CN112280854A - HLA single SNP detection kit and detection method - Google Patents
HLA single SNP detection kit and detection method Download PDFInfo
- Publication number
- CN112280854A CN112280854A CN202011316665.5A CN202011316665A CN112280854A CN 112280854 A CN112280854 A CN 112280854A CN 202011316665 A CN202011316665 A CN 202011316665A CN 112280854 A CN112280854 A CN 112280854A
- Authority
- CN
- China
- Prior art keywords
- nucleotide sequence
- probe
- primer
- hla
- snp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 238000001514 detection method Methods 0.000 title claims abstract description 52
- 239000000523 sample Substances 0.000 claims abstract description 68
- 230000003321 amplification Effects 0.000 claims abstract description 7
- 238000003199 nucleic acid amplification method Methods 0.000 claims abstract description 7
- 108700028369 Alleles Proteins 0.000 claims abstract description 6
- 238000012408 PCR amplification Methods 0.000 claims abstract description 6
- 239000002773 nucleotide Substances 0.000 claims description 61
- 125000003729 nucleotide group Chemical group 0.000 claims description 61
- 230000035945 sensitivity Effects 0.000 abstract description 7
- 238000000034 method Methods 0.000 description 6
- 238000011134 hematopoietic stem cell transplantation Methods 0.000 description 5
- 108700018351 Major Histocompatibility Complex Proteins 0.000 description 4
- 230000015572 biosynthetic process Effects 0.000 description 4
- 230000020382 suppression by virus of host antigen processing and presentation of peptide antigen via MHC class I Effects 0.000 description 4
- 238000003786 synthesis reaction Methods 0.000 description 4
- 238000006243 chemical reaction Methods 0.000 description 3
- 108090000623 proteins and genes Proteins 0.000 description 3
- 238000012163 sequencing technique Methods 0.000 description 3
- 239000000427 antigen Substances 0.000 description 2
- 108091007433 antigens Proteins 0.000 description 2
- 102000036639 antigens Human genes 0.000 description 2
- 239000000539 dimer Substances 0.000 description 2
- 210000003958 hematopoietic stem cell Anatomy 0.000 description 2
- 210000000265 leukocyte Anatomy 0.000 description 2
- 239000000463 material Substances 0.000 description 2
- 238000002054 transplantation Methods 0.000 description 2
- 238000007400 DNA extraction Methods 0.000 description 1
- 208000035965 Postoperative Complications Diseases 0.000 description 1
- 230000000295 complement effect Effects 0.000 description 1
- 238000004090 dissolution Methods 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 238000001506 fluorescence spectroscopy Methods 0.000 description 1
- 230000007614 genetic variation Effects 0.000 description 1
- 238000003205 genotyping method Methods 0.000 description 1
- 230000002489 hematologic effect Effects 0.000 description 1
- 210000003917 human chromosome Anatomy 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 102000054765 polymorphisms of proteins Human genes 0.000 description 1
- 238000010791 quenching Methods 0.000 description 1
- 230000000171 quenching effect Effects 0.000 description 1
- 210000000130 stem cell Anatomy 0.000 description 1
- 238000002560 therapeutic procedure Methods 0.000 description 1
- 238000011144 upstream manufacturing Methods 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention discloses an SNP detection kit and a detection method of HLA. The SNP detection kit of the HLA comprises a first primer, a second primer, a first probe and a second probe; the SNP detection method of the HLA comprises the following steps: and obtaining the genome DNA of a sample to be detected, performing fluorescence PCR amplification by using the first primer, the second primer, the first probe and the second probe and taking the genome DNA as a template, and collecting and analyzing a fluorescence signal so as to obtain the ratio of the amplification amount of one SNP allele of the HLA. The SNP detection kit and the detection method of the HLA improve the accuracy and the sensitivity of detecting one SNP of the HLA.
Description
Technical Field
The invention relates to the field of molecular biology, in particular to an SNP detection kit for HLA and an SNP detection method for HLA.
Background
Human Leukocyte Antigen (HLA) mismatches between the patient's HLA and the non-parental donor hematopoietic stem cells result in life-threatening transplantation of the non-parental donor hematopoietic stem cells, which consequently limits the widespread use of hematopoietic stem cell transplantation in the field of hematological therapies. Studies have shown that such HLA mismatches may be associated with genetic variation in highly polymorphic Major Histocompatibility Complex (MHC). Subsequently, researchers found Single Nucleotide Polymorphisms (SNPs) in this MHC, which were further identified as determinants affecting the post-hematopoietic stem cell transplantation efficacy. That is, the mismatch of the patient's SNP and the donor's SNP increases the risk of death after the patient receives hematopoietic stem cell transplantation from a non-relatives donor. Moreover, the risk of mortality after a patient receiving hematopoietic stem cell transplantation from a non-parental donor increases with the number of mismatched SNPs. Therefore, knowing the SNP content of HLA helps to assess the risk of transplantation before hematopoietic stem cell transplantation from a non-parental donor; and non-relatives donor stem cells which are matched with MHC more can be reasonably selected according to the content of SNP so as to reduce postoperative complications.
The HLA rs107822 SNP is the SNP site of a biallelic polymorphism on human chromosome chr6:33207798(grch38.p12), whose variation is the switch of T or C (a or G on its complementary strand). The genotype of the rs107822 SNP is TT, TC (CT) or CC. The TT is a homozygote of the double-stranded rs107822 SNP sites which are all T, the CC is a homozygote of the double-stranded rs107822 SNP sites which are all C, and the TC (CT) is a heterozygote of the site of one rs107822 SNP chain which is T and the site of the other rs107822 SNP chain which is C.
Currently, clinically applied SNP (single nucleotide polymorphism) methods for detecting HLA (human leukocyte antigen) comprise a direct sequencing method, a PCR-gene chip method and a PCR-dissolution curve method, and the three detection methods have lower accuracy and sensitivity.
The above is only for the purpose of assisting understanding of the technical solutions of the present invention, and does not represent an admission that the above is the prior art.
Disclosure of Invention
The invention mainly aims to provide an HLA SNP detection kit and an HLA SNP detection method, and aims to improve the accuracy and sensitivity of HLA rs107822 SNP detection.
In order to achieve the above object, in a first aspect, the present invention provides an SNP detection kit for HLA, including:
the nucleotide sequence of the primer I is shown as SEQ ID No. 1;
the nucleotide sequence of the primer II is shown as SEQ ID No. 2;
the probe I comprises a nucleotide sequence I shown as SEQ ID No.3 and fluorescent groups respectively connected with the 5 'end and the 3' end of the nucleotide sequence I; and
and the probe II comprises a nucleotide sequence II shown as SEQ ID No.4 and fluorescent groups respectively connected with the 5 'end and the 3' end of the nucleotide sequence II.
Optionally, the 5 'end of the first nucleotide sequence is connected with FAM fluorophore, and the 3' end of the first nucleotide sequence is connected with NFQ-MGB fluorophore; the 5 'end of the second nucleotide sequence is connected with a VIC fluorescent group, and the 3' end of the second nucleotide sequence is connected with an NFQ-MGB fluorescent group.
In a second aspect, the present invention further provides a method for detecting an SNP in an HLA, comprising the steps of:
(1) obtaining the genome DNA of a sample to be detected;
(2) performing fluorescence PCR amplification by using the first primer, the second primer, the first probe and the second probe and taking the genomic DNA as a template, and collecting a fluorescence signal;
(3) analyzing the intensity of the fluorescence signal to obtain the ratio of the amplification amount of one SNP allele of the HLA;
wherein the nucleotide sequence of the primer I is shown as SEQ ID No. 1; the nucleotide sequence of the primer II is shown as SEQ ID No. 2; the probe I comprises a nucleotide sequence I shown as SEQ ID No.3 and fluorescent groups which are respectively connected with the 5 'end and the 3' end of the nucleotide sequence I; the probe II comprises a nucleotide sequence II shown as SEQ ID No.4 and fluorescent groups which are respectively connected with the 5 'end and the 3' end of the nucleotide sequence II.
Optionally, the 5 'end of the first nucleotide sequence is connected with FAM fluorophore, and the 3' end of the first nucleotide sequence is connected with NFQ-MGB fluorophore; the 5 'end of the second nucleotide sequence is connected with a VIC fluorescent group, and the 3' end of the second nucleotide sequence is connected with an NFQ-MGB fluorescent group.
The SNP detection kit of the HLA comprises a first specific primer, a second specific primer, a first probe and a second probe; the SNP detection method of the HLA obtains the genome DNA of a sample to be detected, utilizes the first primer, the second primer, the first probe and the second probe, takes the genome DNA as a template to carry out fluorescence PCR amplification, collects and analyzes a fluorescence signal, thereby obtaining the ratio of the amplification amount of one SNP allele of the HLA. Specifically amplifying the sequence of the rs107822 SNP by the first primer and the second primer respectively, wherein the first probe specifically detects one single copy of the rs107822 SNP, and the second probe specifically detects the other single copy of the rs107822 SNP; thus, the accuracy and sensitivity of detection are improved. Moreover, the detection kit and the detection method are simple to operate, greatly shorten the detection time, save a large amount of manpower and material resources, and have wide clinical application value.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only some embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the structures shown in the drawings without creative efforts.
FIG. 1 is a graph showing the results of the first embodiment;
FIG. 2 is a graph showing the results of the second embodiment.
The implementation, functional features and advantages of the objects of the present invention will be further explained with reference to the accompanying drawings.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
The invention provides an SNP detection kit of HLA, which comprises a primer I, a primer II, a probe I and a probe II, wherein the nucleotide sequence of the primer I is shown as SEQ ID No. 1; the nucleotide sequence of the primer di is shown as SEQ ID No. 2; the probe I comprises a nucleotide sequence I shown as SEQ ID No.3 and fluorescent groups which are respectively connected with the 5 'end and the 3' end of the nucleotide sequence I; the probe II comprises a nucleotide sequence II shown as SEQ ID No.4 and fluorescent groups which are respectively connected with the 5 'end and the 3' end of the nucleotide sequence II.
In the present invention, the sequences of the first Primer, the second Primer, the first probe and the second probe are designed by using a Primer design software (e.g., Primer Premier 5) with the rs107822 SNP sequence of HLA as a template. The sequences of the primer I, the primer II, the probe I and the probe II are shown in Table 1. The Tm values of the first primer and the second primer are both around 60 ℃, so that the generation of primer dimers is avoided as much as possible; the Tm values of the first probe and the second probe are both around 70 ℃, so that the combination between the first probe and the second probe and other non-specific sequences is avoided as much as possible, and the complex dimer between the first probe and the second probe is also avoided; thus, the amplification specificity of fluorescent PCR is improved.
The first primer is an upstream primer for amplifying the rs107822 SNP sequence, and the second primer is a downstream primer for amplifying the rs107822 SNP sequence. The twelfth base from the 5 'end to the 3' end of the probe I is C (underlined), the twelfth base from the 5 'end to the 3' end of the probe II is T (underlined), and therefore the three genotypes TT, TC (CT) and CC of the rs107822 SNP are detected.
TABLE 1 sequences of primer one, primer two, Probe one, and Probe two
| Sequence name | Tm | Sequence (5 '-3') |
| SEQ ID No.1 | 58.4℃ | CATCTTGTGTATGTCCCTGTTTCC |
| SEQ ID No.2 | 61.1℃ | AGAATTGCGTTTGGACAATCAGG |
| SEQ ID No.3 | 69℃ | CGTGGTGTCTCCATTC |
| SEQ ID No.4 | 69℃ | CGTGGTGTCTCTATTC |
Optionally, the 5 'end of the first nucleotide sequence is connected with FAM fluorophore, and the 3' end of the first nucleotide sequence is connected with NFQ-MGB fluorophore; the 5 'end of the second nucleotide sequence is connected with a VIC fluorescent group, and the 3' end of the second nucleotide sequence is connected with an NFQ-MGB fluorescent group. Namely, the 5 'end of the probe I is connected with a FAM fluorescent group, and the 3' end of the probe I is connected with an NFQ-MGB fluorescent group; and the 5 'end of the probe II is connected with a VIC fluorescent group, and the 3' end of the probe II is connected with an NFQ-MGB fluorescent group. Compared with the common TaqMan probe, the MGB probe is a non-fluorescence quenching group, can greatly reduce the background signal intensity and has higher specificity.
In a second aspect, the present invention further provides a method for detecting an SNP in an HLA, comprising the steps of:
(1) obtaining genome DNA of a sample to be detected;
(2) performing fluorescence PCR amplification by using the first primer, the second primer, the first probe and the second probe and taking the genomic DNA as a template, and collecting a fluorescence signal;
(3) analyzing the intensity of the fluorescence signal to obtain the ratio of the amplification amount of one SNP allele of the HLA;
wherein the nucleotide sequence of the primer I is shown as SEQ ID No. 1; the nucleotide sequence of the primer II is shown as SEQ ID No. 2; the probe I comprises a nucleotide sequence I shown as SEQ ID No.3 and fluorescent groups which are respectively connected with the 5 'end and the 3' end of the nucleotide sequence I; the probe II comprises a nucleotide sequence II shown as SEQ ID No.4 and fluorescent groups which are respectively connected with the 5 'end and the 3' end of the nucleotide sequence II.
Optionally, the 5 'end of the first nucleotide sequence is connected with FAM fluorophore, and the 3' end of the first nucleotide sequence is connected with NFQ-MGB fluorophore; the 5 'end of the second nucleotide sequence is connected with a VIC fluorescent group, and the 3' end of the second nucleotide sequence is connected with an NFQ-MGB fluorescent group.
The information of the primer I, the primer II, the probe I and the probe II is introduced above and is not repeated herein.
The specific steps for detecting rs107822 SNP of HLA are as follows:
1) DNA extraction kits (e.g., Qiagen, cat no: 69506) Extracting DNA of a sample to be detected according to the kit instruction;
2) preparing a fluorescent PCR reaction solution according to a fluorescent PCR detection system in the table 2, and then carrying out a fluorescent PCR reaction in a fluorescent PCR instrument according to a fluorescent PCR reaction program in the table 3;
3) and collecting fluorescence information detected by the fluorescence PCR instrument, and analyzing fluorescence data by using a gene typing professional analysis software TaqMan Genotyper developed by American applied biology technology company to obtain a gene typing result of the rs107822 SNP of the HLA.
TABLE 2 fluorescent PCR detection System
TABLE 3 fluorescent PCR reaction procedure
The SNP detection kit of the HLA comprises a first specific primer, a second specific primer, a first probe and a second probe; the SNP detection method of the HLA obtains the genome DNA of a sample to be detected, utilizes the first primer, the second primer, the first probe and the second probe, takes the genome DNA as a template to carry out fluorescence PCR amplification, collects and analyzes a fluorescence signal, thereby obtaining the ratio of the amplification amount of one SNP allele of the HLA. Specifically amplifying the sequence of the rs107822 SNP by the first primer and the second primer respectively, wherein the first probe specifically detects one single copy of the rs107822 SNP, and the second probe specifically detects the other single copy of the rs107822 SNP; thus, the accuracy and sensitivity of detection are improved. Moreover, the detection kit and the detection method are simple to operate, greatly shorten the detection time, save a large amount of manpower and material resources, and have wide clinical application value.
Example one
The invention adopts 47 DNA samples of rs107822 SNP genotype of known HLA to verify the accuracy of the detection kit and the detection method. Referring to FIG. 1, the upper left area (black circle) in FIG. 1 is the result of CC-type homozygous samples; the middle region (light gray circle) in FIG. 1 is the result of a TC (CT) -type heterozygous sample; the lower right region (dark grey circles) in FIG. 1 is the result for TT-type homozygous subsamples; the lower left area (black squares) in figure 1 is the result of the blank control. In this embodiment, 47 DNA samples are subjected to first-generation sequencing, and experimental results show that the detection results of the present invention and the first-generation sequencing are consistent with known results, which indicates that the accuracy and specificity of the rs107822 SNP genotyping for detecting HLA of the present invention are high.
Example two
The invention further takes 5 clinical DNA samples of rs107822 SNP genotype of known HLA as templates to detect the detection sensitivity of the detection kit and the detection method. The sample adding amount of 5 clinical DNA samples is close to the lower limit of clinical detection and is 20 ng; the detection time is according to clinical detection standard, and the detection is continuously carried out for 5 days.
Referring to FIG. 2, the middle region (black circle) in FIG. 2 shows the result of the TC (CT) -type heterozygous sample; the lower left area (light grey squares) in figure 2 is the result of the blank control. The detection result of the invention is consistent with the known result, the template amount used in the detection of the invention is 20ng, which is close to the lower limit of clinical detection, and the detection method of the invention has higher sensitivity.
The above description is only a preferred embodiment of the present invention, and is not intended to limit the scope of the present invention, and all modifications and equivalents of the present invention, which are made by the contents of the present specification and the accompanying drawings, or directly/indirectly applied to other related technical fields, are included in the scope of the present invention.
SEQUENCE LISTING
<110> Shanghai Mitsuo Beiken Biotech Co., Ltd
SHANGHAI TISSUEBANK MEDICAL INSPECTION Co.,Ltd.
SHENZHEN TISSUEBANK PRECISION MEDICINE Co.,Ltd.
Shanghai Ding Shuo Beiken Gene science and technology Co., Ltd
SNP detection kit and detection method for <120> HLA
<130>
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 24
<212> DNA
<213> Artificial Synthesis
<400> 1
catcttgtgt atgtccctgt ttcc 24
<210> 2
<211> 23
<212> DNA
<213> Artificial Synthesis
<400> 2
agaattgcgt ttggacaatc agg 23
<210> 3
<211> 16
<212> DNA
<213> Artificial Synthesis
<400> 3
cgtggtgtct ccattc 16
<210> 4
<211> 16
<212> DNA
<213> Artificial Synthesis
<400> 4
cgtggtgtct ctattc 16
Claims (4)
1. An SNP detection kit for HLA comprising:
the nucleotide sequence of the primer I is shown as SEQ ID No. 1;
the nucleotide sequence of the primer II is shown as SEQ ID No. 2;
the probe I comprises a nucleotide sequence I shown as SEQ ID No.3 and fluorescent groups respectively connected with the 5 'end and the 3' end of the nucleotide sequence I; and
and the probe II comprises a nucleotide sequence II shown as SEQ ID No.4 and fluorescent groups respectively connected with the 5 'end and the 3' end of the nucleotide sequence II.
2. An SNP detection kit according to claim 1 for HLA, characterized in that the first nucleotide sequence has its 5 'end linked to FAM fluorophore and its 3' end linked to NFQ-MGB fluorophore; the 5 'end of the second nucleotide sequence is connected with a VIC fluorescent group, and the 3' end of the second nucleotide sequence is connected with an NFQ-MGB fluorescent group.
3. An SNP detection method for HLA, comprising the steps of:
(1) obtaining the genome DNA of a sample to be detected;
(2) performing fluorescence PCR amplification by using the first primer, the second primer, the first probe and the second probe and taking the genomic DNA as a template, and collecting a fluorescence signal;
(3) analyzing the intensity of the fluorescence signal to obtain the ratio of the amplification amount of one SNP allele of the HLA;
wherein the nucleotide sequence of the primer I is shown as SEQ ID No. 1; the nucleotide sequence of the primer II is shown as SEQ ID No. 2; the probe I comprises a nucleotide sequence I shown as SEQ ID No.3 and fluorescent groups which are respectively connected with the 5 'end and the 3' end of the nucleotide sequence I; the probe II comprises a nucleotide sequence II shown as SEQ ID No.4 and fluorescent groups which are respectively connected with the 5 'end and the 3' end of the nucleotide sequence II.
4. A SNP detection method for HLA as claimed in claim 3, wherein the 5 'end of said first nucleotide sequence is linked to FAM fluorophore and the 3' end of said first nucleotide sequence is linked to NFQ-MGB fluorophore; the 5 'end of the second nucleotide sequence is connected with a VIC fluorescent group, and the 3' end of the second nucleotide sequence is connected with an NFQ-MGB fluorescent group.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011316665.5A CN112280854A (en) | 2020-11-20 | 2020-11-20 | HLA single SNP detection kit and detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011316665.5A CN112280854A (en) | 2020-11-20 | 2020-11-20 | HLA single SNP detection kit and detection method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112280854A true CN112280854A (en) | 2021-01-29 |
Family
ID=74398745
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011316665.5A Pending CN112280854A (en) | 2020-11-20 | 2020-11-20 | HLA single SNP detection kit and detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112280854A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050266432A1 (en) * | 2004-02-26 | 2005-12-01 | Illumina, Inc. | Haplotype markers for diagnosing susceptibility to immunological conditions |
| CN106520971A (en) * | 2016-11-25 | 2017-03-22 | 武汉海吉力生物科技有限公司 | Nucleic acid, kit and method for quickly detecting HLA-B*1502 alleles |
| CN106636370A (en) * | 2016-11-30 | 2017-05-10 | 武汉海吉力生物科技有限公司 | Nucleic acid, kit and method for detecting human HLA-B*5701 allele |
| CN106947807A (en) * | 2017-03-01 | 2017-07-14 | 上海荻硕贝肯医学检验所有限公司 | Primer, probe, kit and method for detecting mankind's ALDH2 gene pleiomorphisms |
-
2020
- 2020-11-20 CN CN202011316665.5A patent/CN112280854A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050266432A1 (en) * | 2004-02-26 | 2005-12-01 | Illumina, Inc. | Haplotype markers for diagnosing susceptibility to immunological conditions |
| CN106520971A (en) * | 2016-11-25 | 2017-03-22 | 武汉海吉力生物科技有限公司 | Nucleic acid, kit and method for quickly detecting HLA-B*1502 alleles |
| CN106636370A (en) * | 2016-11-30 | 2017-05-10 | 武汉海吉力生物科技有限公司 | Nucleic acid, kit and method for detecting human HLA-B*5701 allele |
| CN106947807A (en) * | 2017-03-01 | 2017-07-14 | 上海荻硕贝肯医学检验所有限公司 | Primer, probe, kit and method for detecting mankind's ALDH2 gene pleiomorphisms |
Non-Patent Citations (1)
| Title |
|---|
| CHEN, DING-PING等: "Single nucleotide polymorphisms within HLA region are associated with disease relapse for patients with unrelated cord blood transplantation", PEERJ, pages 3 - 4 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110029178B (en) | SNP molecular marker related to single-fetus and multiple-lamb characters of sheep, detection primer group, detection kit and application thereof | |
| CN110317880B (en) | Molecular marker related to pig feed conversion rate, identification and application thereof | |
| CN107988385B (en) | Method for detecting marker of PLAG1 gene Indel of beef cattle and special kit thereof | |
| CN108359733B (en) | Method for auxiliary detection of 100kg backfat thickness of pig | |
| CN101818195A (en) | Genetic marker by taking pig miR-27a precursor flanking sequence SNP as trait of litter size of pig and application | |
| CN107937493B (en) | Hairpin modified primer for allele PCR | |
| CN108441547B (en) | Primer group, kit and method for HLA gene amplification and genotyping | |
| CN114317780B (en) | SNP molecular marker related to chicken prematurity and application | |
| CN116377082A (en) | Application of sheep LCORL gene single nucleotide polymorphism marker in growth trait selection | |
| CN114317776B (en) | Molecular marker combination related to duck egg laying characteristics, obtaining method and application | |
| CN113373241B (en) | Microsatellite marker of fishes in loach, and amplification primer and application thereof | |
| CN112280854A (en) | HLA single SNP detection kit and detection method | |
| CN112280844A (en) | HLA single SNP detection kit and detection method | |
| CN112280843A (en) | HLA single SNP detection kit and detection method | |
| CN114606335A (en) | Development and application of KASP molecular marker of sugarcane mosaic virus disease resistance gene of corn | |
| CN112280835A (en) | HLA single SNP detection kit and detection method | |
| CN112280837A (en) | HLA single SNP detection kit and detection method | |
| CN112280836A (en) | HLA single SNP detection kit and detection method | |
| CN112280855A (en) | HLA single SNP detection kit and detection method | |
| CN112410412A (en) | HLA single SNP detection kit and detection method | |
| CN112322752A (en) | HLA single SNP detection kit and detection method | |
| CN112410411A (en) | HLA single SNP detection kit and detection method | |
| CN110438245B (en) | SNP (single nucleotide polymorphism) marker of clam and application thereof | |
| CN108950014B (en) | SNP marker related to high altitude adaptability of Chinese domestic horses and application | |
| CN111363843A (en) | PCR/LDR molecular marker and method for identifying genotype of nitrate transporter gene NRT1.1B of rice |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |