CN112251521A - Universal primer and kit for detecting babesia within tiger or tick - Google Patents
Universal primer and kit for detecting babesia within tiger or tick Download PDFInfo
- Publication number
- CN112251521A CN112251521A CN202011173152.3A CN202011173152A CN112251521A CN 112251521 A CN112251521 A CN 112251521A CN 202011173152 A CN202011173152 A CN 202011173152A CN 112251521 A CN112251521 A CN 112251521A
- Authority
- CN
- China
- Prior art keywords
- bab
- round
- primers
- pcr
- tick
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6893—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for protozoa
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6848—Nucleic acid amplification reactions characterised by the means for preventing contamination or increasing the specificity or sensitivity of an amplification reaction
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Tropical Medicine & Parasitology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a universal primer and a kit for detecting babesia within southwestern tiger or tick, which comprises two groups of primers, namely, Bab-1 and Bab-2, and Bab-3 and Bab-4ColpodellaCausing erroneous judgment.
Description
Technical Field
The invention belongs to the technical field of parasite molecule detection, and particularly relates to a universal primer and a kit for detecting babesia within tiger huanan or tick.
Background
The plum blossom mountain area in Fujian province has a unique plum blossom mountain south China tiger garden (China tiger garden) in China, the south China tiger is a conservation animal which is endangered by an absolute species, although the plum blossom mountain area contains vast grasslands, the mountain area also contains a plurality of kinds of ticks, the ticks can penetrate through biting hosts to transmit pathogens, such as rickettsia, babesia and the like, so that the hosts are usually dead, and the blood separated from the dead south China tiger contains the babesia and the rickettsia on several cases before.
The current detection of Babesia filaria uses few universal primers, so far only two sets of universal primers (Bab-5 and Bab-6 and Bab-7 and Bab-8) used in nested PCR are used to detect Babesia filaria 18S rRNA, but the use of the primers in this set has the disadvantages: easily detect blood protozoa of sister genusColpodella. In view of the above, it is urgent to develop a universal primer for detecting babesia and use the nested PCR technique to detect whether the pathogen exists in the blood of south China tiger or to detect the tick insect carrying the pathogen, and it is also one of the ways to prevent south China tiger from being endangered and extincted, and it can be used as the data basis for the epidemiological investigation of the tick insect later.
Disclosure of Invention
The invention aims to provide a universal primer and a kit for detecting babesia within southwestern tiger or tick, which increase the accuracy and positive proportion of rapidly screening and detecting the babesia within host southwestern tiger and tick, and avoid detecting the blood protozoa of babesia sisterColpodellaCausing erroneous judgment.
In order to achieve the purpose, the invention adopts the technical scheme that:
the universal primers for detecting babesia within tiger or tick comprise two groups of primers, and specifically comprise the following primers:
a first set of primers:
Bab-1: 5’-ATCTAAGGAAGGCAGCAGGC -3’
Bab-2: 5’- GAAACGTCCTTGGCAAATGC -3’
a second set of primers:
Bab-3: 5’- GTGACAAGAAATAACAATAC-3’
Bab-4: 5’- ACTAAGGTTCAATAACCAAC -3’。
the nested PCR identification method adopting the universal primer for detecting the babesia sinensis in the south China tiger or the tick comprises the following steps:
1) performing a first round of PCR by using the genomic DNA of the blood sample or the tick sample of the southwestern tiger as a template and the Bab-1 and Bab-2 as the first round of primers in claim 1;
2) performing a second round of PCR by using the DNA of the first round of PCR as a template and the Bab-3 and Bab-4 primers as described in claim 1 as second round primers;
3) taking the second round of PCR products for 1% agarose gel electrophoresis identification;
4) performing sequence determination on the second round PCR product;
5) and carrying out systematic evolution analysis according to the babesia gene sequence recorded in the NCBI database to finally obtain a sample identification result.
The reaction conditions of the first round of PCR are as follows: pre-denaturation at 95 deg.C for 5 min, denaturation at 95 deg.C for 1min, annealing at 56 deg.C for 1min, extension at 72 deg.C for 30s, performing 35 cycles, and extension at 72 deg.C for 10 min;
the reaction conditions of the second round of PCR are as follows: pre-denaturation at 95 deg.C for 5 min, denaturation at 95 deg.C for 1min, annealing at 56 deg.C for 45s, extension at 72 deg.C for 1min, performing 35 cycles, and extension at 72 deg.C for 10 min.
The kit for detecting the babesia sinensis in the south China tiger or tick comprises the universal primer.
The technical idea of the invention is as follows: because the nested PCR technology is used for detecting the existence of the babesia in the ticks, the defect that the babesia still has false positive is overcome, 1) primers of DNA fragments in different regions on a genome are matched, 2) whole genome sequencing is carried out, and the existence of the pathogen can be really confirmed only by confirming the existence of the pathogen again. The inventors designed two sets of universal primers for babesia according to the NCBI website of the national institutes of health with reference to the 18S rRNA sequence of babesia to perform nested PCR, one round of reaction: bab-1: 5'-ATCTAAGGAAGGCAGCAGGC-3', Bab-2: 5'-GAAACGTCCTTGGCAAATGC-3'; carrying out two-round reaction: bab-3: 5'-GTGACAAGAAATAACAATAC-3' and Bab-4: 5'-ACTAAGGTTCAATAACCAAC-3', and a 392 bp DNA product fragment is predicted to be obtained, and then the two groups of original universal primers (Bab-5 and Bab-6, Bab-7 and Bab-8) are matched, so that the proportion of detecting the positive band of Babesia filariana can be increased, unnecessary sequencing time can be reduced, and great help is brought to rapid screening.
The inventor team extracts DNA from more than one thousand ticks in different areas of the Fujian plum blossom mountain area by using a kit for extracting the DNA in tick tissue, then uses the primers to carry out nested PCR technology to detect the existence of babesia in the ticks, and verifies whether the babesia is true positive again by using known universal primers or a whole genome sequencing mode to calculate the accuracy of the universal primers, and if the accuracy reaches more than nine times, the kit can be developed into the detection kit of the babesia.
The invention has the following advantages:
1) the GC ratio of the primers is optimized, namely, the first round of reaction shows that 11 GC exist in the primer part Bab-1, 10 GC exist in the primer part Bab-2, 6 GC exist in the Bab-3 and 7 GC exist in the Bab-4 in the second round of reaction, the GC values are similar, the primers are easy to adhere to the template in the low-temperature annealing step of the PCR reaction, and the amplification efficiency is relatively improved.
2) Bab-6 and Bab-7 primer sequences are finally ended by AT, and the biochemical view shows that the hydrogen bond bonding between A and T is two hydrogen bond bonding, the four primers of the invention are all ended by G-C, and the G-C is three hydrogen bond bonding, therefore, the invention is more stable than the existing primers, the PCR bonding step is relatively stable, and the PCR amplification efficiency can be relatively improved.
Drawings
FIG. 1 shows the result of nested PCR identification using the primers of the present invention.
FIG. 2 shows the use of blood protozoaColpodellaThe result of nested PCR identification of the primers (a) and (b).
Detailed Description
Firstly, sample source:
tick samples were all from the southern China tiger breeding base in Meishan mountain. Blood protozoaColpodellaSamples were cryopreserved using EDTA anticoagulant tubes. The tick sample is stored at low temperature of 4 ℃ by using a 50 mL centrifuge tube
II, an experiment step:
1. tick DNA extraction
1.1 carefully taking out the tick sample from the centrifuge tube by using tweezers, placing the tick sample in a glass plate, washing and soaking the tick sample in absolute ethyl alcohol for 10 minutes, repeating the washing and soaking for 2 times, and airing the tick sample at room temperature. 30 mg tick samples were cut and placed into 1.5 mL centrifuge tubes.
1.2 Add 200. mu.L of buffer GA and mix well with shaking.
1.3 Add 20. mu.L of protease K solution and mix well. Digestion was carried out overnight in a 56 ℃ water bath.
1.4 Add 200. mu.L buffer GB, mix well by inversion, and stand at 70 ℃ for 10 minutes.
1.5 Add 200. mu.L of absolute ethanol and mix well by shaking for 15 seconds.
1.6 Place the adsorption column in the collection tube, transfer all the resulting solution to the adsorption column, centrifuge at 12000 rpm for 1min, and discard the filtrate.
1.7 Add 500. mu.L buffer GD, centrifuge at 12000 rpm for 1min, discard the filtrate.
1.8 mu.L of the rinsing solution PW was added, centrifuged at 12000 rpm for 1 minute, and the filtrate was discarded.
1.9 repeat procedure 1.8
1.1012000 rpm was left to air for 2 minutes and left at room temperature for 5 minutes to air dry the adsorption column.
1.11 transfer the adsorption column to a new 1.5 mL sterile centrifuge tube.
1.12 mu.L of elution buffer TE was added dropwise to the filter in the center of the adsorption column. The mixture was allowed to stand at room temperature for 5 minutes. The DNA was eluted by centrifugation at 12000 rpm for 2 minutes.
The buffer solution GA, GB, GD, rinsing solution PW and elution buffer solution TE are kits for extracting DNA from tick tissue
1.2 nested PCR amplification
Nested PCR amplification Using the following primers
One round of reaction, Bab-1: 5'-ATCTAAGGAAGGCAGCAGGC-3'
Bab-2: 5’- GAAACGTCCTTGGCAAATGC -3’
Two-round reaction, Bab-3: 5'-GTGACAAGAAATAACAATAC-3'
Bab-4: 5’- ACTAAGGTTCAATAACCAAC -3’
The expected amplified target fragment is 392 bp, the amplification reaction system is 50 μ L (containing 5 μ L of template, 1 μ L of each primer, 2 μ L of dNTP, 5 μ L of 10 XTaq buffer, 0.5 μ L of Taq DNA polymerase (5U/. mu.L), and finally supplementing ddH2O 35.5.5 μ L), and the PCR reaction conditions are as follows:
the first round of pre-denaturation at 95 ℃ for 5 min, denaturation at 95 ℃ for 1min, annealing at 56 ℃ for 1min, extension at 72 ℃ for 30s, 35 cycles, and final extension at 72 ℃ for 10 min.
The second cycle of pre-denaturation at 95 ℃ for 5 min, denaturation at 95 ℃ for 1min, annealing at 56 ℃ for 1min, extension at 72 ℃ for 1min for 35 cycles, and finally extension at 72 ℃ for 10 min.
Negative controls were set with no template added and double distilled water replaced. The resulting product was electrophoresed on a 1% agarose gel, observed on an ultraviolet projector and the results recorded.
Third, experimental results
We design the primer (Bab 1-4) and extract the DNA of three ticks, and use the primer of the invention to do nest PCR, the result shows that the three ticks can make the positive stripe (as figure 1) with the same target size, the DNA is sequenced by biology company, all is Babesia filariasis, otherwise, use the blood protozoonColpodellaThe primers of (4) and the three tick DNAs as templates failed to amplify any bands except the positive control group (see FIG. 2).
Sequence listing
<110> Longyan college
<120> general primer and kit for detecting babesia within south China tiger or tick
<130> 2020
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
atctaaggaa ggcagcaggc 20
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gaaacgtcct tggcaaatgc 20
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gtgacaagaa ataacaatac 20
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
actaaggttc aataaccaac 20
Claims (4)
1. The universal primer for detecting babesia within south China tiger or tick is characterized in that: comprises two groups of primers, which are as follows:
a first set of primers:
Bab-1: 5’-ATCTAAGGAAGGCAGCAGGC -3’
Bab-2: 5’- GAAACGTCCTTGGCAAATGC -3’
a second set of primers:
Bab-3: 5’- GTGACAAGAAATAACAATAC-3’
Bab-4: 5’- ACTAAGGTTCAATAACCAAC -3’。
2. a nested PCR identification method using the universal primers for detecting Babesia gibsoni or tick-borne Siberian beetles according to claim 1, characterized in that: which comprises the following steps:
1) performing a first round of PCR by using the genomic DNA of the blood sample or the tick sample of the southwestern tiger as a template and the Bab-1 and Bab-2 as the first round of primers in claim 1;
2) performing a second round of PCR by using the DNA of the first round of PCR as a template and the Bab-3 and Bab-4 primers as described in claim 1 as second round primers;
3) taking the second round of PCR products for 1% agarose gel electrophoresis identification;
4) performing sequence determination on the second round PCR product;
5) and carrying out systematic evolution analysis according to the babesia gene sequence recorded in the NCBI database to finally obtain a sample identification result.
3. The nested PCR assay method of claim 2, wherein: the reaction conditions of the first round of PCR are as follows: pre-denaturation at 95 deg.C for 5 min, denaturation at 95 deg.C for 1min, annealing at 56 deg.C for 1min, extension at 72 deg.C for 30s, performing 35 cycles, and extension at 72 deg.C for 10 min;
the reaction conditions of the second round of PCR are as follows: pre-denaturation at 95 deg.C for 5 min, denaturation at 95 deg.C for 1min, annealing at 56 deg.C for 45s, extension at 72 deg.C for 1min, performing 35 cycles, and extension at 72 deg.C for 10 min.
4. The kit for detecting the babesia within the south China tiger or tick is characterized in that: the kit comprises the universal primer of claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011173152.3A CN112251521A (en) | 2020-10-28 | 2020-10-28 | Universal primer and kit for detecting babesia within tiger or tick |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011173152.3A CN112251521A (en) | 2020-10-28 | 2020-10-28 | Universal primer and kit for detecting babesia within tiger or tick |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112251521A true CN112251521A (en) | 2021-01-22 |
Family
ID=74262699
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011173152.3A Pending CN112251521A (en) | 2020-10-28 | 2020-10-28 | Universal primer and kit for detecting babesia within tiger or tick |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112251521A (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104293903A (en) * | 2014-03-20 | 2015-01-21 | 河南科技大学 | Primer combination, kit and detection method for detecting babeisa canis |
| CN108034741A (en) * | 2018-01-18 | 2018-05-15 | 王素华 | A kind of two-pressure humidity generator nest-type PRC specific primer and detection kit and nested PCR detection method |
| CN108048589A (en) * | 2017-12-25 | 2018-05-18 | 王素华 | The Real-time PCR specific primers and probe and detection kit and detection method of ox two-pressure humidity generator |
| US20190024189A1 (en) * | 2017-07-18 | 2019-01-24 | Roche Molecular Systems, Inc. | Compositions and methods for detection of babesia |
| US20190093149A1 (en) * | 2017-09-27 | 2019-03-28 | The United States Of America, As Represented By The Secretary Of Agriculture | Assays for detecting multiple tick-borne pathogens |
-
2020
- 2020-10-28 CN CN202011173152.3A patent/CN112251521A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104293903A (en) * | 2014-03-20 | 2015-01-21 | 河南科技大学 | Primer combination, kit and detection method for detecting babeisa canis |
| US20190024189A1 (en) * | 2017-07-18 | 2019-01-24 | Roche Molecular Systems, Inc. | Compositions and methods for detection of babesia |
| US20190093149A1 (en) * | 2017-09-27 | 2019-03-28 | The United States Of America, As Represented By The Secretary Of Agriculture | Assays for detecting multiple tick-borne pathogens |
| CN108048589A (en) * | 2017-12-25 | 2018-05-18 | 王素华 | The Real-time PCR specific primers and probe and detection kit and detection method of ox two-pressure humidity generator |
| CN108034741A (en) * | 2018-01-18 | 2018-05-15 | 王素华 | A kind of two-pressure humidity generator nest-type PRC specific primer and detection kit and nested PCR detection method |
Non-Patent Citations (1)
| Title |
|---|
| 危芙蓉等: ""基于PCR蜱体内巴贝虫检测方法的评价"" * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105018489B (en) | Differentiate brucella street strain and vaccine strain A19 and S2 kit | |
| CN105002173A (en) | Kit for identifying Brucella S2 vaccine strain and wild strain | |
| CN105018628B (en) | Differentiate the kit of brucella A19 vaccine strains and street strain | |
| CN112280879A (en) | RPA primer and kit for rapidly detecting citrus yellow shoot Asian species, detection method and application thereof | |
| JP5522820B2 (en) | Method for detecting pathogens of strawberry important diseases and primers for detection | |
| CN107400736A (en) | The type adenovirus ring mediated isothermal amplification detection primer group of duck 2 and kit | |
| JP2007535292A (en) | Method for detecting pathogenic mycobacteria in clinical specimens | |
| KR102019804B1 (en) | Primer set for detection of SFTSV and SFTSV detection method using the same | |
| CN111690759B (en) | Specific primer, kit and method for detecting RPA of citrus canker pathogen | |
| CN109811073B (en) | Primer for rapidly detecting streptococcus agalactiae and streptococcus iniae at early stage by double PCR (polymerase chain reaction) and application of primer | |
| JP2019110810A (en) | Primer sets for specific amplification of nucleic acids derived from strawberry pathogenic viruses and methods for detecting strawberry pathogenic viruses | |
| CN109371110B (en) | LAMP (loop-mediated isothermal amplification) detection kit for bacterial canker pathogen of poplar | |
| CN115747361B (en) | Real-time fluorescence MIRA and MIRA-LFD primer group for detecting streptococcus iniae and detection method | |
| CN116377118A (en) | Multiplex PCR detection method for three pathogenic bacteria of Solanaceae and application thereof | |
| CN103882140A (en) | Rapid diagnosis kit for mycobacterium tuberculosis | |
| CN112251521A (en) | Universal primer and kit for detecting babesia within tiger or tick | |
| JP3525259B2 (en) | Detection of Pectinatus spp. | |
| JP2006061134A (en) | Primer for detection of mycobacterium tuberculosis and method for detecting and identifying the same bacterium | |
| KR102076343B1 (en) | Composition for detecting adenovirus type 55 using Real-time LAMP and uses thereof | |
| CN110923349B (en) | Species-specific detection molecular tags 3283 and 3316 of yersinia enterocolitica and rapid detection method thereof | |
| CN114134218A (en) | Fluorescent detection method based on CRISPR-Cas12a | |
| JP5707641B2 (en) | Genotyping method of Pseudomonas aeruginosa and primer set used therefor | |
| CN110106267A (en) | Methicillin-resistant staphylococcus aureus mecA genetic test primer sets | |
| CN110373486B (en) | PCR primer, PCR method and kit for detecting staphylococcus cohnii | |
| CN109609668B (en) | Detection primer group and kit for MLVA typing of salmonella typhimurium and application of detection primer group and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |