳市康百得生物科技有限公司 | A kind of diagnostic method and dedicated kit detecting Porcine epidemic diarrhea virus using direct expansion method |
Non-Patent Citations (2)
Title |
---|
SCHWARTZ RH等: "BD veritor system respiratory syncytial virus rapid antigen detection test:point-of-care results in primary care pediatric offices compared with reverse transcriptase polymerase chain reaction and viral culture methods" * |
杨海鸥;叶星晨;傅启华;: "依赖核酸序列扩增技术检测呼吸道合胞病毒方法的建立" * |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN111254228B (en) | Kit for detecting novel coronavirus and influenza virus | |
CN106947838B (en) | African swine fever virus non-structural gene real-time fluorescence LAMP (loop-mediated isothermal amplification) detection primer group, kit and detection method | |
CN108192996B (en) | Multiple RT-RPA primer combination for detecting influenza A virus and parting H1 and H3 and application thereof | |
CN111534576B (en) | Method, composition, kit and use for fluorescent quantitative PCR | |
CN110699489B (en) | Real-time fluorescence PCR detection primer probe set, kit and method for African swine fever virus CD2V gene | |
WO2010102460A1 (en) | A method and kit for quantitative and qualitative detection of genetic material of pathogenic microorganisms | |
CN113652505B (en) | Method and kit for detecting novel coronavirus and VOC-202012/01 mutant strain thereof | |
CN112739833A (en) | Primer pair, probe and kit for detecting SARS-CoV-2 by utilizing nested RPA technology and application thereof | |
WO2021046278A1 (en) | Systems, methods, and compositions for the rapid early-detection of host rna biomarkers of infection and early identification of covid-19 coronavirus infection in humans | |
CN110438260B (en) | African swine fever virus nucleic acid test strip detection kit | |
WO2016075277A1 (en) | Novel fish virus and method for detection | |
JP4950656B2 (en) | Nucleic acid detection | |
RU2681473C1 (en) | Test system for detection of the virus genome of parainfluenza 3 types at cattle with a multiplex polymerase chain reaction with fluorescent detection in real time mode | |
CN109722492B (en) | Method for detecting H5 and H7N9 subtype highly pathogenic avian influenza virus and H9 subtype avian influenza virus | |
CN114214455B (en) | Quick quantitative primer probe for hepatitis B virus DNA and CRISPR/Cas12b detection system thereof | |
CN116377118A (en) | Multiplex PCR detection method for three pathogenic bacteria of Solanaceae and application thereof | |
WO2013128405A1 (en) | Real time pcr detection of respiratory syncytial virus | |
CN116121439A (en) | Method and kit for detecting fungi by multiple quantitative PCR | |
KR101236197B1 (en) | Differential detection of West nile virus and Japanese encephalitis virus | |
CN110894532A (en) | RAA constant temperature fluorescence detection method and reagent for bacterial septicemia (FBS) | |
CN112301150A (en) | Method for detecting respiratory viruses by direct fluorescence PCR | |
CN113817870A (en) | Primer composition for simultaneously detecting seven respiratory tract-related viruses and application thereof | |
CN113549709A (en) | Primer pair, probe and kit for detecting SARS-CoV-2 by utilizing nested RPA technology and application thereof | |
CN106521038A (en) | High-sensitivity BHV-2 (bovine herpes virus 2) quantitative real-time PCR (polymerase chain reaction) detection method and kit | |
CN111304364A (en) | Primer and probe combination for detecting avian influenza virus, kit and detection method |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20210202 |
|
WD01 | Invention patent application deemed withdrawn after publication |