CN112280864B - Thyroid polygene joint detection kit - Google Patents

Abstract

The invention belongs to the technical field of molecular biology, and particularly relates to a thyroid polygene joint detection kit. The kit of the present invention comprises: a special joint for constructing a DNA library; detecting the fusion gene and the specific composite primer of point mutation; library amplification composite primers. The kit provided by the invention can be used for carrying out high-throughput sequencing by extracting the DNA and the RNA of a sample to be detected together, carrying out reverse transcription on the RNA into cDNA, then carrying out high-throughput sequencing together with the DNA to construct a high-throughput sequencing library, and carrying out high-throughput sequencing, so that the kit can be used for detecting multiple point mutations including CCDC6-RET/NCOA4-RET fusion, PAX8/PPAR gamma fusion, BRAF (V600E), HRAS (61), NRAS (61), KRAS (12,13), KRAS (61), TERTp and the like at one time, is simple to operate, short in time and high in sensitivity which can reach 0.1%.

Description

Thyroid polygene joint detection kit

Technical Field

The invention relates to the technical field of molecular biology, in particular to a thyroid polygene joint detection kit.

Background

Thyroid nodules are a thyroid disease commonly existing in people and are a pathological change caused by local abnormal growth of thyroid cells. In most cases, thyroid nodules are benign and can be treated conservatively, but 5% -10% of them are malignant, i.e., thyroid cancer, which requires early surgical treatment to obtain a good prognosis. At present, thyroid cells are obtained by a fine needle puncture (FNA) method, and cytological examination is the current gold standard for assessing whether thyroid nodules are malignant tumors. However, there are still 20% -30% of thyroid nodules that cannot be definitively diagnosed in this way.

With the development of molecular biology techniques, molecular diagnosis has been receiving attention in the differential diagnosis of benign and malignant thyroid nodules. The clinical practice guidelines of the united states National Comprehensive Cancer Network (NCCN) 2019 edition specify: (1) for suspected follicular and Hurthle cell carcinoma (diagnosis is based on infiltration of blood vessels or envelopes) which cannot be determined by fine needle puncture, molecular detection is helpful for judging the benign or malignant condition of the cancer; (2) the method is characterized in that the nodules which cannot be diagnosed clearly in cytology have an important effect on auxiliary diagnosis of thyroid cancer by detecting the variation of BRAF, RAS, RET/PTC, PAX8/PPAR gamma and other oncogenes by utilizing a molecular diagnosis technology.

Current research shows that gene fusion is one of The decisive factors for The onset of thyroid Cancer, and The genetic map of thyroid Cancer drawn by The Cancer Genome project (The Cancer Genome Atlas) indicates that gene fusion accounts for about 20% of thyroid Cancer gene mutations. Therefore, the identification of the gene fusion and related gene mutation conditions in the thyroid cancer tissues has important significance for accurate diagnosis and treatment of thyroid cancer.

At present, the detection of gene fusion mainly depends on Real-Time fluorescent quantitative PCR (RT-PCR), Fluorescence In Situ Hybridization (FISH), Immunohistochemistry (IHC) and the like. FISH and IHC both adopt a probe hybridization principle to detect known gene fusion, generally only one type of gene fusion is detected at a time, the operation flow is complex, and the cost is high; RT-PCR has relatively high detection flux, but needs more samples, has more experimental operation steps and higher detection cost. PCR detection is usually performed for the marker mutation site using specific primers. However, it was not found that one-tube reaction of one kit was achieved for thyroid nodules while detecting gene fusion mutations and point mutations.

Chinese patent CN111349694A discloses a method and a kit for detecting fusion mutation of thyroid cancer related genes, which can detect fusion mutation of three thyroid cancer related genes, namely RET/PTC1 fusion, RET/PTC3 fusion and PAX8-PPARG rearrangement, but cannot detect BRAF, KRAS, NRAS, HRAS, tert and other point mutations.

For another example, chinese patent CN110241215B discloses a primer and a kit for detecting benign and malignant genetic variation of thyroid nodule, which can simultaneously detect variation of 15 sites of 6 genes and variation of 3 fusion genes, including BRAF gene, KRAS gene, HRAS gene, NRAS gene, TERT gene, EIF1AX gene, RET/PTC1 fusion, RET/PTC3 fusion, and PAX8/PPAR γ fusion, but the technical scheme has the following disadvantages: the detection range of the fusion gene chaperone gene is small, and only two fusion types of PTC1/RET and PTC3/RET can be detected; the constructed DNA sequencing library has low complexity and is easy to generate false positive; the operation is complex, and the construction of the RNA and DNA two-part library is required to be independently carried out.

For example, CN110878358A discloses a set of thyroid cancer markers and applications thereof, which are used for carrying out high-depth sequencing on all exon regions of 44 genes related to thyroid molecular typing, targeted drug administration, chemotherapy drug administration, surgical prompt, prognosis and inheritance, and simultaneously analyzing multiple variation types of genes, such as SNV/Indel, gene fusion and the like, and deeply analyzing molecular level information of thyroid nodules and thyroid cancer, wherein capture probes designed for 44 genes cover 558 targeted target regions, the probes comprise 3633 sequences, the sizes of the sequences are 254.096Kbp in total, and the prepared kit has the advantages of wide coverage, high cost performance, strong effectiveness, capability of providing reference basis for further molecular typing, drug administration prompt, genetic risk assessment and the like of thyroid patients, and suitability for clinical popularization and application. The disadvantages are that: the cost of liquid phase hybridization is high, and the operation flow is complex.

The traditional fluorescent PCR method only can detect one site at a time, and the required sample amount is large; the detection cost is high; the defects of more experiment operation quantity, long time consumption of detection procedures and the like.

In conclusion, the above methods can only detect the known gene fusion detection or point mutation, and are limited by the detection flux, and cannot realize one-time complete detection of the fusion gene and point mutation causing thyroid tumor carcinogenesis. However, many studies have reported that more than 40 kinds of pathogenic gene fusions are generated in thyroid cancer, and a large number of new gene fusions and gene mutations are reported in succession. Therefore, the development of a kit capable of rapidly and simultaneously detecting the fusion gene and the point mutation has important significance for clinical research and diagnosis of thyroid cancer.

Disclosure of Invention

Aiming at the defects in the prior art, the technical problem to be solved by the invention is to provide a thyroid polygene combined detection kit for simultaneously detecting the fusion and mutation conditions of known and unknown genes of thyroid tumor related polygenes, wherein DNA and RNA of a sample to be detected are jointly extracted, RNA is subjected to reverse transcription to form cDNA, and then a high-throughput sequencing library is constructed together with the DNA, and high-throughput sequencing is carried out, so that the kit can detect various point mutations including CCDC6-RET/NCOA4-RET fusion and PAX8/PPAR gamma fusion, BRAF (V600E), HRAS (61), NRAS (61), KRAS (12,13), KRAS (61), TERTp and the like at one time, can provide accurate diagnosis and treatment for individuals with thyroid cancer, and can evaluate the risk of thyroid nodule patients.

In order to solve the above technical problems, the present invention provides the following technical solutions.

In one aspect, the present invention provides a set of specific composite primers for detecting fusion genes and point mutations, wherein the sequences of the specific composite primers are shown in table 1 below.

TABLE 1 specific composite primer sequences

Name (R)	Primer sequences	Detection site
			General primer 1 (SEQ ID NO: 10)	AATGATACGGCGACCACCGAGAT	Are respectively matched with specific primers 1-8
Specific primer 1 (SEQ ID NO: 11)	GTGACTGGAGTTCAGACGTGCGCTCTTCCGATCCTTCCGAGGGAATTCCCACTTTGGATCC	CCDC6-RET/NCOA4-RET
			Specific primer 2 (SEQ ID NO: 12)	GTGACTGGAGTTCAGACGTGCGCTCTTCCGATCGGGCCAGAATGGCATCTCTGTGTCAACC	PAX8/PPARγ
Specific primer 3 (SEQ ID NO: 13)	GTGACTGGAGTTCAGACGTGCGCTCTTCCGATCCTGTTCAAACTGATGGGACCCACTCCATCG	BRAF(V600E)
			Specific primer 4 (SEQ ID NO: 14)	GTGACTGGAGTTCAGACGTGCGCTCTTCCGATCACCGGAAGCAGGTGGTCATTGATGG	HRAS(61)
Specific primer 5 (SEQ ID NO: 15)	GTGACTGGAGTTCAGACGTGCGCTCTTCCGATCCCTCATGTATTGGTCTCTCATGGCACTGT	NRAS(61)
			Specific primer 6 (SEQ ID NO: 16)	GTGACTGGAGTTCAGACGTGCGCTCTTCCGATCAGCTGTATCGTCAAGGCACTCTTGCC	KRAS(12,13)
Specific primer 7 (SEQ ID NO: 17)	GTGACTGGAGTTCAGACGTGCGCTCTTCCGATCAAAGCCCTCCCCAGTCCTCATGT	KRAS(61)
			Specific primer 8 (SEQ ID NO: 18)	GTGACTGGAGTTCAGACGTGCGCTCTTCCGATCAGGACGCAGCGCTGCCTGAAACTCGC	TERTp

Based on the above primer sequences, a first object of the present invention is to: provides a kit for combined detection of multiple thyroid genes.

The thyroid polygene joint detection kit comprises the following components: (1) specific composite primers for detecting fusion genes and point mutations.

The thyroid polygene joint detection kit further comprises: (2) a special joint for constructing a DNA library.

The special joint constructed by the DNA library is 8 dimers formed by joint primer 1 and 8 different i5 end primers.

The sequences of the adaptor primer 1 and the 8 different i5 terminal primers are shown in Table 2 below.

TABLE 2 Special linker sequences

Special joint	Primer sequences
		Joint primer 1 (SEQ ID NO: 1)	GATCGGAAGAGCCACATACTGA
Primer No. 1 at end i5 (SEQ ID NO: 2)	AATGATACGGCGACCACCGAGATCTACACCTCTCTATACACTCTTTCCCTACACGACGCTCTTCCGATCT
		Primer No. 2 of i5 end (SEQ ID NO: 3)	AATGATACGGCGACCACCGAGATCTACACTATCCTCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
Primer No. 3 of i5 end (SEQ ID NO: 4)	AATGATACGGCGACCACCGAGATCTACACGTAAGGAGACACTCTTTCCCTACACGACGCTCTTCCGATCT
		Primer No. 4 of i5 end (SEQ ID NO: 5)	AATGATACGGCGACCACCGAGATCTACACACTGCATAACACTCTTTCCCTACACGACGCTCTTCCGATCT
Primer No. 5 of i5 end (SEQ ID NO: 6)	AATGATACGGCGACCACCGAGATCTACACAAGGAGTAACACTCTTTCCCTACACGACGCTCTTCCGATCT
		Primer No. 6 at end i5 (SEQ ID NO: 7)	AATGATACGGCGACCACCGAGATCTACACCTAAGCCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
Primer No. 7 of i5 end (SEQ ID NO: 8)	AATGATACGGCGACCACCGAGATCTACACCGTCTAATACACTCTTTCCCTACACGACGCTCTTCCGATCT
		Primer No. 8 at end i5 (SEQ ID NO: 9)	AATGATACGGCGACCACCGAGATCTACACTCTCTCCGACACTCTTTCCCTACACGACGCTCTTCCGATCT

The special joint has a structure shown in figure 1. Wherein, the sequence of the 5_ index is as follows: CTCTCTAT, TATCCTCT, GTAAGGAG, ACTGCATA, AAGGAGTA, CTAAGCCT, CGTCTAAT or TCTCTCTCCG.

The special joint comprises 8 joint structures shown in figure 2.

The thyroid polygene joint detection kit further comprises: (3) a set of library amplification composite primers, wherein the sequences of the library amplification composite primers are shown in table 3 below.

TABLE 3 library amplification composite primer sequences

Name (R)	Primer sequences
		General primer 2 (SEQ ID NO: 19)	AATGATACGGCGACCACCG
Primer No. 1 at end i7 (SEQ ID NO: 20)	CAAGCAGAAGACGGCATACGAGATTCACAAGCGTGACTGGAGTTCAGACGTGT
		Primer No. 2 of i7 end (SEQ ID NO: 21)	CAAGCAGAAGACGGCATACGAGATACTACACGGTGACTGGAGTTCAGACGTGT
Primer No. 3 of i7 end (SEQ ID NO: 22)	CAAGCAGAAGACGGCATACGAGATATCGTACGGTGACTGGAGTTCAGACGTGT
		Primer No. 4 of i7 end (SEQ ID NO: 23)	CAAGCAGAAGACGGCATACGAGATAGACACAGGTGACTGGAGTTCAGACGTGT
Primer No. 5 of i7 end (SEQ ID NO: 24)	CAAGCAGAAGACGGCATACGAGATTTGTCCTGGTGACTGGAGTTCAGACGTGT
		Primer No. 6 at end i7 (SEQ ID NO: 25)	CAAGCAGAAGACGGCATACGAGATTGTGAGAGGTGACTGGAGTTCAGACGTGT
Primer No. 7 of i7 end (SEQ ID NO: 26)	CAAGCAGAAGACGGCATACGAGATAAGGTTGGGTGACTGGAGTTCAGACGTGT
		Primer No. 8 at end i7 (SEQ ID NO: 27)	CAAGCAGAAGACGGCATACGAGATATTAGCCAGTGACTGGAGTTCAGACGTGT

The kit of the present invention, wherein the reagents of items (1) to (3) above are packaged separately.

As a preferred embodiment, the kit provided by the first object of the present invention further comprises any one or more of the following reagent groups: a reverse transcription reaction reagent group; DNA fragmentation, end repair and base A reagent group addition; a DNA ligation reagent group; a PCR amplification reagent set; high fidelity hot start PCR amplification reagent set.

It should be noted that the specific composite primer for detecting fusion gene and point mutation provided by the present invention is the second object of the present invention. The product or related method for detecting CCDC6-RET/NCOA4-RET, PAX8/PPAR gamma, BRAF (V600E), HRAS (61), NRAS (61), KRAS (12,13), KRAS (61) and TERTp by matching the fusion gene and the specific composite primer for detecting point mutation with other joints provided by the invention also belongs to the scope included in the aim of the invention.

Specifically, the reverse transcription reaction reagent group comprises a random primer, a first strand synthesis buffer solution, a first strand synthesis enzyme mixed solution, a second strand synthesis buffer solution, a second strand synthesis enzyme mixed solution and ultrapure water.

Specifically, the DNA fragmentation, end repair and base A reagent group comprises 10 times DNA fragmentation buffer solution, 5 times fragmentation enzyme mixed solution and ultrapure water.

Specifically, the DNA ligation reagent group comprises 5 Xligase buffer solution, TIANSeq DNA ligase, a special joint and ultrapure water.

Specifically, the PCR amplification reagent group comprises 5 multiplied PCR reaction enzyme mixed liquor, PCR primers and ultrapure water.

Specifically, the high-fidelity hot-start PCR amplification reagent set comprises high-fidelity hot-start enzyme reaction liquid and ultrapure water.

The invention also provides a using method of the kit, namely a non-disease detection thyroid polygene combined detection method.

The using method comprises the following steps:

s1, connecting and detecting sample DNA by using a special joint constructed by a DNA library;

s2, carrying out composite PCR amplification on the ligation product obtained in the step S1 by using specific composite primers for detecting the fusion gene and point mutation;

s3, carrying out PCR amplification on the amplification product obtained in the step S2 by using a library amplification composite primer to obtain a sequencing library;

s4, sequencing the sequencing library obtained in the step S3.

As some preferred embodiments, the use method comprises the following steps:

(1) extracting DNA and RNA in a sample;

(2) carrying out reverse transcription on the RNA obtained in the step (1) to prepare cDNA;

(3) mixing the cDNA obtained in the step (2) with the DNA obtained in the step (1), and then carrying out nucleic acid fragmentation, end repair and A addition to obtain a cDNA and DNA mixed solution;

(4) performing joint connection and purification on the cDNA obtained in the step (3) and DNA mixed solution to obtain a purified joint connection product;

(5) performing first-step specific PCR on the purified adaptor connection product obtained in the step (4) and purifying to obtain a first-step PCR purified product;

(6) performing second-step universal PCR on the first-step PCR purified product obtained in the step (5) and purifying to obtain a sequencing library;

(7) sequencing on a computer;

(8) and (4) performing data result analysis by using bioinformatics analysis software.

Compared with the prior art, the invention has the following beneficial effects.

1. The present invention enables simultaneous detection of fusion genes and point mutations with respect to the overall concept of the present invention.

2. In view of the design concept of the present invention for library construction.

When a traditional amplicon library is constructed to detect gene locus mutation, double-primer amplification (see a schematic diagram of an attached figure 3) is used, double-end positions of a generated library are fixed, so that a sequencing sequence at a certain position cannot effectively remove sequence repetition caused by amplification, random mutation introduced in the amplification process cannot be identified and reduced, and the sensitivity is reduced.

After the cDNA and the DNA are randomly broken, the universal primers are connected to two ends of the DNA, one end of the DNA is amplified by using the specific primers, the other end of the DNA is amplified by using the universal primers, and the randomness of one section of the DNA is reserved, so that a repeated sequencing sequence can be effectively identified. See the schematic diagram of fig. 4.

3. In terms of the design of the specific composite primer for detecting the fusion gene and the point mutation of the present invention.

A fusion gene is a chimeric gene formed by connecting the coding regions of two or more genes end to end under the control of the same set of regulatory sequences (including promoter, enhancer, ribosome binding sequence, terminator, etc.). For example, CCDC6-RET/NCOA4-RET, wherein RET is a core gene, CCDC6 and NCOA4 are chaperone genes, fusion genes usually have a plurality of chaperone genes, and fusion breakpoints are often different.

Therefore, in the traditional amplicon library construction, the two genes of the chaperone gene and the core gene need to be known at the same time, and the primer design detection is carried out under the condition that the breakpoint position is also known. Easily miss the type of fusion for which the breakpoint is unknown, or for which the chaperone gene is unknown.

According to the invention, by arranging the single primer on the core gene, the breakpoint or the chaperone gene is not required to be known in advance, the sequence can be contained in the library in the primer amplification process, and the chaperone gene and the breakpoint position can be identified through sequencing. For comparison, see the schematic diagram of FIG. 5.

4. For the entire detection procedure.

The traditional liquid phase hybridization capture library has long flow, about 24 steps are involved, the time is consumed for 20-24 hours, the operation process is complex, the kit simplifies the operation flow to 11 steps and shortens the time to 6-8 hours, and the schematic diagram of the attached figure 6 is shown.

5. Comparison with other detection techniques

(1) Compared with the detection of mutation sites such as BRAF (V600E), HRAS (61), NRAS (61), KRAS (12,13), KRAS (61) and TERTp by Sanger sequencing method

The Sanger sequencing method has low sensitivity which can only reach 10%. The kit provided by the invention utilizes a high-throughput sequencing method to perform parallel sequencing on each mutation more than 10000 times per sequencing. The sensitivity can reach 0.1%.

Sanger sequencing is complex to operate, and only one site can be detected in each tube of reaction. The kit can detect all the sites simultaneously by adding detection primers of a plurality of sites and performing high-throughput sequencing.

(2) Comparison with detection of the above mutation by arms _ PCR

The mutation operation is complex by using an arms _ PCR method, and each tube of reaction can only detect one to three sites; the kit can detect all the sites simultaneously by adding detection primers of a plurality of sites and performing high-throughput sequencing. In addition, the arms _ PCR method cannot detect the fusion gene using mRNA, and the kit of the present invention can detect.

(3) Compared with the detection of the fusion gene by the RT-PCR method

The detection method of RT-PCR has low detection efficiency, only one type of fusion can be detected at one time, and the kit can realize the simultaneous detection of multiple types of fusion by simultaneously adding multiple groups of primers. The RT-PCR can only detect known types and limit the type of fusion gene of a specific breakpoint, and the invention overcomes the defect.

6. The whole technical scheme of the invention utilizes a high-throughput sequencing method, sequences each mutation at each time and performs parallel sequencing more than 10000 times, combines the whole concept, the design concept of library construction and (1) a special joint constructed by a DNA library; (2) detecting the fusion gene and the specific composite primer of point mutation; (3) the design concept of the library amplification composite primer realizes the simultaneous detection of all the sites (fusion gene and a plurality of mutation sites) on one hand; on the other hand, the detection sensitivity is improved from multiple aspects and angles, and the sensitivity can reach 0.1%. And the conventional detection method (such as Sanger sequencing) has low sensitivity which can only reach 10%.

Compared with the prior art, the kit for the combined detection of the multiple thyroid genes has higher sensitivity and can realize the simultaneous detection of the fusion genes and the mutation sites.

Drawings

Fig. 1 shows a special joint structure.

Fig. 2 shows 8 joint structures of the dedicated joint.

FIG. 3 shows the construction of a library of conventional amplicons to detect mutations in gene loci.

FIG. 4 shows the construction of a single primer library of the present invention for detecting gene locus mutations.

FIG. 5 is a comparison of the construction of a conventional amplicon library and the detection of fusion genes with the single primer library of the present invention.

FIG. 6 is a comparison of the construction of a solution phase hybrid capture library with a single primer library of the present invention.

FIG. 7 is an experimental flow chart of the method of using the kit of the present invention.

FIG. 8 is a flow chart of the construction of the single primer amplification library of the present invention.

FIG. 9 shows the result of detecting CCDC6-RET fusion positivity using the kit of the present invention.

FIG. 10 shows the result of the kit of the present invention for detecting KRAS-G12D mutation positivity.

FIG. 11 is a schematic diagram of sensitivity enhancement by random end de-emphasis.

FIG. 12 shows background mutation frequency of KRAS-G12D point mutation detected from conventional double-ended primer amplicon library.

FIG. 13 shows the background mutation frequency of KRAS-G12D point mutation detected by the universal primer and the specific primer.

FIG. 14 shows the results of detection of two different primer pairs CCDC6-RET positive samples. The upper half is specific primer 1 and the lower half is RET other test primers.

FIG. 15 shows the results of testing positive samples for KRAS G12D with two different primer pairs.

FIG. 16 shows the results of the test of clinical sample No. 19474 (NCOA 4-RET). The left half is NCOA4 and the right half is RET.

FIG. 17 shows the result of detection of clinical sample No. 19753 (PAX 8/PPAR. gamma.). The left half is PAX8 and the right half is PPAR γ.

Fig. 18 is BRAF (V600E): and (3) detection results of BRAF p.V600E Reference Standard.

Fig. 19 is NRAS (61): the detection result of NRAS p.Q61H Reference Standard.

FIG. 20 is TERTp: 19225 (wild type). The arrow points to the tert promoter region.

Fig. 21 is HRAS (61): 19387 the result of detection of wild type.

Fig. 22 is KRAS (61): the detection result of KRAS p.Q61H Reference Standard.

Detailed Description

The present invention will be further illustrated in detail with reference to the following specific examples, which are not intended to limit the present invention but are merely illustrative thereof. The experimental methods used in the following examples are not specifically described, and the materials, reagents and the like used in the following examples are generally commercially available under the usual conditions without specific descriptions.

Reagent:

random primers, first strand synthetase mixture, first strand synthesis buffer, second strand synthesis buffer, and second strand synthetase mixture were purchased from Tiangen Biochemical technology (Beijing) Ltd, cat #: TIANeq RNA fragmentation and cDNA Synthesis Module (NG 308).

10 XDNA fragmentation buffer, 5 Xfragmentation enzyme mixture from Tiangen Biochemical technology (Beijing) Ltd, cat #: tiaseq rapid DNA fragmentation/end repair/dA addition module (NG 301).

5 Xligase buffer, TIANSeq DNA ligase was purchased from Tiangen Biochemical technology (Beijing) Ltd, cat #: TIANSeq quick connect module (NG 303).

1.6X magnetic beads purchased from Tiangen Biochemical technology (Beijing) Ltd, cat #: TIANeq DNA fragments sorting beads (NG 306).

5 × multiplex PCR reaction enzyme mixture purchased from Takara, cat #: multiplex PCR Assay Kit Ver.2, RR 062A.

High fidelity hot start enzymatic reaction fluids were purchased from Tiangen Biochemical technology (Beijing) Ltd, cat #: TIANSeq high fidelity PCR reaction premix (NG 219).

Example 1 design of adapter for DNA library construction, specific composite primer for detecting fusion gene and point mutation, and composite primer for library amplification

(1) Specific composite primer for detecting fusion gene and point mutation

A group of specific composite primers for detecting fusion genes and point mutations are shown in Table 1.

(2) Special joint for DNA library construction

A special joint constructed by a DNA library is 8 dimers formed by joint primers 1 and 8 different i5 end primers.

The sequences of adaptor primer 1 and 8 different i5 end primers are shown in Table 2.

The dedicated fitting has a structure as shown in fig. 1. Wherein, the sequence of the 5_ index is as follows: CTCTCTAT, TATCCTCT, GTAAGGAG, ACTGCATA, AAGGAGTA, CTAAGCCT, CGTCTAAT or TCTCTCTCCG.

Thus, the dedicated fitting includes 8 fitting structures as shown in fig. 2.

(3) A set of library amplification composite primers, the sequences of which are shown in table 3.

Example 2 kit for combined detection of multiple genes in thyroid gland and method of use thereof

A kit for combined detection of multiple thyroid genes, comprising the components of example 1: (1) detecting the fusion gene and the specific composite primer of point mutation; (2) a special joint for constructing a DNA library; (3) library amplification composite primers.

The kit further comprises: a reverse transcription reaction reagent group; DNA fragmentation, end repair and base A reagent group addition; a DNA ligation reagent group; a PCR amplification reagent set; high fidelity hot start PCR amplification reagent set.

The reverse transcription reaction reagent group comprises a random primer, a first strand synthesis buffer solution, a first strand synthesis enzyme mixed solution, a second strand synthesis buffer solution, a second strand synthesis enzyme mixed solution and ultrapure water; the DNA fragmentation, end repair and base A reagent group comprises 10 multiplied DNA fragmentation buffer solution, 5 multiplied fragmentation enzyme mixed solution and ultrapure water; the DNA ligation reagent group comprises 5 Xligase buffer solution, TIANSeq DNA ligase, a special joint and ultrapure water; the PCR amplification reagent group comprises 5 multiplied PCR reaction enzyme mixed liquor, PCR primers and ultrapure water; the high-fidelity hot-start PCR amplification reagent set comprises high-fidelity hot-start enzyme reaction liquid and ultrapure water.

The kit of the present invention, wherein the reagents of items (1) to (3) above are packaged separately.

The use method of the kit comprises the following steps:

s1, connecting and detecting sample DNA by using a special joint constructed by a DNA library;

s2, carrying out composite PCR amplification on the ligation product obtained in the step S1 by using specific composite primers for detecting the fusion gene and point mutation;

s3, carrying out PCR amplification on the amplification product obtained in the step S2 by using a library amplification composite primer to obtain a sequencing library;

s4, sequencing the sequencing library obtained in the step S3.

The specific steps are as follows (as shown in fig. 7 and 8).

First, cDNA reverse transcription

1. First Strand cDNA Synthesis

(1) Preparation of reagents: placing RNA extracted from a sample on ice to be slowly thawed, transferring a liquid container, uniformly mixing, taking out a random primer from-20 ℃, thawing, flicking, uniformly mixing, taking out a first strand synthetase mixed solution from-20 ℃, flicking, and uniformly mixing.

(2) The following reaction system of Table 4 was set up in a PCR tube and mixed well by gently pipetting.

TABLE 4 reaction System

Component name	Volume (μ L)
		RNA	X（1000ng）
Random primer	1
		Ultrapure water	10-X
Total amount of	11

(3) The reaction was incubated at 65 ℃ for 5 minutes and then placed on ice for 2 minutes.

(4) After step (3) was completed, the reverse transcription fractions listed in Table 5 below were further added to the original tube.

TABLE 5 reverse transcription Components

Component name	Volume (μ L)
		Reaction solution at the end of step 3	11
First Strand Synthesis buffer	7
		First strand synthetase mixture	2
Total amount of	20

(5) The mixture was gently pipetted and mixed well to perform the first strand cDNA synthesis reaction at a hot lid temperature of 105 ℃.

Reaction procedure: keeping at 25 ℃ for 10 minutes; keeping at 42 ℃ for 15 minutes; keeping at 70 ℃ for 15 minutes; keeping the temperature at 4 ℃.

Note that: immediately after the completion of the reaction, the second strand cDNA synthesis reaction was carried out.

2. Second Strand cDNA Synthesis

(1) Taking out the mixed solution of the second strand synthesis buffer solution and the second strand synthetase from-20 ℃, gently and uniformly mixing, establishing a reaction system shown in the following table 6 in a PCR tube, and gently blowing and fully and uniformly mixing by using a pipettor.

TABLE 6 reaction System

Component name	Volume (μ L)
		Synthetic first Strand cDNA	20
Second Strand Synthesis buffer	8.5
		Second-strand synthetase mixture	3.5
Ultrapure water	48
		Total amount of	80

(2) Performing second strand cDNA synthesis reaction in a PCR instrument, wherein the temperature of a PCR hot cover is set to be less than or equal to 40 ℃.

The reaction steps are as follows: keeping the temperature at 16 ℃ for 60 minutes; keeping the temperature at 4 ℃.

Note that: after the reaction is completed, the synthesized product of the second strand of cDNA may be stored temporarily at 4 ℃ for 1 hour, but it is recommended that the next purification step be carried out immediately after the completion of the reaction.

(3) Purification of

And purifying the synthesized product of the second strand of the cDNA by using the purified magnetic beads at 1.8X, eluting by 37 mu L, and quantifying the cDNA to obtain a cDNA sample.

Secondly, mixing the cDNA with DNA extracted from the sample

50ng of cDNA sample and 50ng of DNA sample extracted from the same sample were mixed in equal amounts to obtain 100ng of mixed solution of cDNA and DNA.

Thirdly, constructing a library: nucleic acid fragmentation, end repair and addition of A

1. The following reaction system of Table 7 was prepared, and the reaction was carried out on ice, and after the addition of the components, the mixture was stirred by gentle pipetting with care taken not to vortex.

TABLE 7 reaction system (when DNA loading >10 ng)

Component name	Volume (μ L)
		10 XDNA fragmentation buffer	5
Mixture of cDNA and DNA	X
		Ultrapure water	35-X
5 Xfragmentation enzyme mixture	10
		Total amount of	50

2. Setting a PCR instrument reaction program. The hot lid was opened and the hot lid temperature was set to 70 ℃.

Reaction procedure: holding at 4 deg.C for 1 min; holding at 32 deg.C for 7 min; keeping the temperature at 65 ℃ for 30 minutes; keeping the temperature at 4 ℃.

Fragmentation time selection reference is made to table 8 below.

TABLE 8 selection of fragmentation time-fragmentation time at 32 ℃ in minutes

Major peak size of DNA	250bp	350bp	450bp	550bp
					10ng DNA loading	24	16	14	10
100ng DNA loading	16	10	8	6
					1000 ng DNA loading	14	8	6	4

3. And immediately entering the joint connection step after the reaction is finished.

Fourthly, constructing a library: joint connection

1. The following components in Table 9 were added directly to the reaction-terminated tube in the previous step.

TABLE 9 linker Components

Components	Volume (μ L)
		Step three fragmenting the reaction product	50
5 Xligase buffer	20
		TIANSeq DNA ligase	10
Special joint (15 mu M)	2.5
		Water (W)	17.5
Total amount of	100

Wherein the special joint comprises 8 joint structures as shown in fig. 2.

Note: only one optional linker structure of the above 8 was used at a time for one sample. The reason for the provision of 8 linker structures is to ensure that multiple samples can be sequenced simultaneously in order to distinguish between different samples.

2. The reaction solution obtained in the previous step was pipetted and mixed well, and the mixture was put into a PCR apparatus to perform the following reaction (without a hot lid).

Reaction procedure: keeping the temperature at 20 ℃ for 15 minutes; keeping the temperature at 4 ℃.

3. And purifying the adaptor connection product by 1.6X magnetic beads, eluting by 16 mu L of ultrapure water, taking 15 mu L of supernate into a new PCR tube, and carrying out the first-step PCR amplification reaction.

Fifth, first step multiplex PCR amplification

1. PCR was performed using a multiplex PCR reaction system as shown in Table 10 below.

TABLE 10 PCR reaction System

Components	Per reaction volume (μ L)
		5 x multiple PCR reaction enzyme mixture	4
10 μ M mixture of specific primers (8 strips)	1.2 (final concentration of each primer 0.1. mu.M)
		5 μ M Universal primer 1 (for current procurement)	0.6 (final concentration 0.15. mu.M)
Purified linker ligation product obtained in step four	X
		Ultrapure water	14.2-X
Total amount of	20

Wherein, the mixture of specific primers (8 strips) includes specific primers 1-8 (SEQ ID NOS: 11-18).

The mixing protocol for the mixture of specific primers (8 strips) is shown in Table 11 below.

TABLE 11 mixing protocol for the mixture of specific primers (8 strips)

Primer name	Each primer of 8 primers had a mixing amount of 100. mu.M (. mu.L)	20 μ L final concentration of primers (μ M) in the reaction System
			Specific primer
1	1	0.1
			Specific primer 2	1	0.1
Specific primer 3	1	0.1
			Specific primer 4	1	0.1
Specific primer 5	1	0.1
			Specific primer 6	1	0.1
Specific primer 7	1	0.1
			Specific primer 8	1	0.1
10 μ M Total amount of primer mix	8

2. After the reaction mixture was prepared, the mixture was pipetted 10 times and mixed, and placed in a PCR instrument and the following reaction program was run (hot lid 105 ℃).

Reaction procedure: holding at 99 deg.C for 2 minutes for 1 cycle; keeping the temperature at 99 ℃ for 15s and 69 ℃ for 4 minutes for 18 cycles; hold at 72 ℃ for 10 minutes for 1 cycle; keeping the temperature at 4 ℃.

3. After the PCR is completed, electrophoresis is performed. And (3) purifying by using 1.6X magnetic beads to obtain a PCR amplification product in the first step, and quantifying the Qubit.

Sixth, second PCR amplification

1. The first PCR amplification product was subjected to the second PCR amplification, and the amplification system was as shown in Table 12 below.

TABLE 12 amplification System

Components	Reaction volume (μ L)
		High-fidelity hot-start enzyme reaction liquid	25
i7-primer（10μM）	1.5
		General primer 2 (10. mu.M)	1.5
First step PCR purification of the product	X
		Water (W)	22-X
Total amount of	50

Wherein the i7 terminal primer is any one of the primer No. 1 at the i7 terminal and the primer No. 8 at the i7 terminal (SEQ ID NO: 20-27). The detection of one sample only uses one i7 terminal primer, and the reason for setting eight i7 terminal primers is to distinguish different samples and ensure that a plurality of samples can be sequenced at the same time.

2. After the second PCR amplification reaction mixture was prepared, the mixture was pipetted 10 times and mixed, and placed in a PCR instrument and the following reaction program was run (hot lid 105 ℃).

Reaction procedure:

initial denaturation at 95 ℃ for 3 min, 1 cycle; denaturation at 98 ℃ for 20sec, annealing at 58 ℃ for 15sec, and elongation at 72 ℃ for 15sec, for 8 cycles; final extension 72 ℃ for 1 min, 1 cycle; keeping the temperature at 4 ℃.

3. After the PCR reaction is finished, the quantit is quantified and electrophoresed.

4. 1.3X magnetic bead purification, 10. mu.L of ultrapure water elution. The Qubit is quantified.

5. The library was diluted to 2-3 ng/. mu.L for Agilent 4150 TapeStation system assay.

6. Sequencing and processing.

7. And (4) performing data result analysis by using bioinformatics analysis software.

Test example 1

Clinical samples were tested using the method described in example 2 of the present invention.

As shown in FIGS. 9 and 10, the sample was found to be positive for CCDC6-RET fusion and positive for KRAS-G12D mutation.

Test example 2

Under the same sample and detection environment, the sensitivity data of the traditional double primers is compared with the sensitivity data of the universal + specific primers.

The difference between the sensitivity data of the traditional double primers and the sensitivity data of the traditional double primers is mainly that certain base errors are generated in the PCR process in the library construction process, the errors grow exponentially with the increase of the PCR cycle number, the background mutation of sequencing data is increased finally, and in order to effectively identify the real mutation originally existing in a sample, the positive judgment limit value must be increased so as to ensure sufficient detection specificity.

The method has the advantages that whether a plurality of reads are from the same original DNA template or not can be effectively identified through the random position of one end, and only one of the reads is reserved for the duplicate removal treatment of the original DNA template, so that background mutation can be effectively reduced, the positive judgment limit can be reduced, and the sensitivity can be improved.

The principle is shown in fig. 11. In the traditional double-ended primer amplicon library, the background mutation frequency is 0.3 and 0.4, and the real mutation frequency is 0.5, so that the background mutation and the real mutation cannot be effectively distinguished, and the sensitivity is low. According to the universal primer + specific primer library, duplication is removed according to random end positions, the background mutation frequency is 0.28, the real mutation frequency is 0.71, background mutation and real mutation are effectively distinguished, and the sensitivity is improved.

Through actual tests, the background mutation situation of each site and the finally determined positive judgment value are counted as shown in the following table 13.

Table 13 background mutation at each site and finally determined positive judgment value

Site of the body	Classical average background mutation frequency	Traditional positive judgment value	Mean background mutation frequency of the invention	Positive judgment value of the invention
					KRAS-G12D	2.32%	4%	0.61%	0.9%
NRAS-Q61	2.73%	4%	0.38%	0.6%
					HRAS-Q61	1.69%	3%	0.49%	0.7%
BRAF-V600	2.21%	4%	0.57%	0.7%

Wherein, for the KRAS-G12D point mutation standard, the conventional double-ended primer amplicon library is adopted for detection, and as shown in FIG. 12, the background mutation frequencies are 1.9% and 1.2%, respectively. The actual mutation frequency of KRAS-G12D is 2.6%, and in this context, KRAS-G12D mutation frequency of more than 4% is required to be judged as positive. The detection by the universal primer and the specific primer and the de-duplication effect according to the random end are carried out, as shown in figure 13, the background mutation frequencies are 0.6 percent and 0.3 percent respectively. The actual mutation frequency of KRAS-G12D is 2.2%, and in this context, KRAS G12D mutation frequency greater than 0.9% can be determined as positive.

Test example 3

Under the condition that other detection conditions are completely consistent, a comparison test of a perfect detection result cannot be obtained after one or two specific composite primers in the invention are replaced.

1. CCDC6-RET different specific primer comparison test

Specific primer 1:

GTGACTGGAGTTCAGACGTGCGCTCTTCCGATCCTTCCGAGGGAATTCCCACTTTGGATCC

other test primers:

GTGACTGGAGTTCAGACGTGCGCTCTTCCGATCTCTACCTTCCGGCAACGGAACTGGTGA

under the same conditions, two different primers were used for detection of CCDC6-RET positive samples. The results are shown in table 14 and fig. 14.

TABLE 14 detection results of two different primer pairs CCDC6-RET positive samples

	Depth of sequencing of CCDC6	Depth of RET sequencing	Positive judgment
				Specific primer
1	3722	6122	Positive for
				Other test primers	9	3555	Weak positive

The above results demonstrate that the other test primers are less sensitive to CCDC6-RET detection than specific primer 1.

2. KRAS G12D different specific primer comparison test

Specific primer 6:

GTGACTGGAGTTCAGACGTGCGCTCTTCCGATCAGCTGTATCGTCAAGGCACTCTTGCC

other test primers:

GTGACTGGAGTTCAGACGTGCGCTCTTCCGATCAGCATCGTCAAGGCACTCTTGCC

under the same condition, two different primer pairs KRAS G12D positive samples are detected. The results are shown in table 15 and fig. 15.

TABLE 15 test results for KRAS G12D positive samples with two different primer pairs

	Depth of KRAS sequencing	Positive judgment
			Specific primer
6	36429	Positive for
			Other test primers	1062	Negative of

The above results demonstrate that the other test primers have reduced sensitivity to detection of KRAS G12D compared to specific primer 6.

Test example 4

The method described in embodiment 2 of the invention is used for testing the capture effect of other sites. The mutation types, sample numbers and origins are shown in Table 16. The results are shown in FIGS. 16-22, and are all detectable.

TABLE 16 other site Capture Effect test

Type of mutation	Sample name/number	Sample source
			NCOA4-RET	19474	Clinical samples
PAX8/PPARγ	19753	Clinical samples
			BRAF(V600E)	BRAF p.V600E Reference Standard	Nanjing Kebai Bio
NRAS(61)	NRAS p.Q61H Reference Standard	Nanjing Kebai Bio
			KRAS(12,13)	KRAS p.G12D Reference Standard	Nanjing Kebai Bio
TERTp	19225 (wild type)	Clinical samples
			HRAS(61)	19387 (wild type)	Clinical samples
KRAS(61)	KRAS p.Q61H Reference Standard	Nanjing Kebai Bio

Finally, it should be noted that the above-mentioned contents are only used for illustrating the technical solutions of the present invention, and not for limiting the protection scope of the present invention, and that the simple modifications or equivalent substitutions of the technical solutions of the present invention by those of ordinary skill in the art can be made without departing from the spirit and scope of the technical solutions of the present invention.

Sequence listing

<110> Suzhou Kobe Biotechnology Ltd

<120> thyroid polygene joint detection kit

<160> 27

<170> SIPOSequenceListing 1.0

<210> 1

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gatcggaaga gccacatact ga 22

<210> 2

<211> 70

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

aatgatacgg cgaccaccga gatctacacc tctctataca ctctttccct acacgacgct 60

cttccgatct 70

<210> 3

<211> 70

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aatgatacgg cgaccaccga gatctacact atcctctaca ctctttccct acacgacgct 60

cttccgatct 70

<210> 4

<211> 70

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

aatgatacgg cgaccaccga gatctacacg taaggagaca ctctttccct acacgacgct 60

cttccgatct 70

<210> 5

<211> 70

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

aatgatacgg cgaccaccga gatctacaca ctgcataaca ctctttccct acacgacgct 60

cttccgatct 70

<210> 6

<211> 70

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

aatgatacgg cgaccaccga gatctacaca aggagtaaca ctctttccct acacgacgct 60

cttccgatct 70

<210> 7

<211> 70

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

aatgatacgg cgaccaccga gatctacacc taagcctaca ctctttccct acacgacgct 60

cttccgatct 70

<210> 8

<211> 70

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

aatgatacgg cgaccaccga gatctacacc gtctaataca ctctttccct acacgacgct 60

cttccgatct 70

<210> 9

<211> 70

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

aatgatacgg cgaccaccga gatctacact ctctccgaca ctctttccct acacgacgct 60

cttccgatct 70

<210> 10

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

aatgatacgg cgaccaccga gat 23

<210> 11

<211> 61

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gtgactggag ttcagacgtg cgctcttccg atccttccga gggaattccc actttggatc 60

c 61

<210> 12

<211> 61

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

gtgactggag ttcagacgtg cgctcttccg atcgggccag aatggcatct ctgtgtcaac 60

c 61

<210> 13

<211> 63

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

gtgactggag ttcagacgtg cgctcttccg atcctgttca aactgatggg acccactcca 60

tcg 63

<210> 14

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

gtgactggag ttcagacgtg cgctcttccg atcaccggaa gcaggtggtc attgatgg 58

<210> 15

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gtgactggag ttcagacgtg cgctcttccg atccctcatg tattggtctc tcatggcact 60

gt 62

<210> 16

<211> 59

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

gtgactggag ttcagacgtg cgctcttccg atcagctgta tcgtcaaggc actcttgcc 59

<210> 17

<211> 56

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

gtgactggag ttcagacgtg cgctcttccg atcaaagccc tccccagtcc tcatgt 56

<210> 18

<211> 59

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

gtgactggag ttcagacgtg cgctcttccg atcaggacgc agcgctgcct gaaactcgc 59

<210> 19

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

aatgatacgg cgaccaccg 19

<210> 20

<211> 53

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

caagcagaag acggcatacg agattcacaa gcgtgactgg agttcagacg tgt 53

<210> 21

<211> 53

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

caagcagaag acggcatacg agatactaca cggtgactgg agttcagacg tgt 53

<210> 22

<211> 53

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

caagcagaag acggcatacg agatatcgta cggtgactgg agttcagacg tgt 53

<210> 23

<211> 53

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

caagcagaag acggcatacg agatagacac aggtgactgg agttcagacg tgt 53

<210> 24

<211> 53

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

caagcagaag acggcatacg agatttgtcc tggtgactgg agttcagacg tgt 53

<210> 25

<211> 53

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

caagcagaag acggcatacg agattgtgag aggtgactgg agttcagacg tgt 53

<210> 26

<211> 53

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

caagcagaag acggcatacg agataaggtt gggtgactgg agttcagacg tgt 53

<210> 27

<211> 53

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

caagcagaag acggcatacg agatattagc cagtgactgg agttcagacg tgt 53

Claims (3)

1. The kit for the combined detection of multiple thyroid genes is characterized by comprising the following components in parts by weight:

(1) a group of specific composite primers for detecting fusion genes and point mutation, wherein the nucleotide sequence of the specific composite primers is shown as SEQ ID NO. 10-SEQ ID NO. 18;

(2) the special joint constructed by the DNA library is 8 dimers formed by a joint primer 1 and 8 different i5 end primers;

the nucleotide sequence of the joint primer 1 is shown as SEQ ID NO. 1;

the nucleotide sequences of the 8 different i5 end primers are shown as SEQ ID NO. 2-SEQ ID NO. 9;

(3) the nucleotide sequence of the library amplification composite primer is shown as SEQ ID NO. 19-SEQ ID NO. 27.

2. The kit for combined detection of multiple thyroid genes according to claim 1, wherein the kit further comprises any one or more of a reverse transcription reaction reagent set, a DNA fragmentation, end repair and base addition A reagent set, a DNA ligation reagent set, a PCR amplification reagent set or a high fidelity hot start PCR amplification reagent set.

3. The kit for combined detection of multiple thyroid genes according to claim 2, wherein the reagent set for reverse transcription reaction comprises a random primer, a first strand synthesis buffer solution, a first strand synthase mixture solution, a second strand synthesis buffer solution, a second strand synthase mixture solution and ultrapure water;

the DNA fragmentation, end repair and base A reagent group comprises 10 multiplied by DNA fragmentation buffer solution, 5 multiplied by fragmentation enzyme mixed solution and ultrapure water;

the DNA ligation reagent group comprises 5 Xligase buffer solution, TIANSeq DNA ligase, a special joint and ultrapure water;

the PCR amplification reagent group comprises 5 multiplied PCR reaction enzyme mixed liquor, PCR primers and ultrapure water;

the high-fidelity hot-start PCR amplification reagent group comprises high-fidelity hot-start enzyme reaction liquid and ultrapure water.

Images