CN112251527A

CN112251527A - Digital PCR method for detecting g10evo-epsps gene of transgenic soybean

Info

Publication number: CN112251527A
Application number: CN202011078898.6A
Authority: CN
Inventors: 陈笑芸; 徐晓丽; 纪艺; 寿惠霞; 王鹏飞; 缪青梅; 汪小福; 徐俊锋
Original assignee: Zhejiang Academy of Agricultural Sciences
Current assignee: Zhejiang Academy of Agricultural Sciences
Priority date: 2020-10-10
Filing date: 2020-10-10
Publication date: 2021-01-22

Abstract

The application relates to the technical field of biological detection, in particular to a transgenic soybeang10evo‑epspsDigital PCR method for gene detection. The method comprises the following steps: 1) extracting transgenic soybean genomic DNA; 2) adding a PCR system and a microdroplet generating oil generating microdroplet into the microdroplet generating card, and transferring the generated microdroplet into a PCR tube for PCR amplification reaction; the PCR amplification primer pair and the probe sequence are as follows: forward primer F4: TTACCGTGAGAGGTGGTAGACCT, respectively; reverse primer R4: GTGGTATCACCCTCAGCGAAG, respectively; probe P4: 5 'FAM-ttccttcaccgacgcc-MGB 3'. 3) After amplification was complete, the 96-well plate was placed in a microdroplet reader to read the signal and the experimental data was analyzed using the software QuantaSoft Version 1.6.6.0320 to obtain absolute quantitative results. The method has the advantages of good specificity, high accuracy and sensitivity and the like, and can be well applied to transgenic soybeansg10evo‑epspsAnd (4) quantitative detection of the gene.

Description

Digital PCR method for detecting g10evo-epsps gene of transgenic soybean

Technical Field

The application relates to the technical field of biological detection, in particular to a digital PCR method for detecting a g10evo-epsps gene of a transgenic soybean.

Background

Soybean is one of the most important crops in the field of human production, and is also one of the important sources of vegetable proteins and oils. Soybeans originate from China and have a cultivation history of over 5000 years. Soybeans have extremely important application in agriculture, industry, medicine and other aspects. The soybean is rich in nutrition, and the seed contains 40% of protein and 20% of fat, and is also rich in physiological active substances such as isoflavone, lecithin, vitamin E, saponin and the like. As a new biological technology, the transgenic technology provides a new technical means for breeding new biological species. The transgenic technology is widely applied to soybean breeding, and a new soybean variety with important economic value is cultivated. The transgenic soybean also becomes the transgenic crop with the earliest commercialization time and the fastest popularization and application speed in the world.

The glyphosate is an excellent broad-spectrum biocidal herbicide, has the advantages of excellent herbicidal performance, low cost, easy degradation and the like, and can greatly reduce the weed control cost when cultivating glyphosate-resistant crops, so that the cultivation of glyphosate-resistant transgenic crops becomes the key point of the development of transgenic crops. For example, the Chinese patent application (application No. CN201110009329.0) discloses that the g10evo-epsps gene with high glyphosate resistance is a functional gene which is developed by Hangzhou Ruifeng Biotechnology Limited and has independent intellectual property rights, and the gene is successfully introduced into crops such as corn, soybean, cotton and rice and is stably integrated and expressed in the crops. However, quantitative detection and analysis of the expression quantity of the exogenous gene for glyphosate resistance of transgenic soybean, the insertion copy number of the exogenous gene and the like are still needed, so that the safety supervision requirements of transgenic organisms in China can be further met, guarantee and support are provided for the smooth implementation of important special items for new variety cultivation of the transgenic organisms, and the healthy development of agricultural transgenic research and application in China is promoted.

Digital PCR is an emerging absolute quantitative analysis technique that has been developed following real-time quantitative PCR. The single DNA molecule is transferred into an independent reaction chamber, and after PCR amplification reaction, the fluorescent signal is detected and analyzed to realize the absolute quantification of the single molecule. The digital PCR technology gets rid of the dependence on a standard curve, has higher sensitivity and accuracy, and is widely applied to the aspects of gene mutation detection, copy number variation detection, microorganism detection, transgenic food detection, next generation sequencing and the like.

Disclosure of Invention

In order to solve the technical problems, the application aims to provide a digital PCR method for detecting the g10evo-epsps gene of the transgenic soybean, a specific primer pair and a probe designed according to the g10evo-epsps gene of the soybean are utilized to carry out digital PCR amplification, and the method has the advantages of good specificity, high accuracy and sensitivity and the like, and can be well applied to quantitative detection of the g10evo-epsps gene of the transgenic soybean.

In order to achieve the above object, the present application adopts the following technical solutions:

a digital PCR method for the detection of g10evo-epsps gene in transgenic soybean, comprising the steps of:

1) extracting transgenic soybean genomic DNA;

2) adding a PCR system and a microdroplet generating oil generating microdroplet into the microdroplet generating card, and transferring the generated microdroplet into a PCR tube for PCR amplification reaction; the PCR amplification primer pair and the probe sequence are as follows: forward primer F4: TTACCGTGAGAGGTGGTAGACCT, respectively; reverse primer R4: GTGGTATCACCCTCAGCGAAG, respectively; probe P4: 5 'FAM-ttccttcaccgacgcc-MGB 3'.

3) After amplification was complete, the 96-well plate was placed in a microdroplet reader to read the signal and the experimental data was analyzed using the software QuantaSoft Version 1.6.6.0320 to obtain absolute quantitative results.

Preferably, the method adopts a droplet type digital PCR reaction program that: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 15s, annealing at 60 ℃ for 45s, and performing 45 cycles at a temperature rate of 2 ℃/s; extending for 1min at 60 ℃; storing at 4 deg.C;

the PCR reaction system is as follows:

the technical scheme is adopted, so that the digital PCR method for detecting the g10evo-epsps gene of the transgenic soybean is provided, a specific primer pair and a probe designed for the g10evo-epsps gene of the soybean are adopted, the primer pair and the probe have high specificity and sensitivity, and the adopted digital PCR reaction technology has the advantages of higher accuracy and sensitivity than a real-time fluorescent quantitative PCR method, so that the method has a good development prospect in the application of detecting the g10evo-epsps gene of the transgenic soybean.

Drawings

FIG. 1 shows the standard curve of the fluorescent quantitative PCR of five primers.

FIG. 2 g10evo-epsps-4 fluorescent quantitative PCR results.

FIG. 3 g10evo-epsps primer probe concentration screen.

Figure 4 digital PCR annealing temperature optimized PCR amplification heatmap.

FIG. 5 Lectin-specific detection reaction heatmap.

FIG. 6g thermal map of the reaction detected specifically by 10evo-epsps transformants.

Detailed Description

Example 1 Experimental design of primer Probe sequences

After the g10evo-epsps gene was introduced into soybean, five sets of specific primer/probe sequences for the gene were designed, as shown in table 1.

TABLE 1 g10evo-epsps Gene primers and Probe sequences

F, forward primer, R, reverse primer, P: probe needle

Taking transgenic soybean g10evo-epsps as a sample, carrying out fluorescence quantitative PCR reaction by using five groups of g10evo-epsps gene primer pairs and probes, and simultaneously carrying out fluorescence quantitative PCR reaction on internal standard genes Lectin by using internal standard primers to respectively obtain five groups of g10evo-epsps standard curves and a group of Lectin standard curves, wherein the amplification efficiencies E of Lectin, g10evo-epsps-1, g10evo-epsps-2, g10evo-epsps-3, g10evo-epsps-4 and g10evo-epsps-5 are 93.6%, 92%, 91.8%, 94.9%, 93.3% and 99.9%, respectively, as shown in figure 1. According to the experimental result, the effects of the five primer probes are better, but compared with the inner standard gene Lectin primer probe, the amplification efficiency of the fourth pair of primer probes (g10evo-epsps-4) is closer to that of the inner standard gene primer probe, and in addition, according to the graph shown in figure 2, the quality of the fluorescent quantitative PCR amplification curve of the g10evo-epsps-4 primer is good, so that the g10evo-epsps-4 primer probe, namely the fourth pair of primer probes, is selected to carry out experiments such as establishment of a subsequent detection method, specificity and the like.

Example 2 digital PCR method

2.1 concentration screening of primer probes, optimization of reaction conditions

As shown in FIG. 3, transgenic soybean g10evo-epsps was used as a sample for detection, microdroplet digital PCR was performed by using several concentrations of primers/probes, the final concentration of the primers/probes in the reaction system was optimized, and different combinations of primer/probe concentrations were set as shown in Table 2. After the reaction efficiency is examined, the concentration of the primer for subsequent test of the project is determined to be 0.5 mu mol/L, and the concentration of the probe is determined to be 0.25 mu mol/L.

TABLE 2 primer Probe concentration ratios

The annealing temperature in the PCR reaction procedure has a significant influence on the raining phenomenon of the droplets, and in the annealing step of the reaction procedure, a temperature gradient is set, and the obtained data are shown in Table 3. As shown in FIG. 4, according to the heat map of the PCR reaction, there was a significant difference in the fluorescence intensity of the microdroplets between the g10evo-epsps and the Lectin genes at different annealing temperatures. Comparing the digital PCR amplification heat maps of different annealing temperatures, finding that when the annealing temperature is 60 ℃, no obvious rain phenomenon occurs, and determining the optimal annealing temperature of the digital PCR to be 60 ℃.

TABLE 3 optimization of different annealing temperatures

2.2 droplet digital PCR detection reaction System and procedure

Microdroplet digital PCR detection reaction system:

TABLE 4 microdroplet digital PCR detection reaction System

The reaction system can be properly adjusted according to the requirements of instruments.

PCR detection reaction procedure:

pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 15s, annealing at 60 ℃ for 45s, and performing 45 cycles at a temperature rate of 2 ℃/s; extending for 1min at 60 ℃; storing at 4 ℃.

Example 3 droplet digital PCR method specific detection

Soybean G10evo-epsps (G10), other transgenic soybean mixed samples (GTS40-3-2, MON89788, CV127, A5547-127, A2704-12, 305423, 356043, MON88302, 73496, MON87769, MON87705, FG72, DAS68416-4, with 1% of each transformant, with non-transgenic soybean as a filler), transgenic corn (Bt11, Bt176, MON810, MON863, GA 25, NK603, T25, TC1507, MON89034, MON88017, 59122, MIR604, 3272, MON87460, MIR162, 40278-9, double resistant 12-5, IE09S034, C0030.3.5, C0010.3.7, MON87427, 368747, with 1% of each transformant, with a non-transgenic corn stuffer (G3684, DAS-9, rice No. 7, transgenic corn accession No. F966, transgenic corn accession No. 7, transgenic corn No. 7, No., RF3, T45, oxy235, Topas19/2, MON88302, 73496, each transformant content is 1%, non-transgenic rape is used as a filling material), transgenic cotton (MON531, MON1445, MON15985, LLCOTTON25, MON88913, GHB614, COT102, each transformant content is 1%, non-transgenic cotton is used as a filling material) and non-transgenic soybeans are used as test samples, and the specificity detection of the g10evo-epsps soybeans is tested by using primers and a system. The detection results are shown in FIGS. 5 and 6, and show that only glyphosate-resistant soybean G10evo-epsps (G10) obtains a typical digital PCR amplification heat map, and the established microdroplet digital PCR method has good specificity. (Note: the double antibody 12-5 in transgenic maize contains g10evo-epsps gene, but because the primer probe designed in this patent is only directed to g10evo-epsps gene in soybean, the primer probe could not amplify in double antibody 12-5.)

The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present disclosure, including any person skilled in the art, having the benefit of the present disclosure. Various modifications to these embodiments will be readily apparent to those skilled in the art. The general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the application. Thus, the present application is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A digital PCR method for detecting a g10evo-epsps gene of transgenic soybean, which is characterized by comprising the following steps:

1) extracting transgenic soybean g10evo-epsps genome DNA;

2. The method of claim 1, wherein the method employs a digital PCR reaction program of the droplet type: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 15s, annealing at 60 ℃ for 45s, and performing 45 cycles at a temperature rate of 2 ℃/s; extending for 1min at 60 ℃; storing at 4 deg.C;

the PCR reaction system is as follows: