CN112266954B - Application of miR-125b-2-3p in renal fibrosis - Google Patents
Application of miR-125b-2-3p in renal fibrosis Download PDFInfo
- Publication number
- CN112266954B CN112266954B CN202011143938.0A CN202011143938A CN112266954B CN 112266954 B CN112266954 B CN 112266954B CN 202011143938 A CN202011143938 A CN 202011143938A CN 112266954 B CN112266954 B CN 112266954B
- Authority
- CN
- China
- Prior art keywords
- mir
- renal fibrosis
- seq
- cells
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/12—Drugs for disorders of the urinary system of the kidneys
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Abstract
The invention discloses application of miR-125b-2-3p in preparation of a product for diagnosing, preventing and/or treating renal fibrosis. The method for detecting the renal fibrosis by using the miR-125b-2-3p marker can quickly and effectively realize early detection, and provides a treatment target and an important basis for clinical application of gene therapy, drug therapy and the like. The invention provides a method for preparing a pharmaceutical composition for preventing and/or treating renal fibrosis by using miR-125b-2-3p, wherein miR-125b-2-3p or a mimic thereof in the pharmaceutical composition can promote E-cadherin expression and inhibit Vimentin expression, and is beneficial to relieving and/or treating renal fibrosis.
Description
Technical Field
The invention relates to the field of biomedicine, in particular to application of miR-125b-2-3p in renal fibrosis.
Background
Chronic kidney disease is a common disease that seriously threatens human health. Renal Fibrosis (RF) is one of the major pathological features of chronic kidney disease, and is the progressive process of kidney function from healthy to impaired function and then to impaired function until loss of function. Renal fibrosis is primarily characterized by pathological deposition of fibrous matrix in the area between the renal tubules and peritubular capillaries. Under pathological conditions, tubular Epithelial cells can differentiate into Mesenchymal cells and activated fibroblasts, eventually forming myofibroblasts, a process known as Epithelial-Mesenchymal Transition (EMT). The kidney is stimulated by various pathogenic factors such as trauma, infection, inflammation, blood circulation disorder, immune reaction and the like, so that the inherent cells of the kidney are damaged, and a large amount of collagen deposition and accumulation appear in the later stage, so that the kidney is gradually hardened to form scars until the kidney completely loses the function of the viscera.
The mechanism of renal fibrosis is complex and is associated with a variety of factors, mainly the proliferation and activation of extracellular matrix cell producing cells, imbalance of vasoactive substances, cytokines and extracellular matrix turnover, and renal interstitial fibrosis is almost a common pathway for the progression of all primary or secondary renal diseases to end-stage renal failure. The degree of renal fibrosis is closely related to the patient prognosis. With the progressive decline of renal function in clinical practice, renal fibrosis is pathologically divided into an inflammatory reaction phase, a fibrosis formation phase and a scarring phase. The inflammatory reaction phase and the fibrosis formation phase are reversible phases, and if diagnosis and intervention can be performed on patients with renal function impairment as early as possible in the reversible phases, the diagnosis and intervention has important significance for slowing and reversing the progress of chronic nephropathy, improving renal function, guiding clinical treatment and improving the life quality of nephropathy patients.
miRNA (microRNA) is a non-coding small molecular RNA with the length of 20-25 nucleotides, and relates to various biological processes, including regulation of development opportunity, apoptosis, fat metabolism, hematopoietic cell differentiation and the like, and regulation and control of cell differentiation, proliferation and apoptosis by influencing the stability of target genes or inhibiting the translation transcription level of the target genes. miRNA is widely expressed in various tissues and organs of human body and plays a wide role in the pathophysiological process of organism; meanwhile, the miRNA has remarkable tissue specificity, and the expression intensity of the miRNA in different tissues and organs is quite different.
Research shows that the misexpression of miRNA in cells can cause the occurrence of various diseases including renal fibrosis, and miRNA has definite specific expression in the process of renal interstitial fibrosis caused by various reasons, thus providing good prospect and platform for the research of renal fibrosis mechanism and providing new thought for the target of renal fibrosis treatment. Some miRNAs are abnormally expressed in the kidney and urine of patients with renal fibrosis, and the miRNAs are suggested to be related to the occurrence and development of the renal fibrosis. Therefore, miRNA related to the occurrence and development of renal fibrosis is searched, and an effective means for clinically diagnosing and treating renal fibrosis can be provided.
Disclosure of Invention
In order to find miRNA related to the generation and development of renal fibrosis, the first aim of the invention is to provide application of miR-125b-2-3p in preparation of products for diagnosing, preventing and/or treating renal fibrosis.
The second object of the present invention is to provide a diagnostic kit for detecting renal fibrosis.
The third purpose of the invention is to provide a pharmaceutical composition for treating renal fibrosis.
In order to achieve the purpose, the specific technical scheme of the invention is as follows:
the invention firstly provides application of miR-125b-2-3p in preparation of a product for diagnosing, preventing and/or treating renal fibrosis.
In some embodiments, the miR-125b-2-3p is down-regulated in expression levels in a cell line with renal fibrosis as compared to a cell line without renal fibrosis.
In some embodiments, the miR-125b-2-3p promotes expression of E-cadherin protein, inhibits Vimentin protein expression, and thereby inhibits EMT pathway initiation of renal fibrosis.
E-cadherin is an important member of the cadherin family of cell adhesion molecules, which plays an important role in maintaining cell-cell adhesion, cell polarity and cell-cell information transfer. Its reduced or absent expression is the most prominent feature of EMT.
Vimentin, a major member of the intermediate filament protein family, is expressed in almost all normal mesenchymal cells and plays an important role in maintaining cellular integrity and resisting external stress. Is a significant marker of EMT.
In some embodiments, the product comprises a kit, reagent, or pharmaceutical composition.
Further, the invention provides a diagnostic kit for detecting renal fibrosis, which comprises primers and instructions for specifically amplifying miR-125b-2-3p related to renal fibrosis.
In some embodiments, the primers include reverse transcription primers of SEQ ID NO. 3 and cDNA amplification primer pairs of SEQ ID NO. 4 and SEQ ID NO. 5, respectively.
In some embodiments, the kit further comprises 10 x Buffer, dNTP, MgCl 2 Taq enzyme and SYBR Green fluorescent dyes.
Further, the invention also provides a pharmaceutical composition for treating renal fibrosis, which comprises miR-125b-2-3p or a mimic thereof and a pharmaceutically acceptable auxiliary material.
In some embodiments, the miR-125b-2-3p or its mimetic includes a nucleotide sequence identical to SEQ ID NO:1 or SEQ ID NO:2 and its various variant forms having the biological activity of the miR-125b-2-3 p.
In some embodiments, the use of miR-125b-2-3p or a mimetic thereof for the preparation of a pharmaceutical composition for the prevention and/or treatment of renal fibrosis.
In some embodiments, the miR-125b-2-3p or a mimic thereof comprises a nucleotide sequence identical to SEQ ID NO:1 or SEQ ID NO:2 and various variant forms thereof having the biological activity of the miR-125b-2-3 p.
Based on the technical scheme, the invention has the following beneficial effects:
the method for detecting the renal fibrosis by using the miR-125b-2-3p marker can quickly and effectively realize early detection, and provides a treatment target and an important basis for clinical application of gene therapy, drug therapy and the like. The invention also provides a diagnostic kit for preparing and detecting renal fibrosis by using the miR-125b-2-3p, which can be used for diagnosing the renal fibrosis related to the miR-125b-2-3p, thereby providing a basis for pertinently treating the disease. The invention provides application of miR-125b-2-3p in preparing a pharmaceutical composition for preventing and/or treating renal fibrosis, wherein miR-125b-2-3p or a mimic thereof in the drug can promote E-cadherin expression and inhibit Vimentin expression, and is beneficial to relieving and/or treating renal fibrosis.
Drawings
FIG. 1 is a significant reduction in the relative expression of miR-125b-2-3p from renal fibrotic HK-2 cells in a model of EMT cells induced by TGF (transforming growth factor) - β, as compared to normal control HK-2 cells;
FIG. 2A shows that kidney tissue cells of control (Ctrl) mice without UOO treatment have typical cobblestone-like morphological features and are tightly engaged; UOO treated mouse unilateral kidney histiocyte shows spindle shape, obvious intercellular space, thin cell, and similar to fibroblast shape; FIG. 2B shows that relative expression level of miR-125B-2-3p in rat tissues of renal fibrosis model is significantly reduced compared to control rats;
FIG. 3 shows that in HK-2 cells transfected with miR-125b-2-3p imic, E-cadherin expression is significantly increased compared to control (Ctrl) cells, Vimentin expression is significantly decreased compared to control (Ctrl) cells, and tubulin expression not associated with renal fibrosis is not significantly changed.
Detailed Description
The following examples are intended to illustrate the invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.
The inventor of the invention finds that miR-125b-2-3p is remarkably reduced in content in kidney tissues or kidney cells of renal fibrosis subjects such as human (Homo sapiens) or rats (Rattus norvegicus) in related research on renal fibrosis. Furthermore, the inventor discovers that miR-125b-2-3p imimic can promote the expression of E-cadherin and inhibit the expression of Vimentin by transfecting the miR-125b-2-3p imimic into renal fibrosis HK-2 cells, thereby being beneficial to relieving and/or treating renal fibrosis of a renal fibrosis subject or patient. miR-125b-2-3p is proved to be a marker remarkably related to renal fibrosis.
In the present invention, the term "miR-125 b-2-3 p" refers to miRNA comprising the sequence shown in SEQ ID NO:1(has-miR-125b-2-3p, UCACAAGUCAGGCUCUUGGGAC) or SEQ ID NO:2(rno-miR-125b-2-3p, ACAAGUCAGGCUCUUGGGACCU) or a homologous sequence thereof, for example, miR-125b-2-3p from various sources known in the art, such as human, mouse, rabbit, etc.
The miR-125b-2-3p also comprises a miR-125b-2-3p derivative which still has the biological activity of miR-125b-2-3p after the naturally-existing miR-125b-2-3p sequence is substituted, deleted or added with one or more nucleotides or is biologically modified.
The miR-125b-2-3p also comprises a miR-125b-2-3p analogue with miR-125b-2-3p biological activity, which is artificially synthesized and can be obtained by purchasing a commercial product.
In addition, the miR-125b-2-3p can also be in a precursor form, and the miR-125b-2-3p precursor refers to a precursor which can be processed into miR-125b-2-3p in cells or bodies of a subject to be administered. Methods for obtaining naturally occurring miR-125b-2-3p precursors are well known to those skilled in the art.
As is well known to those skilled in the art, the initial transcript of miR-125b-2-3p undergoes a series of processing to form mature miR-125b-2-3 p. The miR-125b-2-3p precursor has a corresponding biological function only after being processed into mature miR-125b-2-3 p.
Example 1 relative expression Down-Regulation of miR-125b-2-3p in renal fibrotic cells
Epithelial-mesenchymal transition (EMT) refers to mesenchymal transition between epithelial cells and is part of the process of renal fibrosis. Induction of EMT cell model: adopting human tubular epithelial cell line HK-2 cells, adding TGF (transforming growth factor) -beta into HK-2 cell culture solution to a final concentration of 10ng/mL, culturing for 72h, collecting cells, and photographing, observing and detecting miR-125b-2-3 p.
The specific operation is as follows:
extraction of miRNA
The control (Ctrl) group HK-2 cells that did not develop renal fibrosis and the renal fibrosis (EMT) cells of the induced EMT cell model were collected separately. Using a miRNA extraction kit from Tiangen, 1ml of lysate was added to 50mg of cell samples, and the mixture was shaken and mixed by a shaker for 30 seconds. After standing at room temperature for 5min, centrifuging at 12,000rpm for 10min, collecting the supernatant, adding 200 μ l chloroform, shaking vigorously for 15 s, standing at room temperature for 5min, centrifuging at 12,000rpm for 15min, and separating the sample into three layers: yellow organic phase, intermediate layer and colorless aqueous phase, wherein RNA is mainly in the aqueous phase, transferring the aqueous phase into a new tube, slowly adding anhydrous ethanol with the volume of 1/3 volumes of the transfer solution, mixing, transferring into an adsorption column, standing at room temperature for 2min, centrifuging at 12,000rpm for 30s, and retaining the effluent. Slowly adding anhydrous ethanol with volume of 2/3 of the effluent, mixing, transferring into adsorption column, standing at room temperature for 2min, centrifuging at 12,000rpm for 30s, and retaining the adsorption column after centrifugation. Mu.l of deproteinized solution was added to the adsorption column, and centrifuged at 12,000rpm at room temperature for 30sec, and the waste liquid was discarded. 500 μ l of the rinse was centrifuged at 12,000rpm for 30 seconds at room temperature. The adsorption column was placed in a 2ml collection tube and centrifuged at 12,000rpm for 1min at room temperature to remove residual liquid. The column was then transferred to a new 1.5ml centrifuge tube, 15-30. mu.l RNase-free water was added and centrifuged at 12,000rpm for 2min at room temperature.
2. Reverse transcription
10 pg-1. mu.g of RNA template was mixed with 2. mu.l 10-fold buffer, 2. mu.l dATP (10mM), 0.5. mu.l primer, 0.5. mu.l RNase inhibitor and RNase-free water in a final volume of 20. mu.l and incubated at 37 ℃ for 1 h. Then 1 mul of 0.5 mug/mul specific reverse transcription primer (reverse transcription primer of miR-125b-2-3p is shown in SEQ ID NO: 3) is added into the reaction tube, and after 5min of incubation at 70 ℃, the mixture is immediately incubated on ice for at least 2min, so that the secondary structures of RNA and the primer are interrupted. Finally, 20. mu.l of the above reaction mixture was mixed with 4. mu.l of 5-fold buffer, 1. mu.l of dNTP (10mM), 0.5. mu. l M-MLV reverse transcriptase, 0.5. mu.l of RNase inhibitor, 10. mu.l of polyA reaction mixture and 4. mu.l of RNase-free water, and incubated at 42 ℃ for 1 hour.
Reverse transcription primer:
5’-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGA CAGGTCCC-3’，SEQ ID NO:3。
3.Q-PCR
a25. mu.l reaction system was used, with 3 parallel channels per sample, and all amplification reactions were repeated three more times to ensure the reliability of the results. The method is carried out according to the conventional steps, wherein the sequences of the cDNA amplification primer pair of miR-125b-2-3p are respectively shown as SEQ ID NO. 4 (forward primer, 5'-ACAA GTCAGGCTCTTC-3') and SEQ ID NO. 5 (reverse primer, 5'-GTGCAG GGTCCGAGGT-3'). The following reaction system was prepared: SYBR Green polymerase chain reaction system 12.5. mu.l, forward primer (5. mu.M/l) 1. mu.l, reverse primer (5. mu.M/l) 1. mu.l, template cDNA 2. mu.l, 8.5. mu.l enzyme-free water. All operations were performed on ice. The amplification procedure was: 95 ℃ for 10min, (95 ℃ for 20s, 60 ℃ for 55s)40 cycles. SYBR Green is used as a fluorescent marker, and PCR reaction is carried out on a fluorescent real-time quantitative PCR instrument. The band of interest was determined by melting curve analysis and electrophoresis, and relative quantification was performed by Δ Δ CT.
The results are shown in figure 1, the relative expression of miR-125b-2-3p in cells with renal fibrosis (EMT) was significantly lower than its relative expression in the control (Ctrl) cell line (./p <0.05), the relative expression in EMT was about 25% of that in the control. This indicates that miR-125b-2-3p can be used as a marker for the occurrence process of renal fibrosis.
Example 2 miR-125b-2-3p downregulates the relative expression levels in renal fibrotic cell lines in unilateral ureteral ligation (UUO) animal models
A renal fibrosis animal model was constructed by unilateral ureteral ligation (UUO), and was confirmed by HE (hematoxylin-eosin) staining and massson staining. And then, detecting the content of miR-125b-2-3 p.
As shown in fig. 2A, renal tissue cells of rats in the control (Ctrl) group without unilateral ureteral ligation (UUO) were observed to have typical cobblestone-like morphological features with tight intercellular junctions by HE and massson staining; unilateral kidney tissue cells of a rat treated by UUO show spindle-shaped forms, the intercellular gaps are obvious, the cells are thin and contract, and the forms are similar to those of fibroblasts. The UUO treatment is proved to be successful in constructing an animal model of renal fibrosis.
Rat kidney tissue cells of a control (Ctrl) group in which renal fibrosis did not occur and kidney tissue cells of one side of the UUO-treated rat were collected, respectively. And respectively extracting miRNA and carrying out reverse transcription by referring to the method of example 1, and detecting the relative expression quantity of miR-125b-2-3p by using Q-PCR (according to the conventional steps, wherein reverse transcription primers of miR-125b-2-3p are shown as SEQ ID NO:3, and cDNA amplification primer pairs are respectively shown as SEQ ID NO:4 and SEQ ID NO: 5). As shown in FIG. 2B, the relative expression level of miR-125B-2-3p in the kidney tissue cells of the UUO-treated rat with renal fibrosis (UUO) was significantly lower than that in the kidney tissue cells of the untreated control (Ctrl) rat (p <0.05), and the relative expression level of miR-125B-2-3p in the kidney tissue cells of the UUO-treated rat was about 15% of that in the control group. This shows that miR-125b-2-3p can be used as a marker for the occurrence process of renal fibrosis.
Example 3 detection of markers for epithelial-to-mesenchymal transition (EMT) following transfection of miR-125b-2-3p mimetics into renal fibrotic cells
The miR-125b-2-3p mimic (mimics) (purchased from Ribo Biotechnology, Inc., Guangzhou) was transfected with the transfection reagent lipofectamine 3000 into HK-2 cells, which were a human tubular epithelial cell line, and the HK-2 cells in the control (Ctrl) group and the HK-2 cells transfected with the mimic were collected 48 hours later, respectively. Referring to example 1, miRNA were extracted and reverse transcribed separately, and the relative expression level of miR-125b-2-3p was detected by Q-PCR (according to the conventional procedures, wherein reverse transcription primer of miR-125b-2-3p is shown as SEQ ID NO:2, and cDNA amplification primer pairs are shown as SEQ ID NO:3 and SEQ ID NO:4, respectively). As a result, after the miR-125b-2-3p mimics transfect the HK-2 cells, the expression level of the miR-125b-2-3p in the cells is remarkably increased, and the fact that the mimic can mimic the expression of the miR-125b-2-3p is proved.
The expression of E-cadherin and Vimentin, epithelial-mesenchymal transition (EMT) markers, were further examined in each group of cells using immunoblotting. Immunoblotting was carried out according to the usual procedures (manufacturer of E-cadherin antibody: abcam, product batch: ab 15148; manufacturer of Vimentin antibody: abcam, product batch: ab 92547; manufacturer of Tubulin antibody: abcam, product batch: ab 18207; secondary antibody is goat-anti rabbit or goat-anti mouse; manufacturer: Zhongshan Jinqiao). As shown in FIG. 3, in HK-2 cells administered with miR-125b-2-3p imic, the expression of E-cadherin protein was significantly increased and the expression of Vimentin protein was significantly decreased, compared to control cells (Ctrl), while the expression of tubulin, which is not related to renal fibrosis, was not significantly changed.
The experiment shows that the miR-125b-2-3p mimic can promote the expression of E-cadherin and inhibit the expression of Vimentin protein, thereby being beneficial to relieving and/or treating the renal fibrosis of a renal fibrosis object or a patient.
Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.
Sequence listing
<110> Hebei Renbao Macke Tech Co Ltd
Application of <120> miR-125b-2-3p in renal fibrosis
<130> P200275
<141> 2020-10-23
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> RNA
<213> has-miR-125b-2-3p
<400> 1
ucacaaguca ggcucuuggg ac 22
<210> 2
<211> 22
<212> RNA
<213> rno- miR-125b-2-3p
<400> 2
acaagucagg cucuugggac cu 22
<210> 3
<211> 51
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 3
gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgacaggtcc c 51
<210> 4
<211> 16
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 4
acaagtcagg ctcttc 16
<210> 5
<211> 16
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 5
gtgcagggtc cgaggt 16
Claims (7)
1. Application of a reagent for detecting miR-125b-2-3p expression level in preparation of products for diagnosing renal fibrosis.
2. The use of claim 1, wherein miR-125b-2-3p is down-regulated in expression levels in a cell line with renal fibrosis as compared to a cell line without renal fibrosis.
3. The application of the reagent for detecting the miR-125b-2-3p expression level in the preparation of the renal fibrosis diagnosis kit is characterized in that the kit comprises a primer and an instruction book for specifically amplifying miR-125b-2-3 p.
4. The use according to claim 3, wherein the primers comprise a reverse transcription primer having the sequence SEQ ID NO. 3 and a cDNA amplification primer pair having the sequences SEQ ID NO. 4 and SEQ ID NO. 5.
5. The use of claim 4, wherein the kit further comprises 10 x Buffer, dNTP, MgCl2, Taq enzyme and SYBR Green fluorochrome.
Application of the miR-125b-2-3p mimic in preparation of a pharmaceutical composition for treating renal fibrosis.
7. The use of claim 6, wherein the mimic of miR-125b-2-3p comprises a nucleotide sequence identical to SEQ ID No. 1 or SEQ ID No. 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011143938.0A CN112266954B (en) | 2020-10-23 | 2020-10-23 | Application of miR-125b-2-3p in renal fibrosis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011143938.0A CN112266954B (en) | 2020-10-23 | 2020-10-23 | Application of miR-125b-2-3p in renal fibrosis |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112266954A CN112266954A (en) | 2021-01-26 |
| CN112266954B true CN112266954B (en) | 2022-08-30 |
Family
ID=74342509
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011143938.0A Active CN112266954B (en) | 2020-10-23 | 2020-10-23 | Application of miR-125b-2-3p in renal fibrosis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112266954B (en) |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101056534B (en) * | 2004-10-13 | 2012-10-10 | 乔治亚大学研究基金会公司 | Nematode resistant transgenic plants |
| WO2011076141A1 (en) * | 2009-12-24 | 2011-06-30 | Fudan University | Diagnostic kits comprising microrna biomarkers and methods for diagnosis of hepatocellular cancer |
| CN106167824A (en) * | 2016-07-14 | 2016-11-30 | 西北工业大学 | Application with the oligonucleotide compound of senile osteoporosis related microRNA |
| CN109234381B (en) * | 2018-10-22 | 2021-06-18 | 云南省玉溪市人民医院 | Application of miR-2682-5p as renal fibrosis marker |
| CN109971851A (en) * | 2019-01-22 | 2019-07-05 | 宁波大学 | Purposes of the MiR-125b-2-3p as the molecular marker of antidiastole different subtypes renal cell carcinomas and its in metastases |
-
2020
- 2020-10-23 CN CN202011143938.0A patent/CN112266954B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN112266954A (en) | 2021-01-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102421917B (en) | Means and methods for counteracting, preventing and/or determining heart failure, or a risk of heart failure | |
| EP2228444A1 (en) | microRNA for diagnostic and therapeutic purposes in cardiovascular diseases | |
| Peng et al. | MiR-133a inhibits fracture healing via targeting RUNX2/BMP2. | |
| CN112126686B (en) | Early-stage screening molecular marker for renal fibrosis and application thereof | |
| US20190153446A1 (en) | Mir-149-3p and method for treating metabolic disease using the same | |
| CN110201172B (en) | Application of YY1 expression inhibitor in preparation of medicine for treating breast cancer | |
| CN110734972B (en) | Application of miR-181c-3p as kidney fibrosis marker | |
| CN107557472B (en) | Glioma diagnosis marker circ9:135881633|135883078 and application | |
| CN112266954B (en) | Application of miR-125b-2-3p in renal fibrosis | |
| CN109234381B (en) | Application of miR-2682-5p as renal fibrosis marker | |
| CN112263587B (en) | Application of miR-3065-5p in preparation of medicine for preventing and/or treating renal fibrosis | |
| CN109097358B (en) | Application of lncRNA in prevention or treatment of hypertension | |
| CN112746101B (en) | Osteoporosis diagnosis marker and nucleic acid medicine for promoting osteoporosis bone regeneration | |
| CN112359115B (en) | miR-517a-3p related to cisplatin resistance of tumor cells and application thereof | |
| CN111118143B (en) | Reagent for detecting and targeting RP11-754B17.1 and application thereof in arthritis | |
| CN111154863B (en) | Application of lncRNA in preparation of product for diagnosing and/or treating osteoarthritis | |
| CN109224076B (en) | Gene miR-140-3P related to lung cancer diagnosis and treatment, and mimics and application thereof | |
| CN112941176A (en) | Tumor lactic acid microenvironment related non-coding small RNA molecular spectrum and application thereof | |
| CN113694076A (en) | Application of miRNA and human mesenchymal stem cells in preparation of medicine for treating arthritis | |
| CN109295220B (en) | Application of miR-495-5p in preparation of products for diagnosing, prognosing, preventing or treating pancreatic cancer | |
| CN111118139B (en) | Molecular target for osteoporosis and application thereof | |
| CN114432334B (en) | Application of lnc-BIHAA1 in preparation of medicines for preventing and/or treating hepatic fibrosis | |
| CN113368242B (en) | Application of non-small cell lung cancer inhibition target | |
| CN112941183B (en) | Application of non-coding gene miR-187-5p in primary liver cancer diagnosis and treatment | |
| CN112680511B (en) | Application of ATF5 in screening drugs for treating diseases related to mitochondrial gene 3243 site mutation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |