CN112251526A - Prediction, identification and prokaryotic expression method for tomato miR172a primary body encoding small peptide miPEP172a - Google Patents
Prediction, identification and prokaryotic expression method for tomato miR172a primary body encoding small peptide miPEP172a Download PDFInfo
- Publication number
- CN112251526A CN112251526A CN202011047766.7A CN202011047766A CN112251526A CN 112251526 A CN112251526 A CN 112251526A CN 202011047766 A CN202011047766 A CN 202011047766A CN 112251526 A CN112251526 A CN 112251526A
- Authority
- CN
- China
- Prior art keywords
- tomato
- small peptide
- mir172a
- mipep172a
- prokaryotic expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
- C12N2310/141—MicroRNAs, miRNAs
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Analytical Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Botany (AREA)
- Biomedical Technology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Mycology (AREA)
- Immunology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a method for predicting and identifying a small peptide miPEP172a encoded by a tomato miR172a primary body, which comprises the following steps: s1, designing a primer 1 by a precursor sequence; s2, extracting total RNA by taking DNA and cDNA of wild tomato early powder No.2 as templates, carrying out reverse transcription to synthesize cDNA by taking the total RNA as a template, and carrying out PCR amplification by taking tomatoes as templates and using a primer 2; s3, screening and identifying; the prokaryotic expression method comprises the following steps: s1, constructing a prokaryotic expression vector; s2, transforming escherichia coli competent cells by using the recombinant expression plasmids; s3, transforming escherichia coli; s4, inoculating the strain in a kanamycin culture medium, and then inducing. The identification prediction method provided by the invention solves the cost problem of the current screening method of the small peptide coded by the miRNA primary body, and makes the rapid and low-cost identification of the small peptide possible; the prokaryotic expression method provided by the invention obviously reduces the synthesis cost of the small peptide, is simple to operate and has important value for the mass production and application of the small peptide.
Description
Technical Field
The invention relates to the technical field of plant genetic engineering, in particular to a method for predicting, identifying and prokaryotic expressing a small peptide miPEP172a encoded by a tomato miR172a primary body.
Background
During the growth process of tomato plants, the tomato plants are often infected by pathogens such as fungi, oomycetes, viruses and bacteria, so that various diseases are caused, and great loss is brought to the production of tomatoes. In recent years, with the enlargement of the planting scale of facility tomatoes, the chances of sexual recombination among different pathogenic flora are increased, the mutation speed is accelerated, and the resistance of some varieties is lost. Therefore, it is important to excavate tomato disease-resistant molecules and find out the action mechanism. The method is beneficial to the cultivation of excellent tomato varieties and the improvement of disease-resistant measures, and plays a positive role in improving the yield, increasing the income of farmers and the like.
MicroRNA (miRNA) is non-coding small RNA and is 20-24 nucleotides in length. It is ubiquitous in plants, endogenous miRNA genes in cell nucleus are transcribed by RNA polymerase II under the drive of promoter to form primary transcription product pri-miRNA (primary miRNA transcript), then are sheared under the combined action of DGCR8 or Drosha protein and its accessory factor Pasha to form pre-miRNA with hairpin structure, then are transported from cell nucleus to cytoplasm through nucleoplasm transporter Exportin-5, and are processed into miRNA/miRNA double-stranded complex through Dicer or TRBP. Subsequently, one strand of the helicized double-stranded complex is selectively bound to an RNA-mediated silencing complex RISC (RNA-induced silencing complex) to form a mature miRNA. Mature miRNA is combined with a plurality of target genes through complementary pairing, and acts with AGO1 to shear the target genes or repress the translation of the target genes, and the expression of the target genes is regulated at the level of transcription or posttranscription, thereby influencing the disease resistance and stress resistance of tomato.
In recent years, with the intensive research on the miRNA in the plant body, some pri-miRNAs are successively discovered to be capable of coding small peptides and have functions, and the plant plays various regulating roles in the growth and development process. Researchers report for the first time that alfalfa pri-miR171b can encode and generate a small peptide (miPEP) capable of promoting the expression of a corresponding mature body miRNA and further inhibiting the transcription of a downstream target gene. Researchers have conducted related studies on a plurality of pri-miRNAs of Arabidopsis thaliana, and similar phenomena have been found. In addition, the current research shows that the open reading frame beginning with the first ATG at the end of pri-miRNA 5' is often the coding sequence of a small peptide. The discovery of miPEP changes the view that pri-miRNA is not encoded in the traditional concept, opens up a new field for gene regulation research, and particularly provides a new action mode for the regulation of miRNA. And subsequent researchers use artificially synthesized miPEP172c to treat soybeans in vitro to stimulate the expression of miR172c, so that the nodulation process of the soybeans is promoted, and the finding shows that the miPEP also has important application value for agricultural production. Although studies on the role of small peptides encoded by smORFs in plant growth and development and in stress and disease resistance have been reported, unfortunately, we still have little knowledge about the small peptides generated by the pri-miRNA.
miR172 is a conserved miRNA molecule in plants that has been identified in many plants since first discovered in arabidopsis to date. This family mainly comprises two members: miR172a and miR172 b. miR172 in plants mainly targets one type of APETALA2(AP2) protein which is an important member in an AP2/ERF transcription factor family and plays an important role in the processes of plant growth and development and stress resistance. The screening, identification and expression application of the small peptide (miPEP172a) coded by the miR172 primary body in tomato have important theoretical and production values, however, the existing identification method of the small peptide coded by the miRNA primary body is high in cost, and no related prokaryotic expression method exists at present, so that the production and application of the small peptide in agriculture are limited. Therefore, it is urgent to provide a method for predicting, identifying and prokaryotic expression of a small peptide encoded by tomato miR172a primary body, which has low cost and can be produced in large scale.
Disclosure of Invention
The invention provides a method for predicting, identifying and prokaryotic expression of a small peptide miPEP172a encoded by a tomato miR172a primary body, which aims to solve the problems that the existing method for identifying the small peptide encoded by the miRNA primary body is high in cost and the production and application of the small peptide in agriculture are limited because a related prokaryotic expression method is not available at present.
In order to realize the purpose, the invention provides tomato miR172a, the mature body sequence of which is shown as SEQ ID NO.1, and the precursor sequence of which is shown as SEQ ID NO.2, and provides a method for predicting, identifying and prokaryotic expressing a small peptide miPEP172a encoded by a primary body of the tomato miR172 a.
The method for predicting and identifying the small peptide miPEP172a encoded by the tomato miR172a primary body comprises the following steps:
s1, designing a specific primer 1 for a miR172a precursor sequence SEQ ID NO. 2:
upstream primers 172 a-F: CCAAGCTTGGTACTAGTGCAAATATCTACATTCA, respectively;
downstream primers 172 a-R: CGGGATCCCGTCTCGTGAGTTTCAAATAGC, respectively;
s2, performing PCR amplification by using DNA and cDNA of wild tomato early powder No.2 as templates:
extracting total tomato RNA, performing reverse transcription to synthesize cDNA as a template, and performing PCR amplification by using the tomato cDNA and the DNA as templates and using a specific primer 2;
the specific primers 2 are as follows:
the upstream primer 172 a-1-F: CCAAGCTTGGCTTCCTTCGTTTGGTATTGT, respectively;
downstream primer 172 a-1-R: CGGGATCCCGGTGAGTTTCAAATAGCCAGC, respectively;
the upstream primer 172 a-2-F: CCAAGCTTGGCAATAGATGTCGTAATCCGTG, respectively;
downstream primer 172 a-2-R: CGGGATCCCGCTCGTGAGTTTCAAATAGCC, respectively;
the upstream primer 172 a-3-F: CCAAGCTTGGTACTAGTGCAAATATCTACATTCA, respectively;
downstream primer 172 a-3-R: CGGGATCCCGTCTCGTGAGTTTCAAATAGC, respectively;
the upstream primer 172 a-4-F: AAAGGAATCAGCAGTCTTCA, respectively;
downstream primer 172 a-4-R: GCTGGCTATTTGAAACTCAC, respectively;
the upstream primer 172 a-5-F: CTTCAATTAATTAATTATAGACTA, respectively;
downstream primer 172 a-5-R: GCTGGCTATTTGAAACTCAC, respectively;
s3 and the prediction of the open reading frame of the small peptide miPEP172a coded by the primary body of the miR172a are combined for screening and identification.
Preferably, the open reading frame prediction criteria in step S3 include: the initiation codon is ATG, the open reading frame is positioned at the 5' end of the primary body sequence of miR172a, the length of the open reading frame is between 12 and 303 nucleotides, and the open reading frame conforms to the triplet codon rule.
A prokaryotic expression method for encoding a small peptide miPEP172a by a tomato miR172a primary body comprises the following steps:
s1, connecting a candidate coding sequence of miPEP172a to a vector to construct a prokaryotic expression vector;
s2, transforming escherichia coli competent cells by using the recombinant expression plasmids;
s3, extracting plasmid of the transformed positive competent cell DH5 alpha to transform escherichia coli BL 21;
s4, inoculating the transformed escherichia coli BL21 bacterial colony to a culture medium with a kanamycin concentration of 50mg/L for culturing at 37 ℃ for 8-12h, transferring the bacterial colony into the culture medium with the kanamycin concentration of 50mg/L for culturing at 37 ℃ until OD600 is 0.6, adding isopropyl-beta-D-thiogalactoside to the final concentration of 0.5mmol/L, inducing, boiling at 100 ℃ for 10min, centrifuging at 12000r/min for 10min, and taking the centrifuged supernatant to realize prokaryotic expression of the small peptide miPEP172a nucleic acid encoded by the tomato miR172a primary body.
Preferably, the vector in step S2 is pet32 a.
Preferably, the escherichia coli competent cell in step S2 is DH5 α.
Preferably, the induction temperature in step S4 is 33 ℃.
The invention realizes the mass acquisition of small peptides by constructing an expression vector and by means of a prokaryotic expression technology, and greatly reduces the production cost of the prior art. The identification prediction method provided by the invention solves the cost problem of the current screening method for the small peptide coded by the miRNA primary body, enables the rapid and low-price identification of the small peptide to be possible, and provides a basis for the research of the small peptide coded by the miRNA primary body in other plants; the prokaryotic expression method provided by the invention obviously reduces the synthesis cost of the small peptide, is simple to operate and has important value for the mass production and application of the small peptide.
Drawings
FIG. 1 is a diagram of a segmented PCR agarose gel electrophoresis of a pre-miR17a precursor upstream sequence of the present invention;
FIG. 2 is an SDS-PAGE protein electrophoresis of a miPEP172a prokaryotic expression sample of the present invention.
Detailed Description
The present invention will be described in further detail with reference to the accompanying drawings and examples.
In order to make the objects, schemes, procedures and advantages of the present invention more clear, the present invention is further described in detail with reference to the embodiments, which should be construed as merely illustrative and not limitative. In the following examples, unless otherwise specified, the experimental procedures used were all conventional.
Example one
Predictive identification of small peptide encoded by tomato miR172a primary body
1. Obtaining upstream 1500bp sequence of tomato pre-miR172a
Using the sequence of tomato pre-miR172a as a template, and using BLAST program to align with tomato genome sequence, the alignment result shows that the pre-miR172a is located on 42922097 and 422922202 of chromosome 6, thereby extracting the upstream 1500bp (42920597 and 42922096) sequence. The DNA molecule sequence of the first 1500bp is shown in SEQ ID NO. 3.
2. Prediction of tomato pre-miR172a upstream sequence open reading frame
And predicting an open reading frame of a sequence 1500bp upstream of pre-miR172a by using a get-orf tool to obtain all possible small peptide coding sequences in the range. The prediction criteria include: the initiation codon is ATG, the open reading frame is positioned at the 5' end of the primary body sequence of miR172a, the length is between 12 and 303 nucleotides, and the triplet codon rule is met.
3. Extraction of tomato DNA
(1) About 0.1g of tomato leaves are cut and quickly placed in a mortar, and liquid nitrogen is added to the tomato leaves and fully ground until powder is obtained.
(2) Adding the sample into 700 μ L GP1 buffer solution with preheating temperature of 65 ℃, quickly reversing and mixing uniformly for 6 times, placing the centrifuge tube in a water bath with the temperature of 65 ℃ for 20min, and reversing the centrifuge tube for multiple times in the water bath process to mix the sample uniformly.
(3) mu.L of chloroform was added to the mixture after the water bath, and after mixing by inversion for 6 times, the mixture was centrifuged at 12000rpm for 5 min.
(4) The centrifuged upper aqueous phase was aspirated into a new centrifuge tube, and 700. mu.L of GP2 buffer was added thereto and mixed well 6 times.
(5) The mixed solution was transferred to an adsorption column CB3, centrifuged at 12000rpm for 1min, and then the waste solution was discarded.
(6) mu.L of GD buffer was added to the adsorption column CB3, centrifuged at 12000rpm for 1min, and the waste liquid was discarded.
(7) mu.L of the rinsing solution PW was added to an adsorption column CB3, centrifuged at 12000rpm for 1min, and the waste solution was discarded.
(8) And (5) repeating the step (7) until impurities including ethanol and the like on the adsorption column are collected into the centrifugal tube by centrifugation.
(9) And (4) putting the adsorption column back into the collection tube, centrifuging at 12000rpm for 2min, discarding waste liquid, and standing at room temperature until the PW remained in the adsorption column is dried.
(10) The adsorption column is placed in a new centrifuge tube, 50 mu L of ddH2O with the preheating temperature of 50 ℃ is dripped into the center of the adsorption column membrane, the adsorption column membrane is placed at room temperature for 2-5min, the adsorption column membrane is centrifuged at 12000rpm for 2min, then the liquid at the bottom of the adsorption column membrane is transferred to the adsorption column CB3 again, the adsorption column membrane is centrifuged at 12000rpm for 2min, and the liquid collected at the bottom of the adsorption column membrane is tomato genomic DNA.
4.PCR amplification of tomato pre-miR172a upstream sequence
A primer is designed for a miR172a precursor sequence, namely SEQ ID NO.2, DNA of tomato early powder No.2 is used as a template, and a specific primer is applied to carry out PCR amplification.
The specific primers used were as follows:
172a-F：CCAAGCTTGGTACTAGTGCAAATATCTACATTCA
172a-R：CGGGATCCCGTCTCGTGAGTTTCAAATAGC
the reaction conditions were as follows:
4, recovery and purification of PCR amplification product
After detecting the above PCR product by 1% agarose gel electrophoresis, the PCR product corresponding to the size of the target fragment was recovered by using a gel cutting recovery kit (purchased from Takara).
5. The target fragment is ligated to a cloning vector
The target fragment recovered above was ligated with the cloning vector pMD-19T (purchased from Takara) in the following reaction system:
and (3) connecting for 8h at 16 ℃ to obtain a connecting product.
6. Transformation of E.coli by ligation products
(1) Adding 10 μ L of the ligation product into 200 μ L of Escherichia coli competent cells, blowing, beating, and mixing, and performing ice water bath for 30 min;
(2) immediately transferring the mixed solution after the ice-water bath into a water bath kettle at 42 ℃, and carrying out ice-water bath again for 2min after 90 s;
(3) adding 1mL of fresh LB culture medium into the mixed solution, and carrying out shaking culture for 1.5h at 180rpm in a constant temperature shaking table at 37 ℃;
(4) centrifuging the bacterial liquid at 4000r/min for 10min, sucking 1mL of supernatant, leaving 200 μ L of bacterial liquid, fully blowing, suspending, uniformly coating on an LB plate (containing 100mg/L ampicillin, 24mg/L IPTG and 20mg/L X-Gal), and culturing in a constant-temperature incubator at 37 ℃ overnight;
(5) white single colonies were picked, inoculated into LB liquid medium (containing 100mg/L ampicillin), and cultured overnight with shaking at 180rpm in a 37 ℃ constant temperature shaker.
7. Extraction of plasmids
The target plasmid contained in the above-mentioned bacterial solution was extracted according to the instructions of a plasmid extraction kit (purchased from TIANGEN). 5 μ L of plasmid samples were subjected to 1% agarose gel electrophoresis for detection.
8. Sequencing
And (3) sequencing the obtained plasmid, comparing the obtained plasmid with a genome sequence, judging whether a target sequence is obtained by cloning, and determining whether the sequence of the target fragment obtained by cloning is the same as the genome sequence by sequencing.
9. Extraction of tomato Total RNA
(1) The sample was placed in a mortar, and liquid nitrogen was added and ground thoroughly to a powder.
(2) Taking a proper amount of powder, placing the powder in a 1.5mL RNase/DNase Free centrifuge tube, simultaneously quickly adding 1mL of Trizol with precooling temperature of 4 ℃, shaking up, and standing for 5min at room temperature.
(3) Adding 200 μ L chloroform into the centrifuge tube, shaking, standing at room temperature for 5min, centrifuging at 4 deg.C and 12000r/min for 15 min.
(4) Transferring the supernatant to a new centrifuge tube, adding isopropanol with the same volume, slightly inverting and mixing, standing at-20 ℃ for 20min, and centrifuging at 12000r/min at 4 ℃ for 10 min.
(5) Discarding supernatant, adding 1mL of 75% ethanol with precooling temperature of 4 deg.C, washing precipitate, and centrifuging at 4 deg.C and 12000r/min for 5 min.
(6) Carefully discard the supernatant, leave the flask open at room temperature, add 20. mu.L of RNase Free dH after ethanol has evaporated completely2And dissolving the precipitate by using O.
(7) Take 5. mu.L of RNA, detect by 1% agarose gel electrophoresis.
10. Synthesis of tomato cDNA
Reverse transcription was performed using total RNA as a template, and the procedure was performed using Reverse Transcriptase M-MLV (RNase H-) (purchased from Takara) according to the instruction manual.
11. Segmented PCR of tomato pre-miR172a upstream sequence
Tomato cDNA and DNA are used as templates, and specific primers are applied to carry out PCR amplification.
The specific primers used were as follows:
172a-1-F：CCAAGCTTGGCTTCCTTCGTTTGGTATTGT
172a-1-R：CGGGATCCCGGTGAGTTTCAAATAGCCAGC
172a-2-F：CCAAGCTTGGCAATAGATGTCGTAATCCGTG
172a-2-R：CGGGATCCCGCTCGTGAGTTTCAAATAGCC
172a-3-F：CCAAGCTTGGTACTAGTGCAAATATCTACATTCA
172a-3-R：CGGGATCCCGTCTCGTGAGTTTCAAATAGC
172a-4-F：AAAGGAATCAGCAGTCTTCA
172a-4-R：GCTGGCTATTTGAAACTCAC
172a-5-F：CTTCAATTAATTAATTATAGACTA
172a-5-R：GCTGGCTATTTGAAACTCAC
the reaction conditions were as follows:
12. screening tomato miPEP172a coding sequence
The segmented PCR amplification result in the step 11 shows that the 5' end initiation site of the primary body of the miR172 is positioned in the range of 1000-1500bp at the upstream of the precursor thereof, and the coding sequence of the miPEP172a is determined by combining the prediction result of the open reading frame in the step 2.
Example two: prokaryotic expression of small peptide encoded by tomato miR172a primary body
1. The candidate coding sequence of mippe 172a was ligated to pet32a vector to construct a prokaryotic expression vector.
2. The recombinant expression plasmid pet32a-miPEP172a is transformed to obtain an Escherichia coli competent cell DH5 alpha containing the expression plasmid pet32a-miPEP172a, and a large amount of target plasmids are amplified through DH5 alpha.
3. The plasmid from which the transformed positive competent cell DH 5. alpha. was extracted was transformed into E.coli BL21(DE 3).
4. The transformed escherichia coli BL21 bacterial colony is coated on an LB solid culture medium containing 50mg/L kanamycin, and a single bacterial colony is selected for carrying out bacterial liquid PCR verification; inoculating a correctly verified escherichia coli BL21 bacterial colony in an LB liquid culture medium containing kanamycin at 37 ℃ for 8-12h, then sucking 500 mul of bacterial liquid, transferring the bacterial liquid into the LB liquid culture medium with 50mg/L of kanamycin and 50mL of volume, culturing at 37 ℃ until OD600 is 0.6, then adding isopropyl-beta-D-thiogalactoside (IPTG) until the final concentration of the isopropyl-beta-D-thiogalactoside in the culture solution is 0.5mmol/L, then placing the culture solution in an environment at 33 ℃ for induction for 6h, then taking the bacterial liquid, boiling at 100 ℃ for 10min, centrifuging at 12000r/min for 10min, and taking a centrifugal supernatant to realize prokaryotic expression of the nucleic acid of the small peptide coded by the tomato miR172 primary body 172 a.
The above description is only for the preferred embodiment of the present invention, but the scope of the present invention is not limited thereto, and any person skilled in the art should be able to cover the technical solutions and the inventive concepts of the present invention within the technical scope of the present invention.
Sequence listing
<110> university of Large Community
<120> prediction, identification and prokaryotic expression method of small peptide miPEP172a encoded by tomato miR172a primary body
<141> 2020-09-29
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213> Artificial sequence
<400> 1
agaatcttga tgatgctgca t 21
<210> 2
<211> 106
<212> DNA
<213> Artificial sequence
<400> 2
atgtggcata atcaagattc acgtgaaaag ttgcaaattg gttatataat tgatgaaatt 60
aatggctggc tatttgaaac tcacgagaat cttgatgatg ctgcat 106
<210> 3
<211> 1500
<212> DNA
<213> Artificial sequence
<400> 3
taatttaatg aggtagaata tatattagtt atcgtggtaa gtgagaaata cttttatata 60
aatacatata catatcaatt tttttattta cttttgttta tcatatttta atttaacaca 120
cttatattaa gaaaatgtac atcagtcatt cttattaaca gtaaatttaa tgcttttaga 180
tttcaaagta agttttatgc aaaaggcaat agacattgcg tcatcttgaa ttttatattc 240
cattttctga aattatggat tattgaaaaa ttgtatgttt tctttatttc aacttcaatt 300
aattaattat agactaattg ttttttatta ataatttatg ttgctaatta ttgtaaaaag 360
gaaatggggt caatagatgt cgtaatccgt gattaaacaa ggtctagtcc aaataccatg 420
aaaaggaatc agcagtcttc atatgatcct ttcatatcat atcaaatatt gtttcatttt 480
actgtttatt tcaataaatt atgaggattt ttccatatta tgtttaatat taaatactta 540
tataaaataa tagcaacatt caaatttaaa atttcaaata tcattaacca tattaatcta 600
ataaaataca catctaatta ttttttaggt ggtacgtgtt acttcaacat agaccaaata 660
ctatgaaacg aagggagtgt atatatttta agctggctat ttttttttta ccttattcat 720
tactttttag atgtataccc tctacttttt ttcctctgtt tcatattaat tgtgtacgtt 780
attatgaata gatatttaaa ttattcgtca atttataaaa ttaagataag tttaattatc 840
tgtttcttat tttatcttta taatactttc ttttataaaa aaaaaagtgt aaacaagttt 900
gtaaagttaa aaaagatttc tgtaaattag tacttccttc gtttggtatt gtttgtgatg 960
gtttctattt ttagagtcta actataaaaa ctttgactaa cattttaata tgtatttgtt 1020
catcatatta gtatacaaaa aattgtaatt tataatactt ttcatatagt tttagaatat 1080
ctaatttttt ttatttaaaa tattaaatta atgtaatcta atttactttt gaaaatttat 1140
caaattgact ttcgataagc ataacatgac aaataattcc gaacgaagaa agtaataaaa 1200
ttatcatgca tttctcgtgt tcaatggaaa aatagacaac taatatgttt aataggagac 1260
ggagaaaaat atttctcttt ctaaacaaat tgaatagagt ttgcttttgt tttcttcttc 1320
ttgttttttg aaaattacga aaacagcagt taatagattc taattgtttg ataccctcat 1380
agcataggca ttagagccac acgtttagtc tcctcctata tatatgtggc atatctaatc 1440
acataatata tacaaatata gataaaaaaa aaatattttt cttacagtcg ttgtttgcat 1500
Claims (6)
1. A method for predicting and identifying a small peptide miPEP172a encoded by a tomato miR172a primary body is characterized by comprising the following steps of:
s1, designing a specific primer 1 for a miR172a precursor sequence SEQ ID NO. 2:
upstream primers 172 a-F: CCAAGCTTGGTACTAGTGCAAATATCTACATTCA, respectively;
downstream primers 172 a-R: CGGGATCCCGTCTCGTGAGTTTCAAATAGC, respectively;
s2, performing PCR amplification by using DNA and cDNA of wild tomato early powder No.2 as templates:
extracting total tomato RNA, performing reverse transcription to synthesize cDNA as a template, and performing PCR amplification by using the tomato cDNA and the DNA as templates and using a specific primer 2;
the specific primers 2 are as follows:
the upstream primer 172 a-1-F: CCAAGCTTGGCTTCCTTCGTTTGGTATTGT, respectively;
downstream primer 172 a-1-R: CGGGATCCCGGTGAGTTTCAAATAGCCAGC, respectively;
the upstream primer 172 a-2-F: CCAAGCTTGGCAATAGATGTCGTAATCCGTG, respectively;
downstream primer 172 a-2-R: CGGGATCCCGCTCGTGAGTTTCAAATAGCC, respectively;
the upstream primer 172 a-3-F: CCAAGCTTGGTACTAGTGCAAATATCTACATTCA, respectively;
downstream primer 172 a-3-R: CGGGATCCCGTCTCGTGAGTTTCAAATAGC, respectively;
the upstream primer 172 a-4-F: AAAGGAATCAGCAGTCTTCA, respectively;
downstream primer 172 a-4-R: GCTGGCTATTTGAAACTCAC, respectively;
the upstream primer 172 a-5-F: CTTCAATTAATTAATTATAGACTA, respectively;
downstream primer 172 a-5-R: GCTGGCTATTTGAAACTCAC, respectively;
s3 and the prediction of the open reading frame of the small peptide miPEP172a coded by the primary body of the miR172a are combined for screening and identification.
2. The method for predicting and identifying the small peptide miPEP172a encoded by the tomato miR172a precursor according to claim 1, wherein the open reading frame prediction standard in the step S3 comprises: the initiation codon is ATG, the open reading frame is positioned at the 5' end of the primary body sequence of miR172a, the length of the open reading frame is between 12 and 303 nucleotides, and the open reading frame conforms to the triplet codon rule.
3. A prokaryotic expression method for encoding a small peptide miPEP172a by a tomato miR172a primary body is characterized by comprising the following steps:
s1, connecting a candidate coding sequence of miPEP172a to a vector to construct a prokaryotic expression vector;
s2, transforming escherichia coli competent cells by using the recombinant expression plasmids;
s3, extracting plasmid of the transformed positive competent cell DH5 alpha to transform escherichia coli BL 21;
s4, inoculating the transformed escherichia coli BL21 bacterial colony to a culture medium with a kanamycin concentration of 50mg/L for culturing at 37 ℃ for 8-12h, transferring the bacterial colony into the culture medium with the kanamycin concentration of 50mg/L for culturing at 37 ℃ until OD600 is 0.6, adding isopropyl-beta-D-thiogalactoside to the final concentration of 0.5mmol/L, inducing, boiling at 100 ℃ for 10min, centrifuging at 12000r/min for 10min, and taking the centrifuged supernatant to realize prokaryotic expression of the small peptide miPEP172a nucleic acid encoded by the tomato miR172a primary body.
4. The prokaryotic expression method for encoding the small peptide miPEP172a from tomato miR172a precursor as claimed in claim 3, wherein the vector in step S2 is pet32 a.
5. The prokaryotic expression method of the small peptide miPEP172a encoded by tomato miR172a precursor according to claim 3, characterized in that the escherichia coli competent cell in step S2 is DH5 α.
6. The prokaryotic expression method for encoding the small peptide miPEP172a from tomato miR172a precursor according to claim 3, characterized in that the induction temperature in step S4 is 33 ℃.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011047766.7A CN112251526A (en) | 2020-09-29 | 2020-09-29 | Prediction, identification and prokaryotic expression method for tomato miR172a primary body encoding small peptide miPEP172a |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011047766.7A CN112251526A (en) | 2020-09-29 | 2020-09-29 | Prediction, identification and prokaryotic expression method for tomato miR172a primary body encoding small peptide miPEP172a |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112251526A true CN112251526A (en) | 2021-01-22 |
Family
ID=74233368
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011047766.7A Pending CN112251526A (en) | 2020-09-29 | 2020-09-29 | Prediction, identification and prokaryotic expression method for tomato miR172a primary body encoding small peptide miPEP172a |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112251526A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117683103A (en) * | 2023-11-24 | 2024-03-12 | 南京林业大学 | Small peptide miPEP166i and application thereof in plant tissue culture |
-
2020
- 2020-09-29 CN CN202011047766.7A patent/CN112251526A/en active Pending
Non-Patent Citations (1)
| Title |
|---|
| DOMINIQUE LAURESSERGUES等: "Primary transcripts of microRNAs encode regulatory peptides", 《NATURE》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117683103A (en) * | 2023-11-24 | 2024-03-12 | 南京林业大学 | Small peptide miPEP166i and application thereof in plant tissue culture |
| CN117683103B (en) * | 2023-11-24 | 2024-05-14 | 南京林业大学 | Small peptide miPEP i and application thereof in plant tissue culture |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105647943B (en) | Saussurea involucrate cell squalene synthase gene SiSQS and coded product and application thereof | |
| CN112029774B (en) | Chaperonin for enhancing plant phloem RNP signal communication and application | |
| CN114891803B (en) | Ginseng PgWRKY40 gene induced by methyl jasmonate and application thereof | |
| CN110684776B (en) | Penaeus monodon Na+/K+/2Cl-Cotransporter NKCC gene and application thereof | |
| CN116970623A (en) | Gene segment for preventing and controlling wheat stem-based rot and application thereof | |
| CN112251526A (en) | Prediction, identification and prokaryotic expression method for tomato miR172a primary body encoding small peptide miPEP172a | |
| CN110129318B (en) | Long-chain non-coding RNA PRALR, expression plasmid and application thereof | |
| CN116855529B (en) | Application of OsbHLH186 gene in improving rice grain type | |
| CN116732041B (en) | Lethal gene and RNA interference sequence for preventing and controlling myzus persicae by RNA interference and preparation method thereof | |
| CN113025724B (en) | Dual PCR primer, method and kit for identifying small pissodes punctatus | |
| CN114561411A (en) | Dicer1 gene and application of dsRNA thereof in pest control | |
| CN104894150B (en) | Saussurea involucrate cell phenylalanine ammonia lyase gene SiPAL and encoding product and application thereof | |
| CN108998548B (en) | Primer and method for detecting expression characteristics of TnT gene of agasicles hygrophila | |
| CN110551702B (en) | Recombinant aspergillus tubingensis tannase and expression and application thereof | |
| CN114085838A (en) | Potato stu-miRn220 and application thereof | |
| CN111549028A (en) | shRNA and application thereof | |
| CN112195178A (en) | Tomato late blight-resistant long-chain non-coding RNA-lncRNA40787 and cloning method and application method thereof | |
| CN112359045A (en) | Carotenoid metabolic pathway related gene and application thereof | |
| CN110066799A (en) | Target dsRNA and the application of Tetranychus cinnabarinus molting hormone acceptor gene EcR | |
| CN112210555B (en) | Tomato late blight resistant gene Sly-miR166b and cloning method and application method thereof | |
| CN115678903B (en) | Sogatella furcifera Ago1 gene, method for synthesizing dsRNA and application thereof | |
| CN111662369B (en) | Apolygus linens receptor substrate 1 gene and application thereof | |
| CN111304197A (en) | Long-chain non-coding RNA gene of beet under alkali stress resistance and preparation method and application thereof | |
| CN109055506B (en) | Primer and method for detecting LIM gene transcription level of agasicles hygrophila | |
| CN110373419B (en) | Application of cotton GhMADS44-A03 gene in promoting plant flowering |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20210122 |
|
| RJ01 | Rejection of invention patent application after publication |