CN112266953B - Female premature ovarian failure susceptibility gene detection model and detection kit - Google Patents
Female premature ovarian failure susceptibility gene detection model and detection kit Download PDFInfo
- Publication number
- CN112266953B CN112266953B CN202010729479.8A CN202010729479A CN112266953B CN 112266953 B CN112266953 B CN 112266953B CN 202010729479 A CN202010729479 A CN 202010729479A CN 112266953 B CN112266953 B CN 112266953B
- Authority
- CN
- China
- Prior art keywords
- ovarian failure
- premature ovarian
- seq
- artificial sequence
- primers
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The application discloses a female premature ovarian failure susceptibility gene detection model and a female premature ovarian failure susceptibility gene detection kit. The female premature ovarian failure susceptibility gene detection model consists of SNP sites of fifteen genes, namely ELN, SOD2, FSHR, DENND1A, IL17RD, FGF8, KAL1, THADA, LHCGR, FGFR1, GLO1, BMP15, KISS1R, ESR1 and CAT. The gene detection model is creatively established, particularly for Chinese females, and has ethnic specificity. Moreover, the detection reagent and the kit developed according to the gene detection model of the application can accurately, sensitively and specifically detect premature ovarian failure of Chinese females; provides a new approach and scheme for the detection of premature ovarian failure of Chinese females.
Description
Technical Field
The application relates to the field of female premature ovarian failure detection, in particular to a female premature ovarian failure susceptibility gene detection model and a female premature ovarian failure susceptibility gene detection kit.
Background
Premature Ovarian Failure (POF) refers to ovarian failure occurring before the age of 40 years in women due to various causes, resulting in symptoms such as increased follicle stimulating hormone levels and decreased estrogen levels, which are mostly manifested as amenorrhea before the age of 40 years. Premature ovarian failure is one of the most common gynecological diseases in the world at present, is also a common disease and a frequently encountered disease of a female reproductive system, has an increasing trend year by year, and causes serious harm to female reproductive health and society. Research shows that the incidence rate of premature ovarian failure in China is relatively high, reproductive disorders such as amenorrhea, infertility and the like are caused, symptoms such as systemic vascular dysfunction, night sweat, depression and anxiety syndrome and the like are caused, and the life quality and the physical and mental health are seriously influenced. At present, no exact conclusion is clinically made on the pathogenesis of premature ovarian failure; clinical studies have shown that premature ovarian failure may be associated with metabolic abnormalities, autoimmune factors, genetic and external infections, and the like.
With the continuous development of molecular biology and genetics in recent years, the research on the pathogenic genes of premature ovarian failure is deepened, and the premature ovarian failure is recognized to have obvious family aggregation tendency and is a complex multi-factor and multi-gene genetic disease. The POF pathogenic genes known at present mainly comprise follicular development related genes, endocrine function related genes and Mendelian genetic disease related genes influencing ovarian function.
Although some genes and gene mutations related to premature ovarian failure are researched and found at home and abroad at present, the research on the correlation among different gene mutation SNP sites of premature ovarian failure is less in various countries so far. The search of the related SNP has important scientific significance for understanding the pathogenesis of premature ovarian failure and detecting the susceptibility constitution of premature ovarian failure from the genetic aspect. In addition, related research and reports about a Chinese female premature ovarian failure susceptibility gene detection model are not available at home at present.
Disclosure of Invention
The application aims to provide a novel premature ovarian failure susceptibility gene detection model and a novel premature ovarian failure susceptibility gene detection kit which are particularly aimed at Chinese females.
The following technical scheme is adopted in the application:
one aspect of the application discloses a Chinese female premature ovarian failure susceptibility gene detection model, which consists of SNP sites of fifteen genes, namely ELN, SOD2, FSHR, DENND1A, IL17RD, FGF8, KAL1, THADA, LHCGR, FGFR1, GLO1, BMP15, KISS1R, ESR1 and CAT.
The gene detection model is developed aiming at the existing research object of premature ovarian failure of Chinese females, and is particularly suitable for detecting the premature ovarian failure of Chinese females; by detecting SNP loci of fifteen genes of the gene model, the premature ovarian failure condition of the Chinese female can be accurately judged, so that the method is used for early diagnosis screening or treatment prognosis of the premature ovarian failure of the Chinese female.
The application also discloses application of the Chinese female premature ovarian failure susceptibility gene detection model in preparation of premature ovarian failure detection reagents.
It can be understood that the gene model of the application can be used for detecting and judging premature ovarian failure of Chinese females, so that primers or probes for detecting fifteen gene SNP sites can be developed on the basis of the gene model of the application; therefore, the application creatively provides the application of the gene model in the preparation of the premature ovarian failure detection reagent.
The application also discloses a reagent for detecting premature ovarian failure of Chinese females, which comprises a primer group for amplifying SNP loci of fifteen genes in the susceptibility gene detection model of premature ovarian failure of Chinese females.
Preferably, the primer set is composed of primers having sequences shown in Seq ID No.1 to Seq ID No.30, wherein the sequences shown in Seq ID No.1 and Seq ID No.2 are primers of the first group, the sequences shown in Seq ID No.3 and Seq ID No.4 are primers of the second group, and so on, the sequences shown in Seq ID No.29 and Seq ID No.30 are primers of the fifteenth group, and the total is fifteen groups of primers; fifteen sets of primers were used in sequence to amplify the SNP sites of fifteen genes ELN, SOD2, FSHR, DENND1A, IL17RD, FGF8, KAL1, THADA, LHCGR, FGFR1, GLO1, BMP15, KISS1R, ESR1 and CAT.
It is understood that the primer sets of the sequences shown in Seq ID No.1 to Seq ID No.30 are only primers specifically used in one implementation of the present application, and do not exclude that other primers can also be used for PCR amplification of SNP sites of fifteen genes. Of course, on the basis of the primer set of the present application, addition or deletion of several bases can be performed on the basis of the primer set of the present application without affecting the amplification of the SNP site.
The application also discloses a Chinese female premature ovarian failure susceptibility gene detection kit containing the reagent.
Preferably, the kit of the present application further comprises a reagent for performing at least one of DNA extraction, PCR amplification, restriction endonuclease cleavage, and agarose gel electrophoresis.
It can be understood that, for the convenience of use, the reagent of the present application can be combined with other existing reagents, such as a DNA extraction reagent, a PCR amplification reagent, a restriction enzyme digestion reagent, an agarose gel electrophoresis reagent, etc., to be used as a kit; of course, the kit may further comprise other reagents for facilitating detection of the fifteen gene SNP sites, and is not particularly limited herein.
The beneficial effect of this application lies in:
the Chinese female premature ovarian failure susceptibility gene detection model creatively establishes a gene detection model especially for Chinese females, and has ethnic specificity. Moreover, the detection reagent and the kit developed according to the gene detection model of the application can accurately, sensitively and specifically detect premature ovarian failure of Chinese females; provides a new approach and scheme for detecting premature ovarian failure of Chinese females.
Detailed Description
The present application will be described in detail with reference to specific examples. The following examples are intended to be illustrative of the present application and should not be construed as limiting the present application.
Example one
1 materials and methods
1.1 materials
1.1.1 subjects
(1) Premature ovarian failure case group: 192 premature ovarian failure patients were sampled from the special outpatient clinic of premature ovarian failure in Xinhua hospital from 2007 to 2008.
(2) Normal control group: 192 healthy volunteers from Shanghai university and university of eastern China. And (3) inclusion standard: no diseases related to ovaries, such as premature ovarian failure and ovarian cancer, exist in the third generation and the third generation of direct relatives.
The above two groups are sampled from Chinese females, and have no relationship with each other.
1.1.2 Primary reagents
1.1.2.1 DNA extraction reagent
Genomic DNA extraction A blood genomic DNA extraction kit from QIAGEN was used.
1.1.2.2 PCR reaction reagent
(1) TaKaRa Ex TaqHot Start Version: purchased from TaKaRa Ex Taq HS (5U/. mu.L) and 10 XEx Taq buffer (containing Mg) 2+ ) The resulting mixture was stored at 20 ℃ in a dNTP mixture (2.5 mM each of dATP, dTTP, dGTP and dCTP).
(2) Gold medal Taq enzyme: purchased from applied biosystems, USA, and contains gold Taq enzyme, 10 Xgold Taq enzyme HS buffer, Mg 2+ (50mmol/L)。
(3) Q-solution: purchased from Jitai Biotech, Inc. -20 ℃ storage.
1.1.2.3 agarose gel electrophoresis reagent
(1)10 × TBE buffer: the 1L buffer contained 108 g of Tris base, 55 g of boric acid, and 0.5 XMDTA 40mL (pH8.0), and was stored at room temperature.
(2) Electrophoresis loading buffer solution: both the 6 XLoading Buffer and the 10 Xloading Buffer were purchased from Bao bioengineering (Dalian) Co., Ltd. and stored at room temperature.
(3)10mg/mL ethidium bromide: the final concentration was 0.5. mu.g/mL, and the cells were stored at room temperature.
(4) Marker: purchased from Tiangen Biochemical technology (Beijing) Ltd and stored at 4 ℃.
1.1.2.4 restriction enzyme
(1) BstU I and NEBuffer2 buffers: purchased from New England BioLabs Inc.
(2) Bsaai and NEBuffer3 buffers: purchased from New England BioLabs Inc.
(3) Alu i and NEBuffer4 buffer: purchased from New England BioLabs Inc.
(4) BsmF I and NEBuffer4+ BSA buffer system: purchased from New England biolabs inc.
(5) Bfu I and NEBuffer4 buffer: purchased from New England BioLabs Inc.
(6) Alwn i and NEBuffer4 buffers: purchased from New England BioLabs Inc.
(7) Nco I and 10 XBuffer TangoTM Buffer: purchased from MBI Fermentas.
(8) Bse xi and 10 × Buffer BseXI buffers: purchased from MBI Fermentas.
(9) Tru9 i and NEBuffer4+ BSA buffer system: purchased from New England biolabs inc.
(10) Xmni and NEBuffer2+ BSA buffer system: purchased from New England biolabs inc.
(11) Eco 81I and 10 XBuffer TangoTM Buffer: purchased from MBI Fermentas.
(12) Sau96 i and NEBuffer4 buffer: purchased from New England BioLabs Inc.
(13) Rsa i and NEBuffer 1 buffer: purchased from New England BioLabs Inc.
(14) MnlI and 10 XBufferG +10 XBufferTangoTM systems: purchased from MBIFermentas.
1.1.3 Main Instrument
(1) Model TP600 gradient PCR apparatus (TaKaRa, Japan).
(2) Model 4-15 high capacity centrifuge (SIGMA, Germany).
(3) Model TGL-16G bench centrifuge (Shanghai' an Tint scientific Instrument factory).
(4) FR-980 type bio-electrophoresis image analysis System (Shanghai Riyu science and technology Co., Ltd.).
(5) UV-254 dark box type ultraviolet transilluminator (Beijing ancient country biotechnology, Inc.).
(6) PowerBC 3002SI model of numerically controlled electrophoresis apparatus (Shanghai Shenneng gambling Biotech Co., Ltd.).
(7) DYCP-32A type agarose gel electrophoresis cell (six instruments, Beijing, Inc.).
(8) HE-90 horizontal trough glue maker (Shanghai Tianneng technologies, Inc.).
(9) DK-8D type electric heating constant temperature water tank (Shanghai sperm macro test equipment Co., Ltd.).
(10) Model P7021TP-6 grance microwave oven (grand microwave oven electric appliance ltd, changshan).
(11) Model JT10001 electronic balance (shanghai Jingtian electronics ltd).
(12) Model QL-901 vortexer (limebel instruments, inc. of haman).
(13) Manually adjustable pipettes (dalong medical devices limited).
1.2 methods
1.2.1 sample Collection and DNA extraction
1) According to the principle of informed consent, peripheral blood of patients and healthy volunteers is collected, and is anticoagulated by EDTA and stored at-80 ℃ for standby.
2) DNA extraction was performed using a blood genomic DNA extraction kit. The whole process is worn with disposable gloves and masks, so that cross contamination is avoided. The disposable articles such as gun head, cyclone, tube, etc. are sterilized under the same pressure.
3) Sequentially adding 20 mu L of proteinase K and 200 mu L of anticoagulation blood into a 1.5mL centrifuge tube, shaking in a cyclone manner, fully mixing uniformly, and centrifuging for a short time.
4) Adding 200 μ L of anhydrous ethanol, shaking thoroughly, mixing, centrifuging for a short time, transferring to a purification column, centrifuging at 13200rpm for 1min, and discarding filtrate and collection tube.
5) The rinsing solutions Buffer AW1 and Buffer AW2 were added with absolute ethyl alcohol before use to prepare working solutions. The column was placed in a new collection tube, 500. mu.L of Buffer AW1 was added, and the mixture was centrifuged at 13200rpm for 1min, and the filtrate was discarded.
6) The column was returned to the collection tube, 500. mu.L of Buffer AW2 was added, and the tube was centrifuged at 13200rpm for 3min, and the filtrate and collection tube were discarded.
7) Placing the purification column into a new collection tube, centrifuging at 13200rpm for 1min, discarding filtrate and collection tube
8) And (4) putting the purification column into a new 1.5mL centrifuge tube, and standing at room temperature for 15 minutes to ensure that the residual rinsing liquid in the adsorption film is evaporated to be clean as much as possible.
9) 200 μ L of Buffer AE (preheated at 68 ℃) is added into the purification column, the mixture is placed at room temperature for 5-10min, and the mixture is centrifuged at 13200rpm for 2min, and the obtained filtrate is the genome DNA.
All DNA sample purities met the following criteria: A260/A280 is between 1.7 and 2.0; A260/A230 is greater than 1.5; agarose gel electrophoresis detects a main band of more than 20K and has no obvious degradation. The concentration of the DNA sample is not lower than 50 ng/. mu.L, and the total DNA amount of each sample is not lower than 6. mu.g. The genomic DNA was stored at-20 ℃.
1.2.2 selection of SNP sites and design and Synthesis of primers
Specific amplification primers were designed for SNP sites of fifteen genes, ELN, SOD2, FSHR, DENND1A, IL17RD, FGF8, KAL1, THADA, LHCGR, FGFR1, GLO1, BMP15, KISS1R, ESR1 and CAT. SNP site information of fifteen genes is shown in Table 1, and designed specific amplification primers are shown in Table 2. The primers were synthesized by Shanghai Biotechnology service, Inc.
TABLE 1 SNP site information to be tested
| Name of Gene | SNP site name | Reference allele | Risk alleles |
| ELN | rs7787362 | T | C |
| SOD2 | rs4880 | T | C |
| FSHR | rs28928871 | G | A |
| DENND1A | rs2479106 | A | G |
| IL17RD | rs184758350 | T | G |
| FGF8 | rs137852660 | G | A |
| KAL1 | rs137852517 | G | A |
| THADA | rs13429458 | C | A |
| LHCGR | rs13405728 | G | A |
| FGFR1 | rs121909642 | C | T |
| GLO1 | rs1130534 | T | A |
| BMP15 | rs104894763 | C | T |
| KISS1R | rs104894702 | T | A |
| ESR1 | rs104893956 | C | T |
| CAT | rs1001179 | G | A |
TABLE 2SNP site-specific amplification primers
| Name of Gene | F end primer (5 '-3') | R end primer (5 '-3') | Length of amplification | Tm | Seq ID No. |
| ELN | TGCGTGTGCATGAACATGAC | ATCTGAGAGCGATGTTGGAC | 224bp | 65 | 1、2 |
| SOD2 | TTTCTCGTCTTCAGCACCAG | AACCTACCCTTGGCCAACG | 244bp | 66 | 3、4 |
| FSHR | CTGCCCATGGATATTGACAG | GAAAGAAATGGGTGCCATGC | 216bp | 54 | 5、6 |
| DENND1A | TTTACCATGACCTGTGGGAC | AAATGGAGCAGCCACTCAAG | 218bp | 55 | 7、8 |
| IL17RD | AGCTACTGTTGAGCTGCTTC | CTGGCCACAGTTAGAATTCC | 184bp | 58 | 9、10 |
| FGF8 | AGAAGCTGGACCCACCTGTT | TTTGGCCCAATGATCGGGTG | 198bp | 56 | 11、12 |
| KAL1 | GTCACATGCATGTGGGTAAG | TGGAATTGCAAGCCATAACG | 177bp | 62 | 13、14 |
| THADA | ATGCACAATGGAGACTGCTG | GTCACAATCCAGGGAAAGAC | 256bp | 57 | 15、16 |
| LHCGR | TCTTCCCCATCCACATACTC | CACAATTTGGGAAGGCAGCG | 237bp | 56 | 17、18 |
| FGFR1 | ATACTCTCTAGTCTAGCCCC | ATTTGCAGGTGGTCTTTCGG | 263bp | 64 | 19、20 |
| GLO1 | CACAATGGCAATTCAGACCC | TCATGGTGAGATGGTAAGTG | 194bp | 60 | 21、22 |
| BMP15 | GGCATAACAACTCACCTCTG | CTACTTTGCCCCTGATTGAG | 168bp | 60 | 23、24 |
| KISS1R | CAGAAGCCAGGGAGCAGTG | ACAACGAAACTGCACCGAAC | 174bp | 59 | 25、26 |
| ESR1 | GGCAGATTCCATAGCCATAC | ACAGACGGCAAGAGGTAATG | 189bp | 58 | 27、28 |
| CAT | GGAGGACTGCCTTCTGATTG | CTGAAGGATGCTGATAACCG | 205bp | 55 | 29、30 |
In Table 2, "Seq ID No." includes two sequence numbers in the order of F-terminal primer and R-terminal primer, for example, "1 and 2", i.e., the F-terminal primer of ELN is Seq ID No.1, the R-terminal primer is Seq ID No.2, and the rest "Seq ID No." are analogized.
1.2.3 PCR amplification
In this example, HotStart PCR was used
(1) HotStart PCR reaction System: the total volume of the reaction was 10. mu.L, inclusive
TaKaRa Ex Taq HS(5U/μL)0.05μL
10 XEx Taq buffer (containing Mg) 2+ )1μL
dNTP mix (2.5 mM each) 1. mu.L
Forward primer (50 pmol/. mu.L) 0.1. mu.L
Reverse primer (50 pmol/. mu.L) 0.1. mu.L
Genomic DNA 0.4. mu.L
ddH 2 O 7.35μL
(2) HotStart PCR amplification reaction conditions:
95℃5min
then 40 cycles are entered: 95 ℃ for 30s, annealing temperature for 45s and 72 ℃ for 1min
72 ℃ for 10min after the circulation is finished
4 ℃ standby
Here, the annealing temperature used in this example was a temperature of-5 ℃ for the Tm value of each pair of primers.
1.2.4PCR product detection
After the PCR amplification reaction is finished, 5 mu L of PCR product is uniformly mixed with 1 mu L of electrophoresis sample loading buffer solution and then electrophoresed on 2.0 percent (w/V) of agarose gel, ethidium bromide with the final concentration of 0.5 mu g/mL is added into the agarose gel in the preparation process, and the electrophoresis is carried out in 0.5 xTBE buffer solution according to the voltage of 5V/cm; after the electrophoresis is finished, taking a picture of the gel on an FR-980 type biological electrophoresis image analysis system, and analyzing the PCR amplification condition.
1.2.5 restriction fragment Length polymorphism analysis
An enzyme digestion reaction system: the volume of the reaction system was 10. mu.L, and contained: PCR product 5. mu.L, 10 XBuffer Buffer 1. mu.L, restriction enzyme 0.5U, ddH2O to a total volume of 10. mu.L. Among them, 100 XBSA 0.1. mu.L was added for three restriction enzymes BamHI, EcoRI and HindII.
The recognition sequences for the three endonucleases are shown in Table 3.
TABLE 3 enzymes and their recognition sequences
| Incision enzyme | Identification sequences |
| BamHⅠ | G↓GATCC |
| EcoRⅠ | C↓AATTC |
| HindⅡ | GTY↓RAC |
The enzyme digestion reaction conditions are as follows: the enzyme cutting reaction temperature is the optimal reaction temperature of the adopted restriction enzyme, and the reaction time is 16 hours.
1.2.6 detection of enzyme digestion products
Taking 5 mu L of enzyme digestion products of each tube, mixing the enzyme digestion products with 1 mu L of electrophoresis loading buffer solution uniformly, carrying out electrophoresis on 4.0% (w/V) agarose gel, adding ethidium bromide with the final concentration of 0.5 mu g/mL into the agarose gel in the preparation process, and carrying out electrophoresis in 0.5 xTBE buffer solution according to the voltage of 2V/cm; after the electrophoresis, the gel was photographed on an FR-980 type biological electrophoresis image analysis system, and the result was recorded.
1.2.7 statistical analysis
1.2.7.1 genotype frequency and allele frequency calculations
(1) Calculation of genotype frequencies: a and a represent two alleles respectively, and N represents the number of cases
A A frequency N AA /(N AA +N Aa +N aa )
Aa frequency N Aa /(N AA +N Aa +N aa )
aa frequency N aa /(N AA +N Aa +N aa )
(2) Calculation of allele frequencies: a and a represent two alleles respectively, and N represents the number of cases
Frequency of A ═ N AA +1/2N Aa )/(N AA +N Aa +N aa )
a frequency ═ N aa +1/2N Aa )/(N AA +N Aa +N aa )
1.2.7.2 Hardy-Weinberg equilibrium goodness of fit test
Calculating expected genotype frequencies of the SNP loci in the premature ovarian failure group and the control group according to Hardy-Weinberg equilibrium law, and comparing the difference between the observed genotype frequency and the expected genotype frequency by using SPSS11.0 statistical software to carry out chi-square test, wherein P < 0.05 represents that the difference has statistical significance. And determining that the selected premature ovarian failure group and the control group are in a genetic equilibrium state at each SNP locus to be researched and have group representativeness.
1.2.7.3 statistical analysis of distribution Difference
Statistical analysis of distribution differences of genotypes, alleles and genotype combinations the chi-square test was performed using SPSS11.0 statistical software to analyze the frequency differences of genotypes, alleles and genotype combinations at each SNP site between the premature ovarian failure group and the control group, with P < 0.05 indicating that the differences are statistically significant. If the genotype and the allele frequency of a certain SNP locus have statistical difference among groups, the polymorphic locus has correlation with premature ovarian failure, and otherwise, the polymorphic locus has no correlation with the premature ovarian failure.
1.2.7.4 higher order interaction analysis of multiple SNP sites
And (3) applying MDR 2.0beta software to carry out high-order interaction analysis of a plurality of SNP sites, and establishing an premature ovarian failure detection model. The MDR software package is free software with open source codes written based on Java programs, can be freely downloaded in http:// www.epistasis.org/MDR. Java 2Runtime Environment is installed first, and can be downloaded in http:// www.java.com/free, and the mdr. jar file running program is clicked directly under the Windows operating system.
2 results
2.1 detection results of PCR products and cleavage products at each SNP site
Carrying out gene typing on the SNP loci of the 15 genes by adopting a PCR-RFLP method, and carrying out agarose gel electrophoresis on PCR products of the SNP loci. The results show that the PCR amplification products of 15 genes all contain a single target sequence that is expected. The cleavage result of the PCR amplification product also agreed with the expected result.
2.2Hardy-Weinberg equilibrium goodness of fit test results
Hardy-Weinberg equilibrium goodness of fit test is respectively carried out on the 15 SNP loci in the premature ovarian failure case group and the normal control group, and P values are all larger than 0.05, which indicates that the 15 SNP loci are in a genetic equilibrium state in the case group and the control group and have group representativeness.
2.3 genotype and allele frequency distribution of SNP sites between case group and control group
The analysis result shows that the genotype of 15 SNP sites between the premature ovarian failure case group and the normal control group is shown in Table 4.
TABLE 4 Gene profiles examined in premature ovarian failure case groups and in normal control groups
The results in Table 4 show that 15 SNP sites and corresponding primers of this example can effectively distinguish the case group from the normal control group.
Discussion of 3
Premature ovarian failure is a complex multi-factor, polygenic genetic disease. Multiple genes may control expression of a phenotype characteristic of premature ovarian failure, either individually or in combination, and the last or common pathway of such control is premature ovarian failure. The finding of the related genes has important scientific significance for understanding the pathogenesis of premature ovarian failure and detecting the susceptibility constitution of premature ovarian failure from the genetic aspect.
The research result of the example shows that 15 subsequent SNP sites can effectively predict the disease onset risk.
3.1 Single site analysis
This example was conducted in a case-control study of 384 women in China comprising 192 individuals of premature ovarian failure and healthy volunteers.
Single-point analysis is carried out on 15 candidate SNP sites of the 15 genes, and the frequency of carrying mutant alleles in a case group is obviously higher than that of a healthy volunteer group.
The research result also shows that the polymorphism of 15 candidate SNP sites has obvious correlation with the premature ovarian failure of Chinese females, which is consistent with certain similar research conclusions of Chinese population, but is not consistent with some foreign literature reports, and the reason is probably that the genetic background is different among different ethnic groups.
3.2 higher order interaction analysis
The multi-factor dimensionality reduction method proposed by Ritchie et al in 2001 is the mainstream statistical method for researching the correlation relationship of multiple SNP sites at present. And (3) carrying out high-order interaction analysis on a plurality of SNP sites by adopting an MDR method to obtain a more ideal early ovarian failure susceptibility gene detection model. Because the sample size of the experiment is limited, the total number of SNP sites participating in statistical analysis cannot be too large, otherwise, the efficiency of MDR analysis is influenced.
In the experiment, when single-point analysis is carried out on SNP loci, 15 genes of ELN, SOD2, FSHR, DENND1A, IL17RD, FGF8, KAL1, THADA, LHCGR, FGFR1, GLO1, BMP15, KISS1R, ESR1 and CAT are related to the occurrence of premature ovarian failure of female women in China and are all premature ovarian failure susceptible genes which can be repeated in more than 10 samples, so that only fifteen candidate SNP loci of 5 premature ovarian failure susceptible genes which can be repeated in more than 10 samples are selected for research when a MDR method is adopted to carry out multi-locus high-order interaction analysis to preliminarily establish a premature ovarian failure gene detection model.
The results show that there is no linkage disequilibrium and effective prediction of disease risk for 15 sites tested.
Finally, the analysis of the embodiment considers that each premature ovarian failure detection index of the 15-site model is superior to that of other models, so that the 15-site model is selected as the optimal detection model. The model "If-the Rules" shows the classification of susceptibility to premature ovarian failure for all genotypic combinations formed by 15 SNP sites of ELN, SOD2, FSHR, DENND1A, IL17RD, FGF8, KAL1, THADA, LHCGR, FGFR1, GLO1, BMP15, KISS1R, ESR1 and CAT, including susceptible and non-susceptible types.
In conclusion, SNP sites of ELN, SOD2, FSHR, DENND1A, IL17RD, FGF8, KAL1, THADA, LHCGR, FGFR1, GLO1, BMP15, KISS1R, ESR1 and CAT fifteen genes are related to the premature ovarian failure of Chinese females and are main effect sites, and the rest SNP sites have no obvious relevance to the premature ovarian failure of Chinese females and are non-main effect sites. Therefore, the SNP sites of ELN, SOD2, FSHR, DENND1A, IL17RD, FGF8, KAL1, THADA, LHCGR, FGFR1, GLO1, BMP15, KISS1R, ESR1 and CAT fifteen genes become the best detection model established in the research. The establishment of a Chinese female premature ovarian failure susceptibility gene detection model is the first time in China and has innovation; compared with similar research in foreign countries, the method has ethnic specificity.
4 conclusion
The example constructs a Chinese female premature ovarian failure susceptibility gene detection model consisting of SNP sites of ELN, SOD2, FSHR, DENND1A, IL17RD, FGF8, KAL1, THADA, LHCGR, FGFR1, GLO1, BMP15, KISS1R, ESR1 and CAT fifteen genes, has good premature ovarian failure detection efficiency, and can be used for Chinese female premature ovarian failure detection or screening.
Example two
The present example illustrates a clinical application scheme of the chinese female premature ovarian failure susceptibility gene detection model constructed in the first embodiment. Specifically, 192 cases of Chinese female cases and controls collected in Xinhua hospital are used as research objects, 15 Single Nucleotide Polymorphism (SNPs) sites of 15 genes are genotyped, a mainstream statistical method for researching the mutual correlation relationship of a plurality of SNP sites, namely a multi-factor dimensionality reduction Method (MDR) is used for carrying out statistical analysis, and a Chinese female premature ovarian failure susceptibility gene detection model consisting of SNP sites of ELN, SOD2, FSHR, DENND1A, IL17RD, FGF8, KAL1, THADA, LHCGR, FGFR1, GLO1, BMP15, KISS1R, ESR1 and CAT fifteen genes is preliminarily established, so that the model has good ovarian failure susceptibility detection efficiency, OR is 345.3478, the accuracy is less than 0.0001%, the sensitivity is less than 0. 92.97%, and the sensitivity is 97.02%, and the sensitivity is specific. The establishment of a Chinese female premature ovarian failure susceptibility gene detection model is the first time in China and has innovation; compared with similar research in foreign countries, the method has ethnic specificity. MDR creates an ideal discrimination classification model for distinguishing high-risk and low-risk individuals, and the model shows the premature ovarian failure susceptibility classification of all genotype combinations formed by fifteen SNP sites, including susceptible types and non-susceptible types. The establishment of the detection model is helpful for judging premature ovarian failure and early intervening, and has positive significance for effectively reducing the prevalence rate of premature ovarian failure. The clinical application of the Chinese female premature ovarian failure susceptibility gene detection model is briefly described as follows:
1. fifteen gene detection kits are developed aiming at the constructed susceptibility gene detection model of the premature ovarian failure of the female females. The kit consists of fifteen boxes, and each small box is respectively corresponding to one SNP locus in fifteen SNP locus models for genotyping. Each small box is filled with related reagents of four steps of DNA extraction, PCR amplification, restriction enzyme digestion and agarose gel electrophoresis.
2. The detection kit is suitable for potential premature ovarian failure patients scattered in a community, namely those who have personal or family allergy history but have no premature ovarian failure, and the potential premature ovarian failure patients may be suffered from premature ovarian failure under certain conditions. The concept of three-level prevention of premature ovarian failure is proposed abroad, wherein the first-level prevention is to take active measures when the disease does not occur, such as changing the living environment, dietary habits and the like of high risk groups, and preventing the premature ovarian failure. The potential patients can be screened early by adopting the Chinese female premature ovarian failure susceptibility gene detection kit, the high risk group of premature ovarian failure is determined, measures such as allergen avoidance are taken in a targeted manner, the disease is prevented in the bud, the premature ovarian failure morbidity is effectively reduced, and a large amount of resources are saved.
3. A detection step: (1) collecting peripheral blood of a subject; (2) extracting peripheral blood genome DNA; (3) carrying out PCR amplification on the specific DNA fragment; (4) detecting the PCR product by agarose gel electrophoresis; (5) carrying out restriction enzyme digestion reaction on the PCR product; (6) detecting the product of the enzyme digestion reaction by an agarose gel electrophoresis method to determine the genotype; (7) obtaining the genotypes of fifteen SNP loci; (8) judging the susceptibility classification of premature ovarian failure according to the genotype result of the fifteen loci, namely determining whether the detected person is at high risk or low risk of premature ovarian failure; (9) and performing premature ovarian failure education and management on premature ovarian failure high-risk persons and families thereof.
The foregoing is a detailed description of the present application in conjunction with specific embodiments thereof, and it is not intended that the implementations of the present application be limited to these descriptions. It will be apparent to those skilled in the art from this disclosure that many more simple derivations or substitutions can be made without departing from the basic inventive concepts herein.
Sequence listing
<110> Guangzhou Dakang Gene technology Co., Ltd
<120> female premature ovarian failure susceptibility gene detection model and detection kit
<130> 20200218
<150> 2019111372636
<151> 2019-11-19
<160> 30
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
tgcgtgtgca tgaacatgac 20
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
atctgagagc gatgttggac 20
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
tttctcgtct tcagcaccag 20
<210> 4
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
aacctaccct tggccaacg 19
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
ctgcccatgg atattgacag 20
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
gaaagaaatg ggtgccatgc 20
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
tttaccatga cctgtgggac 20
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
aaatggagca gccactcaag 20
<210> 9
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
agctactgtt gagctgcttc 20
<210> 10
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
ctggccacag ttagaattcc 20
<210> 11
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
agaagctgga cccacctgtt 20
<210> 12
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
tttggcccaa tgatcgggtg 20
<210> 13
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
gtcacatgca tgtgggtaag 20
<210> 14
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
tggaattgca agccataacg 20
<210> 15
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
atgcacaatg gagactgctg 20
<210> 16
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
gtcacaatcc agggaaagac 20
<210> 17
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
tcttccccat ccacatactc 20
<210> 18
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
cacaatttgg gaaggcagcg 20
<210> 19
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 19
atactctcta gtctagcccc 20
<210> 20
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
atttgcaggt ggtctttcgg 20
<210> 21
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 21
cacaatggca attcagaccc 20
<210> 22
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 22
tcatggtgag atggtaagtg 20
<210> 23
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 23
ggcataacaa ctcacctctg 20
<210> 24
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 24
ctactttgcc cctgattgag 20
<210> 25
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 25
cagaagccag ggagcagtg 19
<210> 26
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 26
acaacgaaac tgcaccgaac 20
<210> 27
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 27
ggcagattcc atagccatac 20
<210> 28
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 28
acagacggca agaggtaatg 20
<210> 29
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 29
ggaggactgc cttctgattg 20
<210> 30
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 30
ctgaaggatg ctgataaccg 20
Claims (4)
1. A reagent for detecting premature ovarian failure of Chinese females is characterized in that: the reagent is a primer group for amplifying SNP sites of fifteen susceptibility genes of premature ovarian failure of Chinese females, the susceptibility genes of premature ovarian failure of the Chinese females are ELN, SOD2, FSHR, DENND1A, IL17RD, FGF8, KAL1, THADA, LHCGR, FGFR1, GLO1, BMP15, KISS1R, ESR1 and CAT, and the SNP sites of the susceptibility genes of premature ovarian failure of the Chinese females are selected from the following table:
2. the reagent according to claim 1, characterized in that: the primer group consists of primers of sequences shown by Seq ID No.1 to Seq ID No.30, wherein the sequences shown by Seq ID No.1 and Seq ID No.2 are a first group of primers, the sequences shown by Seq ID No.3 and Seq ID No.4 are a second group of primers, and so on, the sequences shown by Seq ID No.29 and Seq ID No.30 are a fifteenth group of primers, and fifteen groups of primers are counted; fifteen sets of primers were used in sequence to amplify the SNP sites of fifteen genes ELN, SOD2, FSHR, DENND1A, IL17RD, FGF8, KAL1, THADA, LHCGR, FGFR1, GLO1, BMP15, KISS1R, ESR1 and CAT.
3. A kit for detecting susceptibility genes of premature ovarian failure of Chinese females, which comprises the reagent of claim 1 or 2.
4. The kit for detecting susceptibility genes of premature ovarian failure of Chinese females as claimed in claim 3, wherein: the kit also contains a reagent for performing at least one operation of DNA extraction, PCR amplification, restriction enzyme digestion and agarose gel electrophoresis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010729479.8A CN112266953B (en) | 2020-07-27 | 2020-07-27 | Female premature ovarian failure susceptibility gene detection model and detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010729479.8A CN112266953B (en) | 2020-07-27 | 2020-07-27 | Female premature ovarian failure susceptibility gene detection model and detection kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112266953A CN112266953A (en) | 2021-01-26 |
| CN112266953B true CN112266953B (en) | 2022-08-02 |
Family
ID=74349459
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010729479.8A Active CN112266953B (en) | 2020-07-27 | 2020-07-27 | Female premature ovarian failure susceptibility gene detection model and detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112266953B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103463629A (en) * | 2012-06-08 | 2013-12-25 | 上海市计划生育科学研究所 | Preparation method and application of premature ovarian failure non-human mammal model |
| CN104962655A (en) * | 2015-07-28 | 2015-10-07 | 山东大学齐鲁医院 | Ovarian cancer susceptibility-related molecular marker as well as detection primer and kit |
| CN110564839A (en) * | 2019-08-23 | 2019-12-13 | 浙江大学 | amplification and detection method for full exons of premature ovarian failure related genes |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100203502A1 (en) * | 2005-09-13 | 2010-08-12 | Moron Francisco J | Method for the in Vitro Detection of a Predisposition to the Development of Alterations in Ovarian Function |
| AU2016341281A1 (en) * | 2015-10-19 | 2018-06-07 | Celmatix Inc. | Methods and systems for assessing infertility as a result of declining ovarian reserve and function |
-
2020
- 2020-07-27 CN CN202010729479.8A patent/CN112266953B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103463629A (en) * | 2012-06-08 | 2013-12-25 | 上海市计划生育科学研究所 | Preparation method and application of premature ovarian failure non-human mammal model |
| CN104962655A (en) * | 2015-07-28 | 2015-10-07 | 山东大学齐鲁医院 | Ovarian cancer susceptibility-related molecular marker as well as detection primer and kit |
| CN110564839A (en) * | 2019-08-23 | 2019-12-13 | 浙江大学 | amplification and detection method for full exons of premature ovarian failure related genes |
Non-Patent Citations (3)
| Title |
|---|
| FSHR基因多态性与卵巢早衰和多囊卵巢综合征的关系;印贤琴等;《广东医学》;20160110(第01期);第113-117页 * |
| 早发性卵巢功能不全基因检测的研究进展;卢秋敏等;《国际妇产科学杂志》;20200615(第03期);第68-73页 * |
| 雌激素受体α基因多态性与中国妇女特发性卵巢早衰的相关性研究;刘丽鹏等;《生殖医学杂志》;20120815(第04期);第303-308页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112266953A (en) | 2021-01-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Luo et al. | An Ashkenazi Jewish SMN1 haplotype specific to duplication alleles improves pan-ethnic carrier screening for spinal muscular atrophy | |
| CN111500723A (en) | Marker combination for detecting premature ovarian failure genes and detection kit | |
| CN111549116B (en) | Female early-onset ovarian dysfunction susceptibility gene detection model and detection kit | |
| Liu et al. | Prenatal diagnosis of Chinese families with phenylketonuria | |
| Alakoc et al. | Y-chromosome and autosomal STR diversity in four proximate settlements in Central Anatolia | |
| CN117603982B (en) | P.P374TfsTer18 mutant pathogenic gene of SQSTM1 for amyotrophic lateral sclerosis and application thereof | |
| Huang et al. | Do partial AZFc deletions affect the sperm retrieval rate in non-mosaic Klinefelter patients undergoing microdissection testicular sperm extraction? | |
| CN112266953B (en) | Female premature ovarian failure susceptibility gene detection model and detection kit | |
| CN109837344B (en) | Methylated EphA7 nucleotide fragment, detection method and application thereof | |
| CN115960997A (en) | Primer probe combination and kit for detecting exon14 skipping mutation of c-MET gene based on digital PCR platform | |
| CN115216533A (en) | Biomarker for diagnosing Wilson's disease, amplification primer set, detection reagent and application | |
| Ta et al. | Rapid method for targeted prenatal diagnosis of Duchenne muscular dystrophy in Vietnam | |
| CN114958967A (en) | Construction method and kit of gene library for detecting male infertility | |
| Minh et al. | Association between single nucleotide polymorphism Rs11614913 (C> T) on Mir-196a2 and breast cancer in vietnamese population | |
| Alharbi et al. | The impact of leukemia on the detection of Short Tandem Repeat (STR) markers | |
| CN106868128B (en) | Biomarker for auxiliary diagnosis of breast cancer and application thereof | |
| Babaki et al. | Relationship between MspI polymorphism of CYP1A1 gene and the risk of endometriosis in an Iranian population: A case-control study | |
| Agha Heydar Ali Naghash et al. | The rs4415084 and rs10941679 Might be Risk Conferring Factors for Breast Cancer among Iranian Women | |
| Oruč et al. | Assessment of relatedness between neurocan gene as bipolar disorder susceptibility locus and schizophrenia | |
| CN110643689A (en) | TaqMan probe real-time fluorescent PCR method for detecting rs6313 site of HTR2A gene and primer probe combination thereof | |
| CN110144404B (en) | New mutation SNP site of breast cancer treatment gene TFR2 and application thereof | |
| Kuzmanovska et al. | Y-chromosome haplogroup architecture confers susceptibility to azoospermia factor c microrearrangements: a retrospective study | |
| Yuan et al. | Study of autosomal STR loci with IBS method in full sibling identification | |
| Rajovski et al. | Association of PRMT6, PEX10 and SOX5 genetic variants with idiopathic male infertility: Evidence from North Macedonian population and an updated meta-analysis | |
| An et al. | Screening of longevity-associated genes based on a comparison between dead and surviving populations |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20230607 Address after: 510700 Room 303, building C, R & D center, No. 11, Nanyun fifth road, Huangpu District, Guangzhou City, Guangdong Province Patentee after: Guangzhou Zhili Medical Diagnostic Technology Co.,Ltd. Address before: Unit 214-41, 2nd floor, office area, No.1 helix 4th Road, Guangzhou International Biological Island, Guangzhou, Guangdong 510000 Patentee before: Guangzhou Dakang Gene Technology Co.,Ltd. |
|
| TR01 | Transfer of patent right |