CN112280898A - Efficient duplex primer and kit for detecting rabbit plague and rabbit plague type 2 - Google Patents
Efficient duplex primer and kit for detecting rabbit plague and rabbit plague type 2 Download PDFInfo
- Publication number
- CN112280898A CN112280898A CN202011154052.6A CN202011154052A CN112280898A CN 112280898 A CN112280898 A CN 112280898A CN 202011154052 A CN202011154052 A CN 202011154052A CN 112280898 A CN112280898 A CN 112280898A
- Authority
- CN
- China
- Prior art keywords
- primer
- rhdv
- rabbit
- rhdv2
- type
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Abstract
The invention discloses a primer and a kit for efficiently detecting rabbit plague and rabbit plague type 2 in a duplex manner, wherein the invention takes an improved LAMP technology as a gene amplification reaction principle, gold nanoparticles are added into a reaction system to adsorb ssDNA and protease, so that the nonspecific reaction in the heating process is inhibited, the purpose of hot start is achieved, and the nonspecific reaction in the heating process is avoided; by combining the improved LAMP technology and the improved microfluidic chip technology, the method can quickly and accurately detect and distinguish the rabbit plague and the rabbit plague type 2, meanwhile, the reaction reagent is embedded on the microfluidic chip, the detection with the same double indexes is realized, and the user operation is simple and convenient.
Description
Technical Field
The invention belongs to the technical field of gene detection, and particularly relates to a primer and a kit for efficiently detecting rabbit plague and rabbit plague type 2 in a duplex manner.
Background
Rabbit Hemorrhagic Disease (RHD), commonly known as rabbit plague, is an acute, highly lethal infectious disease of rabbits caused by Rabbit Hemorrhagic Disease Virus (RHDV). The RHD takes the bleeding of a respiratory system, the congestion, the swelling, the bleeding and the liver necrosis of parenchymal organs as main pathological features, mainly harms cultivated and wild rabbit varieties with the age of more than 2 months, and has the death rate of 80-100 percent. New rabbit hemorrhagic diseases (nRHD), also known as rabbit hemorrhagic disease type 2 (RHD 2), which are caused by a new species of RHDV, rabbit hemorrhagic disease virus type 2 (RHDV 2), and which infect immunized rabbits lethal to less than 30 days of age and inactivated vaccines of traditional RHDV strains, have appeared in france in 2010. The current diagnostic method is the RT-PCR method. The existing PCR technology is adopted, because the reaction is circulated in 2 different temperature areas, the requirement on instruments is high, the cost is relatively high, and the PCR technology only has 1 pair of amplification primers, is easy to be interfered, has relatively insufficient specificity, has long result output time, high requirement on operation speciality and more trace addition steps. The LAMP technology has 4 different specific primers, so the detection result accuracy is higher, but the isothermal reaction is adopted, a hot start enzyme similar to PCR is lacked, and nonspecific amplification is easily generated at the temperature rise stage of equipment, so the detection result is influenced.
Disclosure of Invention
The invention aims to solve the technical problem of providing a primer and a kit for efficiently detecting rabbit fever and rabbit fever type 2 in a duplex manner aiming at the defects of the prior art.
The technical scheme adopted by the invention for solving the technical problems is as follows: a primer for efficiently detecting rabbit plague and rabbit plague type 2 in a duplex manner comprises the following specific steps:
RHDV-F3：CCGGCACAAACCAAAAYC；
RHDV-B3：GTGCGCCTGACRACAGAC；
RHDV-FIP：ATGTGACGGCAYTGGCGTTT-CCGGACTGTTTGTGATGGC；
RHDV-BIP：
TTGTRACTACACCCGGCACTCC-GCGAACATGATGGGTGTGTT；
RHDV2-F3：GCTTCCGGCTTCATGGAAC；
RHDV2-B3：GAAAAGCCATTGGTTGTGCC；
RHDV2-FIP：
TCRATGAGGGTGGCTGAAGCC-TTGGCTTGAGTGTTGATGGA；
RHDV2-BIP：
AGAVCTTGTTGACATCCGCCC-ARTTGTACACRAGCGTRCT。
the invention also provides a high-efficiency duplex detection kit for detecting the rabbit fever and the rabbit fever type 2, the kit comprises the primers and reaction liquid, and the reaction liquid comprises the following components:
20 mM Tris-HCl 0.2 μL
40 mM KCl 6.8 μL
100 mM （NH4）2SO4 1.8 μL
80 mM MgSO4 1.8 μL
1% Tween-20 1.8 μL
28 mM dNTPs 0.9 μL
8000U/mL Bst enzyme 1.8. mu.L
10000U/mL Invitrogen SuperScript IV reverse transcriptase 0.1. mu.L
10Mm Reverse Transcriptase Inhibitors 0.1 μL
0.9. mu.L of 1 mM SYBRGREEN fluorescent dye
4.0×10-6 mol/L goldNanoparticle 1.8 μ L
The concentration and volume of the rabbit fever primer are as follows: mu.L of 90. mu.M RHDV-F3 primer, 0.5. mu.L of 90. mu.M RHDV-B3 primer, 2. mu.L of 180. mu.M RHDV-FIP primer, and 2. mu.L of 180. mu.M RHDV-BIP primer. The concentration and volume of the rabbit fever type 2 primer are as follows: mu.L of RHDV2-F3 primer of 90. mu.M, 0.5. mu.L of RHDV2-B3 primer of 90. mu.M, 2. mu.L of RHDV2-FIP primer of 180. mu.M, and 2. mu.L of RHDV2-BIP primer of 180. mu.M. The kit selects 8 sample chips, namely 1 sample adding hole corresponds to 4 detection holes, a primer for embedding and amplifying an RHDV sequence in a 1 st detection hole position and a primer for embedding and amplifying an RHDV2 sequence in a 2 nd detection hole position, a 3 rd detection hole is blank, and an internal reference primer and an internal reference plasmid are embedded in a 4 th detection hole, and is freeze-dried as shown in a figure 1.
The nucleic acid sequence of the rabbit fever virus is EF558582, and the nucleic acid sequence of the rabbit fever 2 type virus is MH 341513.
Compared with the prior art, the invention has the following advantages: the invention takes the improved LAMP technology as the gene amplification reaction principle, gold nanoparticles are added into a reaction system to adsorb ssDNA and protease, so as to inhibit the non-specific reaction in the heating process, achieve the purpose of hot start and avoid the non-specific reaction in the heating process; by combining the improved LAMP technology and the improved microfluidic chip technology, the method can quickly and accurately detect and distinguish the rabbit plague and the rabbit plague type 2, meanwhile, the reaction reagent is embedded on the microfluidic chip, the detection with the same double indexes is realized, and the user operation is simple and convenient.
Drawings
FIG. 1 is a 8 sample chip test well bitmap;
FIG. 2 is a graph showing the results of primer sensitivity amplification of RHDV and RHDV2, in which: a is the result of RHDV sensitive amplification, and B is the result of RHDV sensitive amplification.
FIG. 3 is a graph of the repetitive amplification of the RHDV and RHDV2 primers, in which: a is the result of RHDV repetitive amplification, and B is the result of RHDV repetitive amplification.
FIG. 4 is a diagram of primer-specific amplification of RHDV and RHDV 2.
Detailed Description
The present invention will be described in further detail with reference to the following examples, but the present invention is not limited to the following examples.
Examples
Firstly, searching a target sequence through NCBI GenBank, designing primers aiming at the target sequence, respectively fixing the primers at corresponding positions of a microfluidic chip, packaging the microfluidic chip, mixing and reacting the primers with a nucleic acid template extracted from rabbit meat and various organs, blood, excrement, an environmental sample and cell culture, adding the mixture into the packaged microfluidic chip, and then putting the packaged microfluidic chip into a microfluidic chip detector with a centrifugal function, a constant temperature function and real-time fluorescence detection, wherein the instruments and the chips are all commercially available products, Ningbo love gene science and technology limited company also has corresponding products, and a sample is driven to enter a microfluidic chip reaction hole by using centrifugal force to carry out constant temperature amplification. And if the sample contains the target fragment, carrying out isothermal amplification, effectively combining the amplified product with a fluorescent substance, capturing a fluorescent signal in real time by using a fluorescent detector, intuitively reacting the generation of the amplified product, and judging whether the sample contains the rabbit plague and the rabbit plague type 2 virus or not according to the appearance time, the intensity and the position of the real-time fluorescent signal.
The specific operation steps are as follows:
1. the composition of 18 mul reaction solution in the micro-fluidic chip detection system is as follows:
20 mM Tris-HCl 0.2 μL
40 mM KCl 6.8 μL
100 mM （NH4）2SO4 1.8 μL
80 mM MgSO4 1.8 μL
1% Tween-20 1.8 μL
28 mM dNTPs 0.9 μL
8000U/mL Bst enzyme 1.8. mu.L
10000U/mL Invitrogen SuperScript IV reverse transcriptase 0.1. mu.L
10Mm Reverse Transcriptase Inhibitors 0.1 μL
0.9. mu.L of 1 mM SYBRGREEN fluorescent dye
4.0×10-6 mol/L gold nanoparticle 1.8 mu L
The concentration and volume of the rabbit fever primer are as follows: mu.L of 90. mu.M RHDV-F3 primer, 0.5. mu.L of 90. mu.M RHDV-B3 primer, 2. mu.L of 180. mu.M RHDV-FIP primer, and 2. mu.L of 180. mu.M RHDV-BIP primer. The concentration and volume of the rabbit fever type 2 primer are as follows: mu.L of RHDV2-F3 primer of 90. mu.M, 0.5. mu.L of RHDV2-B3 primer of 90. mu.M, 2. mu.L of RHDV2-FIP primer of 180. mu.M, and 2. mu.L of RHDV2-BIP primer of 180. mu.M. The kit selects 8 sample chips, namely 1 sample adding hole corresponds to 4 detection holes, a primer for embedding and amplifying an RHDV sequence in a 1 st detection hole site and a primer for embedding and amplifying an RHDV2 sequence in a 2 nd detection hole site, a 3 rd detection hole is blank, and an internal reference primer (shown in figure 1) is embedded in a 4 th detection hole site, and is freeze-dried.
The nucleic acid sequence of the rabbit fever virus is EF558582, and the nucleic acid sequence of the rabbit fever 2 type virus is MH 341513.
Taking 16 mu L of RHDV nucleic acid with the sequence of EF 558582; taking 16 mu L of nucleic acid of RHDV2 with the nucleic acid sequence of MH341513, fully and uniformly mixing the two nucleic acids, then mixing 18 mu L of reaction liquid with 32 mu L of nucleic acid of RHDV and RHDV2 template, adding the mixture into a sample adding hole of a chip, sealing the sample adding hole by using a sealing film, and loading on a machine;
the temperature was set at 63.5 ℃ and the reaction time was set at 30 min.
2. And (3) performing on-machine amplification on the microfluidic chip:
because the method adopts constant temperature amplification, the temperature-variable processes of denaturation, annealing, extension and the like of PCR amplification are not needed, the whole reaction process is finished under the constant temperature condition, and the amplification program comprises the following steps: the temperature was set at 63.5 ℃ and the reaction time was set at 30 min. And (3) running a program: the low-speed centrifugation rotating speed is 1600 r/min, the low-speed centrifugation time is 10 sec, the high-speed centrifugation rotating speed is 4600 r/min, and the high-speed centrifugation time is 30 sec.
3. And (3) judging the result of the microfluidic chip:
3.1 microfluidic chip Detector threshold line set
The threshold line is set to 800 (which can be adjusted according to the actual situation, the setting principle is that the threshold line just exceeds the highest point of the atypical S-type amplification curve, and the Ct value is displayed as 30), and the instrument matching software automatically analyzes the result.
3.2 quality control
When the internal reference shows an amplification curve and the Ct value is less than 30, the experimental result is valid.
3.3 determination of results
3.3.1 Experimental establishment conditions
Positive control: ct <30, and the reaction wells (1 and 2) of the positive control and the reaction well (4) of the internal standard have obvious typical S-shaped amplification curves.
Negative control: ct <30, no amplification curve exists in the reaction wells (1 and 2) of the negative control, and a typical S-shaped amplification curve is obvious in the internal standard reaction well (4).
3.3.2 criteria of determination
Positive: within 30 minutes of reaction time, an obvious amplification curve appears at the hole site detected by the item, and the Ct value is less than 30, and the detection item corresponding to the hole is judged to be positive. Negative: within 30 minutes of reaction time, no obvious amplification curve appears at the hole site of the item detection, and the detection item corresponding to the hole is judged to be negative.
Carrying out constant-temperature amplification on the microfluidic chip on a microfluidic chip detector, carrying out real-time fluorescence detection by the detector, judging and reading according to an effective amplification curve of the fluorescence detection, and judging that any detection hole is positive if a standard S-shaped amplification curve exists in the detection hole, namely the sample contains viral nucleic acid corresponding to the detection hole; the test well without the amplification curve is judged to be negative, i.e., the sample does not contain the viral nucleic acid corresponding to the test well.
4. Verification of sensitivity and detection limits
4.1 Experimental materials
Reagent: reaction solution; 1X 106 copies/µL、1×105 copies/µL、1×104 copies/µL、1×103copies/µL、1×102 copies/µL、1×101 copies/µL、1×100Copies/mu L gene fragment with RHDV and RHDV2The plasmid of (1); negative control; and (4) positive control.
The instrument comprises the following steps: a constant temperature amplification instrument; a palm centrifuge; a pipette.
4.2 detection System
The experimental operation was carried out by referring to the above-mentioned detection system, and then the test detection was carried out by placing the same chip into an isothermal amplification apparatus, and the amplification results were as shown in FIG. 2, wherein the minimum detection limits of the primers RHDV (A) and RHDV2 (B) were 1X 102The Ct of the plasmid with copies/mu L is less than 30 min, which indicates that the sensitivity is very high.
5. Verification of repeatability
5.1 Experimental materials
Reagent: reaction solution; RHDV and RHDV2 primers 1X 104 Plasmid of copies/μ L; negative control; and (4) positive control.
The instrument comprises the following steps: a constant temperature amplification instrument; a palm centrifuge; a pipette.
5.2 detection System
And (3) carrying out experimental operation by referring to the detection system, and then putting the chip into a constant-temperature amplification instrument for experimental detection.
5.3 amplification results
FIG. 3 is a graph showing the results of amplification of RHDV and RHDV2 in a repetitive experiment. The lower graph shows the coefficient of variation (CV,%) of Ct values for RHDV and RHDV 2.
Through calculation, the coefficient of variation (CV,%) of the Ct value of the primer RHDV is 2.8%, the repeatability is good and is less than 5%, and the requirement is met; the variation coefficient (CV,%) of Ct value of the primer RHDV2 is 1.2%, the repeatability is good and is less than 5%, and the primer RHDV2 meets the requirement.
6. Verification of specificity
6.1 Experimental materials
Reagent: reagent: reaction solution; rabbit fever vaccine nucleic acids; rabbit fever type 2 sample nucleic acid; and (5) negative control.
The instrument comprises the following steps: a constant temperature amplification instrument; a palm centrifuge; a pipette.
6.2 detection System
The experimental operation was carried out with reference to the detection system in the above 1, and then the chip was put into an isothermal amplification apparatus for experimental detection.
6.3 amplification results
The amplification results of the RHDV and RHDV2 specificity experiments refer to FIG. 4, and the amplification results of the RHDV show that the RHDV primers can only specifically amplify and detect the nucleic acid of the Lepidoptera vaccine and have good specificity, and generally can not generate cross reaction with the pathogenic bacteria of Lepidermal disease type 2, except that the amplification result of the nucleic acid of the Lepidermal vaccine is positive, and the nucleic acid of the Lepidermal disease type 2 sample and the negative control have no amplification curve. From the amplification result of the RHDV, the amplification result of the nucleic acid except the classical lepori type 2 sample is positive, and the nucleic acid of the classical lepori vaccine and the negative control have no amplification curve, which indicates that the RHDV2 primer can only specifically amplify and detect the classical lepori type 2 sample nucleic acid, has good specificity and generally does not generate cross reaction with the classical lepori pathogenic bacteria.
The above are merely characteristic embodiments of the present invention, and do not limit the scope of the present invention in any way. All technical solutions formed by equivalent exchanges or equivalent substitutions fall within the protection scope of the present invention.
Claims (3)
1. A primer for efficiently detecting rabbit plague and rabbit plague type 2 in a duplex manner is characterized by comprising the following specific steps:
RHDV-F3：CCGGCACAAACCAAAAYC；
RHDV-B3：GTGCGCCTGACRACAGAC；
RHDV-FIP：ATGTGACGGCAYTGGCGTTT-CCGGACTGTTTGTGATGGC；
RHDV-BIP：
TTGTRACTACACCCGGCACTCC-GCGAACATGATGGGTGTGTT；
RHDV2-F3：GCTTCCGGCTTCATGGAAC；
RHDV2-B3：GAAAAGCCATTGGTTGTGCC；
RHDV2-FIP：
TCRATGAGGGTGGCTGAAGCC-TTGGCTTGAGTGTTGATGGA；
RHDV2-BIP：
AGAVCTTGTTGACATCCGCCC-ARTTGTACACRAGCGTRCT。
2. a kit for efficiently detecting rabbit fever and rabbit fever type 2 in a duplex manner, which is characterized by comprising the primers of claim 1 and a reaction solution, wherein the reaction solution comprises the following components:
20 mM Tris-HCl 0.2 μL
40 mM KCl 6.8 μL
100 mM （NH4）2SO4 1.8 μL
80 mM MgSO4 1.8 μL
1% Tween-20 1.8 μL
28 mM dNTPs 0.9 μL
8000U/mL Bst enzyme 1.8. mu.L
10000U/mL Invitrogen SuperScript IV reverse transcriptase 0.1. mu.L
10Mm Reverse Transcriptase Inhibitors 0.1 μL
0.9. mu.L of 1 mM SYBRGREEN fluorescent dye
4.0×10-6 mol/L gold nanoparticles 1.8. mu.L.
3. The kit for efficiently detecting rabbit fever and rabbit fever type 2 in a duplex manner according to claim 2, wherein the concentration and volume of the rabbit fever primers are as follows: mu.L of 90. mu.M RHDV-F3 primer, 0.5. mu.L of 90. mu.M RHDV-B3 primer, 2. mu.L of 180. mu.M RHDV-FIP primer, and 2. mu.L of 180. mu.M RHDV-BIP primer; the concentration and volume of the rabbit fever type 2 primer are as follows: mu.L of RHDV2-F3 primer of 90. mu.M, 0.5. mu.L of RHDV2-B3 primer of 90. mu.M, 2. mu.L of RHDV2-FIP primer of 180. mu.M, and 2. mu.L of RHDV2-BIP primer of 180. mu.M.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011154052.6A CN112280898A (en) | 2020-10-26 | 2020-10-26 | Efficient duplex primer and kit for detecting rabbit plague and rabbit plague type 2 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011154052.6A CN112280898A (en) | 2020-10-26 | 2020-10-26 | Efficient duplex primer and kit for detecting rabbit plague and rabbit plague type 2 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112280898A true CN112280898A (en) | 2021-01-29 |
Family
ID=74424934
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011154052.6A Pending CN112280898A (en) | 2020-10-26 | 2020-10-26 | Efficient duplex primer and kit for detecting rabbit plague and rabbit plague type 2 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112280898A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112795705A (en) * | 2021-03-12 | 2021-05-14 | 长沙海关技术中心 | Primer and kit for efficient triple detection of SVCV, IHNV and CEV |
| CN113005227A (en) * | 2021-03-12 | 2021-06-22 | 长沙海关技术中心 | Efficient duplex primer and kit for detecting foot-and-mouth disease and Peste des petits ruminants |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108546780A (en) * | 2018-04-26 | 2018-09-18 | 四川农业大学 | PCR primer that is a kind of while detecting RHDV and RHDVa and its kit and non-diagnostic purpose detection method |
-
2020
- 2020-10-26 CN CN202011154052.6A patent/CN112280898A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108546780A (en) * | 2018-04-26 | 2018-09-18 | 四川农业大学 | PCR primer that is a kind of while detecting RHDV and RHDVa and its kit and non-diagnostic purpose detection method |
Non-Patent Citations (2)
| Title |
|---|
| DONGWEI YUAN等: "Development of a reverse-transcription loop-mediated isothermal amplification method for detection of rabbit hemorrhagic disease virus", JOURNAL OF VIROLOGICAL METHODS, vol. 187, pages 272 * |
| ZEXIAO YANG等: "Preliminary Study on The RT-LAMP Assay for Rabbit Hemorrhagic Disease Virus Type 2 Detection, Advances in Biological Sciences Research, volume 3", INTERNATIONAL CONFERENCE ON BIOLOGICAL ENGINEERING AND PHARMACY (BEP 2016, pages 2 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112795705A (en) * | 2021-03-12 | 2021-05-14 | 长沙海关技术中心 | Primer and kit for efficient triple detection of SVCV, IHNV and CEV |
| CN113005227A (en) * | 2021-03-12 | 2021-06-22 | 长沙海关技术中心 | Efficient duplex primer and kit for detecting foot-and-mouth disease and Peste des petits ruminants |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110551846B (en) | Cpf1 kit for quickly detecting African swine fever virus nucleic acid and detection method thereof | |
| CN107988325A (en) | Shrimp liver sausage born of the same parents worm（EHP）RAA constant temperature fluorescence detection method and reagent | |
| CN110791592A (en) | Primer and kit for rapidly detecting African swine fever virus | |
| CN112280898A (en) | Efficient duplex primer and kit for detecting rabbit plague and rabbit plague type 2 | |
| CN111334608B (en) | Dual-fluorescence freeze-drying microchip, kit and method for detecting novel coronavirus 2019-nCoV | |
| CN107828913A (en) | Prawn white spot syndrome（WSSV）RAA constant temperature fluorescence detection method and kit | |
| CN107988427A (en) | Prawn hepatopancreatic parvovirus（HPV）RAA constant temperature fluorescence detection method and reagent | |
| CN107988426A (en) | Prawn Taura syndrome（TSV）RAA constant temperature fluorescence detection method and reagent | |
| JP7105553B2 (en) | Dual-probe assay for target nucleic acid detection | |
| CN110885904B (en) | Freeze-dried microchip, kit and method for identifying 16 pig disease pathogens | |
| CN110885900B (en) | Freeze-dried microchip, kit and method for identifying classical strain of porcine reproductive and respiratory syndrome virus and NADC30-Like strain | |
| CN112029878A (en) | Primer and kit for efficiently detecting erysipelothrix rhusiopathiae | |
| CN111321247B (en) | Freeze-drying microporous plate, kit and method for identifying African swine fever virus, swine fever wild strain and swine fever lapinized attenuated vaccine strain | |
| CN110885899B (en) | Freeze-drying microchip, kit and method for identifying 16 avian disease pathogens | |
| CN111406118A (en) | Nick generation and extension amplification reaction (NEAR) of respiratory syncytial virus species | |
| CN112029909A (en) | Primer and kit for detecting white spot syndrome virus | |
| CN112210624B (en) | LAMP primer and kit for efficiently detecting three pathogens of trionyx sinensis in triple mode | |
| CN111850173A (en) | Primer and kit for efficiently detecting porcine circovirus type 2 | |
| CN111996293A (en) | Primer and kit for efficiently detecting porcine epidemic encephalitis B virus | |
| WO2021192370A1 (en) | Testing method and testing reagent for novel coronavirus | |
| CN108588274A (en) | Prawn steals dead nodavirus（CMNV）RAA constant temperature fluorescence detection method and reagent | |
| CN112795705A (en) | Primer and kit for efficient triple detection of SVCV, IHNV and CEV | |
| CN110885902B (en) | Freeze-drying microchip, kit and method for detecting porcine reproductive and respiratory syndrome virus and identifying highly pathogenic classical variant strain of porcine reproductive and respiratory syndrome virus | |
| CN112094945A (en) | Primer and kit for efficiently detecting porcine epidemic diarrhea virus | |
| CN111961755A (en) | Primer and kit for efficiently detecting porcine parvovirus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |