CN112251501B - Internal reference gene set, screening method thereof, universal primer group, kit, reaction system and application - Google Patents
Internal reference gene set, screening method thereof, universal primer group, kit, reaction system and application Download PDFInfo
- Publication number
- CN112251501B CN112251501B CN202011171377.5A CN202011171377A CN112251501B CN 112251501 B CN112251501 B CN 112251501B CN 202011171377 A CN202011171377 A CN 202011171377A CN 112251501 B CN112251501 B CN 112251501B
- Authority
- CN
- China
- Prior art keywords
- artificial sequence
- dna
- reference gene
- primer
- gene set
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention is suitable for the field of biotechnology, and provides an internal reference gene set, a screening method thereof, a universal primer group, a kit, a reaction system and application. The reference genes in the reference gene set are suitable for the sequencing platforms of illuminea (second generation sequencing) and Thermo Fisher Scientific, can be applied to positive control and cross contamination monitoring in the links of nucleic acid extraction, second generation high-throughput sequencing and the like of a multiplex PCR system, and have good positive control and cross contamination monitoring effects.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to an internal reference gene set, a screening method thereof, a universal primer group, a kit, a reaction system and application.
Background
The second generation high throughput sequencing technology has been developed rapidly in recent years, and has the advantages of high speed, high accuracy, low cost, etc. compared with the first generation sequencing technology. The high-throughput sequencing technology is widely applied to the fields of neonate screening, tumor personalized medicine application, infectious disease detection, gene consumption and the like. The clinical application process comprises the steps of sample pretreatment, nucleic acid extraction, library construction, on-machine sequencing and the like, and in order to reduce the single sample sequencing cost, multiple sample parallel treatment, nucleic acid extraction, library construction and sequencing are generally adopted.
However, in the parallel processing of multiple samples, such as the operation steps of rubbing air against the liquid surface during nucleic acid extraction, nucleic acid aerosol contamination is easily generated, for example, centrifugation in a centrifuge, vigorous shaking of a reaction tube, or repeated sample aspiration by a sample aspiration device. In the PCR process of library construction, such as in linker synthesis or sample nucleic acid PCR reaction, aerosol contamination is also easily generated during rapid temperature rise and drop of the PCR process due to the million-fold increase in product concentration. In addition, in the sequencing link, linker hopping is likely to occur due to the residues of the linkers in the library, thereby affecting the analysis of downstream data and creating cross contamination.
It can be seen that cross-contamination is easily generated in multiple links in the second generation sequencing process, thereby affecting the accuracy of DNA detection and even leading to false positive results. For the positive internal reference of the second generation sequencing, the cross contamination monitoring effect of the currently used positive internal reference gene on a multiple PCR reaction system is poor.
Disclosure of Invention
The embodiment of the invention provides an internal reference gene set, which aims to solve the problem that the existing positive internal reference genes for a multiple PCR reaction system have poor cross contamination monitoring effect on the reaction system.
The embodiment of the invention is realized by a reference gene set, wherein the reference gene set comprises one or any combination of genes with nucleotide sequences shown as SEQ ID NO. 1-SEQ ID NO. 48 in a sequence table or genes within 20 bases of the nucleotide sequences.
The embodiment of the invention also provides a screening method of the reference gene set, which comprises the following steps: taking CDS (coding sequence) regions of 5.7 ten thousand genes of zebra fish as an alternative sequence of an internal reference gene, and filtering genes with GC content less than 40% and more than 60% to obtain an alternative internal reference gene set A;
dividing the gene sequence of the alternative internal reference gene set A into 3 parts according to an equal ratio, respectively counting GC content, and filtering out any section of genes with GC content less than 40% and more than 60% and genes concentrated by GC to obtain an alternative internal reference gene set B;
filtering genes containing continuous 5 identical bases in the alternative reference genes B to obtain the reference gene set.
The embodiment of the invention also provides a universal primer group applied to a multiplex PCR system, which comprises the following components: a universal adaptor for ligating the specific nucleic acid fragments at both ends of the reference gene, and a primer pair corresponding to each reference gene of the reference gene set as described above or a DNA sequence differing from the primer pair by one base, respectively; wherein each primer pair consists of a forward primer and a reverse primer, and the nucleotide sequences of the forward primer and the reverse primer of each primer pair are respectively shown as SEQ ID NO. 49-SEQ ID NO. 144 in the sequence table in sequence.
The embodiment of the invention also provides a kit applied to the multiplex PCR system, which comprises the reference gene set and the universal primer group applied to the multiplex PCR system.
The embodiment of the invention also provides a reaction system applied to the multiplex PCR system, wherein the reaction system contains the reference gene set and the universal primer group applied to the multiplex PCR system.
The embodiment of the invention also provides application of the reference gene set in vitamin metabolism gene detection.
The reference genes in the reference gene set provided by the embodiment of the invention are suitable for a sequencing platform of illuminea (second generation sequencing) and Thermo Fisher Scientific, can be applied to positive control and cross contamination monitoring in the links of nucleic acid extraction of a multiplex PCR system, second generation high-throughput sequencing and the like, and can also be applied to detection of vitamin metabolism genes, and the positive control and cross contamination monitoring effect is good.
Detailed Description
The present invention will be described in further detail with reference to specific embodiments in order to make the objects, technical solutions and advantages of the present invention more apparent. It should be understood that the specific embodiments described herein are for purposes of illustration only and are not intended to limit the scope of the invention.
The internal reference gene set provided by the embodiment of the invention is suitable for a sequencing platform of illuminea (second generation sequencing) and Thermo Fisher Scientific, can be applied to positive control and cross contamination monitoring in links such as nucleic acid extraction of a multiplex PCR system, second generation high-throughput sequencing and the like, and has good positive control and cross contamination monitoring effects.
The embodiment of the invention provides an internal reference gene set, wherein internal reference genes in the internal reference gene set are derived from zebra fish genes LOC100148225, zp3, LOC100536860, bdkrb2, crls1, LOC568955, shprh, mapkbp1, hnrnpua, fbxo33, samd4a, kcnk13a, ryr2b, hmx2, ttbk1b, exo1, birc6, wdcp, morn2, wapla, jade1, wtbn 5, tecpr2, adam17a, ralgapa2, plk4, myt1lb, tgfb3, asb b, LOC100535674, usp8, tm2d3, eif2a, spar 5l1, cyp1a, grm3, big 1a, hipk2, ps9d1, igf, flexible 1ra, 35 b 1, 35 b 1.
5, etc. The zebra fish reference genome is available from the NCBI (National Center for Biotechnology Information, part of the national institute of biotechnology information, NIH) branch of National Institutes of Health (NIH) National Library of Medicine (NLM) database.
The reference gene set comprises one or any combination of the nucleotide sequences shown as SEQ ID NO. 1-SEQ ID NO. 48 in the sequence table or genes within 20 bases of the nucleotide sequences.
In the embodiment of the invention, the gene length of each reference gene in the reference gene set is 180-250bp (base pair), the GC content is 40-60%, the base G, C is not concentrated at the 3 'or 5' end of the DNA, and the number of continuous bases is less than 5. GC content refers to the ratio of guanine and cytosine among the 4 bases of DNA, which is called GC content. In double-stranded DNA, the ratio of adenine to thymine (A/T) and the ratio of guanine to cytosine (G/C) are all 1. However, the ratio of (A+T)/(G+C) varies depending on the kind of DNA. The higher the GC content, the higher the density of DNA, and the less likely it is to be denatured by heat and alkali, so that the separation or measurement of DNA can be performed by utilizing this property.
The embodiment of the invention also provides a screening method of the reference gene set, which comprises the following steps:
the CDS (coding sequence) region of 5.7 ten thousand genes of zebra fish is used as an alternative sequence of an internal reference gene, and genes with GC content less than 40% and more than 60% are filtered to obtain an alternative internal reference gene set A.
Dividing the gene sequence of the alternative internal reference gene set A into 3 parts according to an equal ratio, respectively counting GC content, and filtering out any section of genes with GC content less than 40% and more than 60% and genes concentrated by GC to obtain an alternative internal reference gene set B.
Filtering genes containing continuous 5 identical bases in the alternative reference genes B to obtain the reference gene set.
The embodiment of the invention also provides a universal primer group applied to a multiplex PCR system, which comprises the following components: a universal adaptor for ligating the specific nucleic acid fragments at both ends of the reference gene, and a primer pair corresponding to each reference gene of the reference gene set of claim 1 or a DNA sequence differing from the primer pair by one base, respectively; wherein each primer pair consists of a forward primer and a reverse primer, and the nucleotide sequences of the forward primer and the reverse primer of each primer pair are respectively shown as SEQ ID NO. 49-SEQ ID NO. 144 in the sequence table in sequence.
The universal joint comprises a first universal joint and a second universal joint; the nucleotide sequence of the first universal joint is as follows: TACACGACGCTCTTCCGATCT; the nucleotide sequence of the second universal joint is as follows: TCCTTGGCACCCGAGAATTCCA.
Wherein, the upstream primer 5'-3' is a first universal joint and an internal reference gene specific upstream primer sequence in sequence; the 5'-3' of the downstream primer is a second universal joint and an internal reference gene specific downstream primer sequence in sequence.
The embodiment of the invention also provides a kit applied to the multiplex PCR system, which comprises the reference gene set and the universal primer group applied to the multiplex PCR system.
The embodiment of the invention also provides a reaction system applied to the multiplex PCR system, wherein the reaction system contains the reference gene set and the universal primer group applied to the multiplex PCR system.
The reference gene set provided by the embodiment of the invention can be applied to vitamin metabolism gene detection, and can be used as a positive control and a cross-contamination monitoring reference.
The application method comprises the following steps:
obtaining N nucleic acid samples to be tested; adding 1000-3000 copies of reference genes into each sample to be detected; extracting total DNA of each nucleic acid sample to be detected, and storing at 4 ℃ for standby (to be used when entering a multiplex PCR library building link); carrying out two-round PCR amplification on the extracted N nucleic acid samples to be detected to construct a sequencing DNA library; the PCR amplified products described above were sequenced using a sequencing platform of Illumina or Thermo Fisher Scientific.
The technical effects of the present invention will be further described with reference to specific examples. The reagents or instruments used in the experiments are not indicated to manufacturers, and are conventional products which are commercially available, for example, can be purchased from Illumina, radicle biochemical company and the like.
Example 1 screening method of reference Gene sets
The common model organisms including zebra fish, arabidopsis thaliana, nematode, drosophila and mice have thorough and easy availability of genome information research, and have the characteristics of low cost and the like compared with artificial simulation random generation of artificial synthetic sequences. The invention selects zebra fish as the information source of the internal reference gene set. Zebra fish reference genomes were obtained from NCBI, the zebra fish comprising a total of 57k genes.
The screening steps are as follows:
(1) Based on 57K genes of zebra fish CDS (coding sequence) as an alternative sequence of the reference genes, the GC content is evaluated, and genes with GC content less than 40% and more than 60% are filtered to obtain an alternative reference gene set A.
(2) Dividing the gene sequence of the reference gene set A into 3 parts according to an equal ratio, counting GC content respectively, filtering any section of genes with GC content smaller than 40% and larger than 60%, and filtering genes in the GC set to obtain an alternative reference gene set B.
(3) And filtering genes containing continuous 5 identical bases in the alternative reference genes B to obtain a reference gene set C, namely the reference gene set of the invention.
(4) Screening target primers for the reference gene set C by adopting Primer3 plus Primer design software, wherein the length of an amplicon is 180-250bp.
The zebra fish gene set is filtered under the conditions to obtain a group of universal primer groups containing 48 reference genes and multiple PCR systems, wherein the sequences of the reference genes are shown as SEQ ID NO. 1-SEQ ID NO. 48 in a sequence table, and the universal primers of the multiple PCR systems are shown as SEQ ID NO. 48-SEQ ID NO. 144 in the sequence table.
Example 2 screening of reference Gene sets and verification of corresponding primers
The 48 reference genes of the reference gene set obtained by screening in the above example 1 are used as templates, a primer pair of a multiplex PCR system corresponding to each reference gene in the reference gene set is designed and synthesized, the primers are diluted to 100um (millimoles/liter), the primers are mixed in equal volumes (uL) to obtain reference gene mix (mixture), a sequencing library is constructed according to the following procedure, and the sensitivity and amplification efficiency differences of the reference gene set and the primer pair are verified.
Second generation high throughput sequencing library construction and purification based on multiplex PCR technology:
(1) Carrying out two-round PCR amplified sequencing library construction on the internal reference gene primer P1 mix obtained above; a first round PCR amplification system was prepared according to the system shown in Table 1 below, and the zebra fish genome template (50 ng), P1 mix, 3X Enzyme, ddH 2 O is mixed to obtain a plurality of premixed heavy PCR reaction liquids mix.
TABLE 1
| Component (A) | A reaction volume |
| Nuclease-Free H 2 O | To 30uL |
| P1 mix | 8uL |
| Zebra fish gDNA (50 ng) | 10uL |
| 3x Enzyme | 10uL |
(2) The premixed multiplex PCR reaction mixture mix was placed on a Bio-rad T100 (Bio-rad Bere T100 type gradient PCR apparatus in the U.S.) and subjected to a first round of PCR amplification according to the following parameters, the procedure being as follows: the PCR product is collected at 98 ℃,3min, then 98 ℃,20 seconds, 60 ℃,6min for 17-20 cycles, then 72 ℃,2min and finally 10 ℃.
(3) Then adding the amplified PCR reaction solution into 0.5 times of AMpure XP Beads, and blowing up and down by using a pipette to fully and uniformly mix the amplified product and the AMPURE XP Beads. Standing at room temperature for 3 minutes.
(4) Placing the mixture subjected to the standing treatment on a magnetic rack, standing for 3min, sucking the supernatant into a new EP tube/96 well plate by using a pipette after the magnetic beads are completely adsorbed, and retaining the supernatant (avoiding sucking the magnetic beads).
(5) And adding 0.6 times of the volume of the AMPureXP Beads into the reserved supernatant, and blowing up and down by using a pipette to fully and uniformly mix the amplified product and the AMPure XP Beads. Standing at room temperature for 3 minutes.
(6) Placing the compound subjected to the standing treatment on a magnetic rack, standing for 3min, completely clarifying the solution after the magnetic beads are completely adsorbed, carefully removing the supernatant by using a pipette, and retaining the magnetic beads.
(7) The above-mentioned retained magnetic beads were added to 50uL of the magnetic bead washing liquid 1, and the magnetic beads were suspended and allowed to stand at room temperature for 2 minutes. And (3) adsorbing the magnetic beads by using a powerful magnet or a magnetic frame until the solution is clarified. The supernatant was pipetted off, leaving the beads.
(8) The beads obtained above were added with 100ul of 80% ethanol, and the beads were repeatedly adsorbed back and forth on different sides with a magnetic rack to sufficiently suspend the beads for washing.
(9) The fourth mixture, fully resuspended, was placed on a magnetic rack and allowed to stand at room temperature for 3 minutes until the solution was clear. The supernatant was carefully removed with a pipette to avoid the attraction of magnetic beads.
(10) The beads obtained above were left at room temperature for 5 minutes until the ethanol was completely volatilized. The step can also be carried out in an oven at 50 ℃ for 3-5 minutes.
(11) The magnetic beads obtained above were subjected to a second round of PCR amplification system (the P2 primer set was a universal primer with tag information, and the sequences were respectively:
forward primer: aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatct;
reverse primer: caagcagaagacggcatacgagatgtgactgga gttccttggcacccgagaattcca).
TABLE 2
| Component (A) | Primary reaction volume |
| Nuclease-Free H 2 O | 18uL |
| 3x Enzyme HT | 10uL |
| P2 | 2uL |
| Total volume of | 30uL |
(12) The premixed PCR reaction solution was placed on Bio-rad T100, and the second round of PCR amplification was performed according to the following parameters, the procedure being as follows: the PCR products were collected at 98℃for 2min, then at 98℃for 15sec,60℃for 15sec,72℃for 30sec for 6 to 9 cycles, then at 72℃for 2min and finally at 10 ℃.
(13) And adding the gradient amplified PCR reaction solution into 0.8 times of AMpure XP Beads, and blowing up and down by using a pipettor so as to fully and uniformly mix the PCR product and the AMPure XP Beads. Standing at room temperature for 3 minutes.
(14) Placing the obtained mixed solution in a magnetic rack to adsorb magnetic beads, and standing for 2 minutes until the solution is clear. The supernatant was carefully aspirated with a pipette, leaving the beads behind.
(15) The beads obtained above were added with 100ul 80% ethanol, and the beads were repeatedly adsorbed back and forth on different sides using a magnetic rack to suspend the beads sufficiently for washing, and the supernatant was carefully aspirated off using a pipette, leaving the beads.
(16) The beads obtained above were left at room temperature for 5 minutes until the ethanol was completely volatilized. The step can also be carried out in an oven at 50 ℃ for 3-5 minutes.
(17) The magnetic beads obtained above were added to 20uL Elution Buffer (elution buffer), and the magnetic beads were sufficiently suspended to obtain a mixed solution seven, which was allowed to stand at room temperature for 2 minutes to elute DNA.
(18) The beads were placed on a magnetic rack for 5 minutes until the solution was completely clear, and the supernatant was aspirated into a new 1.5/0.5/0.2mL centrifuge tube or 96-well PCR tube.
The library obtained above was sent to the Beijing norelvan source technologies Co., ltd for sequencing using the illumin Novaseq sequencing platform, and the data quality control results of the sequencing results are shown in Table 3 below:
TABLE 3 Table 3
| Sample name | Total reads | Clean reads | Adapter rate | Q20 | Q30 | GC content |
| ICG-48 | 10,221,536 | 9,752,234 | 2.79 | 92.03 | 87.46 | 52.2％ |
The statistics of the number and relative abundance of 48 alternative reference genes reads are shown in table 4 below: primer ID P_IC01 in Table 4 corresponds to the test results of the general primer set SEQ ID NO. 49 and SEQ ID NO. 50, primer ID P_IC02 corresponds to the test results of the general primer set SEQ ID NO. 51 and SEQ ID NO. 52.
TABLE 4 Table 4
| Primer ID | Number of sequences | Primer ID | Number of sequences | Primer ID | Number of sequences | Primer ID | Number of sequences |
| P_IC01 | 120619 | P_IC13 | 23664 | P_IC25 | 187443 | P_IC37 | 16977 |
| P_IC02 | 38684 | P_IC14 | 69077 | P_IC26 | 56586 | P_IC38 | 195408 |
| P_IC03 | 119407 | P_IC15 | 120925 | P_IC27 | 62959 | P_IC39 | 151803 |
| P_IC04 | 157015 | P_IC16 | 28918 | P_IC28 | 162066 | P_IC40 | 125056 |
| P_IC05 | 83431 | P_IC17 | 177046 | P_IC29 | 8287 | P_IC41 | 118585 |
| P_IC06 | 48447 | P_IC18 | 194287 | P_IC30 | 167505 | P_IC42 | 198621 |
| P_IC07 | 85737 | P_IC19 | 123271 | P_IC31 | 107430 | P_IC43 | 38928 |
| P_IC08 | 113956 | P_IC20 | 91308 | P_IC32 | 13772 | P_IC44 | 130023 |
| P_IC09 | 15300 | P_IC21 | 18034 | P_IC33 | 138889 | P_IC45 | 151942 |
| P_IC10 | 96976 | P_IC22 | 98643 | P_IC34 | 19432 | P_IC46 | 78105 |
| P_IC11 | 9835 | P_IC23 | 183223 | P_IC35 | 199866 | P_IC47 | 138683 |
| P_IC12 | 198795 | P_IC24 | 170039 | P_IC36 | 104481 | P_IC48 | 98561 |
As can be seen from the test results of Table 4, the reference genes of the examples of the present invention were positive in the multiplex PCR system. The median value of the amplification efficiency F (number of amplicon reads/median of all amplicon reads) of 1.07 (q1=0.45, q3=1.45) was obtained by analyzing the amplification efficiencies F of 48 reference genes, which is consistent with the production application.
EXAMPLE 3 preparation of reference Gene sets
48 reference genes in the reference gene set passing verification in the above example 2 were selected as templates, and reference gene specific primer pairs were synthesized, and the primers were diluted to 10um, and a PCR reaction system was configured according to the system of the following Table 5: zebra fish genome template (50 ng), specific primers P1-P48 (namely 48 groups of universal primers corresponding to the 48 reference genes), PCR premix and ddH 2 O is mixed.
TABLE 5
The premixed multiplex PCR reaction mixture mix was placed on Bio-rad T100 and subjected to a first round of PCR amplification according to the following parameters, the procedure being as follows: firstly, the temperature is 94 ℃ for 2min, then the temperature is 98 ℃, 10s,60 ℃, 30s, 68 ℃ and 30s are carried out for 35 cycles, then the temperature is 68 ℃, 5min and finally the temperature is 4 ℃ for a long time.
Purifying the amplified PCR product by using a American-based biological PCR Pure LQ Kit, measuring the concentration of nucleic acid by using Qubit4.0, converting the concentration to a conversion formula of copy number to obtain the copy number of the nucleic acid fragments, obtaining the concentration of each reference gene, diluting the reference gene concentration to 1000-1500 copies/uL concentration, obtaining a final reference gene set, and making a label for standby.
The conversion method is as follows:
1) From copies/. Mu.L to ng/. Mu.L:
the size of the nucleic acid in the sample and the ng value of each copy of DNA are first known, taking human genomic DNA as an example: the DNA size was scaled to ng/copy: human genomic DNA size (Mb): molecular weight of 3000Mb/copy x1 bp: 1.096X10-21g/bp x converts Mb to bp:1x106bp/Mb x converts g to ng:1x109ng/g = ng value per copy DNA: 0.0033ng/copy. Then, the copy number concentration is directly converted, if the copy number concentration is 3000 copies/. Mu.L, the following formula is converted: 3000 copies/. Mu. L x 3.3.3 pg/copy (0.0033 ng/copy) =9.9 ng/. Mu.L.
2) Scaled from ng/uL to copies/uL:
first, the size of nucleic acid in a sample is known, and the size of human genome is 3000Mb/copy, and the molecular weight ng of the nucleic acid molecule per copy is converted. Human genomic DNA size (Mb): molecular weight of 3000Mb/copy 1 bp: 1.096X10-21 g/mbx converts Mb to bp1x106bp/Mb x converts g to ng:1x10-9ng/g = ng value per copy DNA: 0.0033ng/copy. If the mass concentration is 10ng/uL, the calculation is carried out as follows: 10ng/uL = 3030copies/uL;0.0033 ng/copy=3030 copies/uL.
Example 4 application of reference Gene Assembly in vitamin Metabolic Gene detection
(1) Internal reference input and nucleic acid extraction
10 saliva samples with the volume of 2mL are selected, 5uL of internal reference genes are added in the pretreatment process of the samples, and marks are made; nucleic acid extraction was performed using a Tiangen TIANamp Swab DNA kit (DP 322-01) kit, and the extracted genome was assayed for purity using Nanodrop 2000, with concentrations greater than 0.2ng/uL using a qubit4.0 assay.
(2) DNA tag library construction based on multiplex PCR method
10 saliva nucleic acid samples to be tested are subjected to library construction by adopting a vitamin metabolism gene detection panel of human body code gene technology, and by combining a vitamin metabolism gene detection method (the specific method is referred to in the embodiment 2), library construction is carried out, different tag primers are added to reaction systems of different samples of the second PCR after the first round of specific primer pair amplification, and the PCR products are purified to obtain the library to be on machine.
(3) Sequencing and data analysis
The 10 purified DNA library samples are mixed into library mix according to the equimolar number, and after passing Agilent2100 detection, the library mix is sequenced by using an Illumina Novaseq platform, and the preparation and sequencing detailed steps before sequencing are described in NovaSeq Reagent Kits operation instructions.
The sequencing off-machine data are subjected to label identification and are used for distinguishing sequencing data sets of different samples; the sequence obtained by sequencing the machine is subjected to quality control treatment such as comparison, filtration, weight removal and the like to obtain the sequence number of the internal reference gene detection, and the result is shown in Table 6; the effective coverage depth of the targeted capture of the sample target region is statistically calculated and analyzed for single base mutations. The result shows that the reference gene provided by the implementation of the invention plays a role in positive control and cross contamination monitoring in the vitamin metabolism gene detection process.
TABLE 6 distribution of the number of columns of reference genes in 10 saliva samples
| Sample numbering | Total_Reads | Clean_Reads | Reference gene | Number of internal reference gene sequences | Reference gene (pollution) |
| S01 | 402000 | 373860 | P_IC01 | 2568 | NA |
| S02 | 386116 | 342088 | P_IC02 | 1587 | NA |
| S03 | 315439 | 293582 | P_IC03 | 305 | P_IC01 (3 strips) |
| S04 | 443728 | 418367 | P_IC04 | 8091 | NA |
| S05 | 441320 | 411588 | P_IC05 | 4307 | P_IC08 (12 pieces) |
| S06 | 344375 | 321067 | P_IC06 | 724 | NA |
| S07 | 413914 | 314940 | P_IC07 | 578 | NA |
| S08 | 428827 | 396930 | P_IC08 | 9862 | NA |
| S09 | 382319 | 352557 | P_IC09 | 5278 | NA |
| S10 | 434126 | 403452 | P_IC10 | 3834 | NA |
The foregoing description of the preferred embodiments of the invention is not intended to be limiting, but rather is intended to cover all modifications, equivalents, and alternatives falling within the spirit and principles of the invention.
Sequence listing
<110> Shenzhen human body password Gene technology Co., ltd
<120> an internal reference gene set, screening method thereof, universal primer set, kit, reaction system and application
<160> 144
<170> SIPOSequenceListing 1.0
<210> 1
<211> 208
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
cttcagctgg aagtttgtgg caaactctct ctgggcttca gcaacaatgg ggaacttcca 60
ggtgaaaggc tcaggagctt gcagcatcag cttctcctga agaccgagag gagcttgcac 120
aggtttccta gagtcaagac tattgaaggc caccatcaca tcaggactga aaacagctcc 180
aggaggagca ggaacacctc tgagattc 208
<210> 2
<211> 203
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
gctggaagtt tgtggcaaac tctctctggg cttcagcaac aatggggaac ttccatgtga 60
aaggctcagg agcttgcagc atcagcttct cctgaagacc aagaggtgct tgcacaggtt 120
tcccagagtc aagactattg aaagccacca tcacatcagg actgaaaaca gctccaggag 180
gagcaggaac acctctgaga ttc 203
<210> 3
<211> 230
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
cgatctgaac cacagttaac cgcaacagtg ctgccaggag atgcaggctg cttcagctgg 60
aagtttgtgg caaactctct ctgggcttca gcaacaatgg ggaacttcca tgtgaaaggc 120
tcaggagctt gcagcatcag cttctcctga agactgagag gagcttgcac aggtttccta 180
gagtcaagac tgttgaaagc caccatcaca tcaggactga aaacggctcc 230
<210> 4
<211> 230
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
gagaatcggg ttcaaaacgc tgttgctcaa agccaagtag gtgaaaatct gattggaaat 60
atcaagacct gcttcaaatg tgcatccgct aaagacaccg aatcgcatca gaacatccat 120
gagtgtcacc agatgaaacg gcacccaaca taagagaaac accatcagga ccaccaacac 180
cagaatcgta gcttttcttt cagtgttttc agcgttaaag cgatcgacca 230
<210> 5
<211> 201
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
acacccttaa aaccagctgt tgcagctttt caaaccggac ctgcggctct tgtagacccg 60
ttccagagcc gcggagtccc gaactaaaca agccgagtat cgggctccat ctgcggcatg 120
caggagcagg attcaccgct gcgctccgtc tgtgtggatc tagcgggttt tgcactgatg 180
cgtccagaaa gtcggagtta g 201
<210> 6
<211> 211
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
cggtatcgag agtgacttcg aggaccctcg agacaccgag agcgagcgtg aagaaatggc 60
tcccgaagct gcgtttgcac catatctgtc ctgcagacag tgcggccagc tgctgggtga 120
ccctttgagt ggcctctact gccttcaatg tggagaaact gaccggcagg accgatccct 180
ggaacccact catccagcag acaacacact a 211
<210> 7
<211> 228
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 7
ctccacacag gattctcctc cagacaccat tgaactgaat gtaatgccaa tttctgttct 60
ggatcaaggg tggaacgcac tgatcggaga gtttaacttg catccaaaga ttcctattga 120
ggttgcagat ggttcattct gcctgcagca aacaggagac acactgagca tgactctgaa 180
cactcttgag atggaggatg ggaggggtag aagtgatccg ctctgttc 228
<210> 8
<211> 242
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 8
gtttccaggt caaactgact ggcagtgctc gacccctgct ccatatagac attccaaatc 60
ctcttccgga taaacccttc ttatcttccc tctcgccaag cagcaagagc cccaaggttg 120
cacaaaagga gcccttgagt agaaacccaa cgacgactcc ttcacttgct ggagcagttc 180
agcttcccag cggcatcatt cagccagtcg cagctgttca tttgagccca tctgaaaccc 240
ca 242
<210> 9
<211> 245
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 9
atttatccat ctctaccccg gcgtcctcct cttcctcctc cataatatca tcatgctcgg 60
cctccgcgtt tcctccatcc tcttcttcct cctccatgct ctctcccacc gggtcctcct 120
ccaggtcttt gccggcgggg tctcctccgt cctcgtaccg acgctcggag ccgttagtac 180
cagagagcgc ctcctcgtct agtgcggcct gcaggcgcga cataagatcc gccttcagcc 240
cttta 245
<210> 10
<211> 241
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 10
ctgctctgga tgtcaagcct ttggacggga ctgcggctga ggatgactgg aaagcactgg 60
tccgccgcag caccaacctg cgtgtctaca tcatgggaat ggacgtgcac agccaggatc 120
ttctgcgcgt gctgaagcct agcgttcccc tggaacggat ccacctggat agctacagca 180
cattggtgac ggatggtgtc attgagctta tctcgcagca gtaccacaaa accctcacac 240
a 241
<210> 11
<211> 203
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 11
ggagcgggtc atctctctag ttctgaccca cttgccactt ctcaagccgg gcaacgtcga 60
ggccaaagtg gagtacatga gcctcctgcc gaagatcctg ggccacacca ttgaacatgg 120
ccggcacttg gaggaaagca ggcaactttt atcctacgct ctcatccacc ccgcaacatc 180
cctagatgac cgggctaacc tgg 203
<210> 12
<211> 247
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 12
gtaaaatccc aacgcggtct gagagtgtcc acccgtatcc ctgccatgtt cgcctcttca 60
taatgtctca agaagttctc caggtcactt ttgttgaggt tgtacttttg gctgaacagc 120
tcaaacctct gagcccacct ttccttcgcc agtttctcct tcggatgctc cagggctgaa 180
aacaccgcgg ctccgcacag aaggtagagg atgatgagga gtagcaacat gatgaaccgg 240
gcattat 247
<210> 13
<211> 223
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 13
agccaatttc tttagccggt tcgtgaaaac gtgtcacaaa gtctgggtaa tccagcagct 60
cactttctgc catctccgca caggataaca ggaattcaat ctcagattga gagtagcgct 120
tgaacacttc catggctcgc tggaagtcct tcttggaaat gagtcctttg ctgtctgggt 180
catattcatg gaaggcttct gacgacgtga ggtctttgag ttt 223
<210> 14
<211> 219
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 14
gcttcaagtt ctgcagagag ctgccgcttc catttgtttc gccggttctg aaaccacgtt 60
ttcacttgtg tctccgttaa ctgcaggctg gaggcgagac aggctctctc ggagctgctc 120
aaatagcgtt tcatatcgaa tgtggactcg agttgataaa cctgactccg agagaaaacg 180
gtgcgcgttt tcttcttcgc ggagttgttc tgtttgtcc 219
<210> 15
<211> 201
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 15
ctccatgcac tctccttctc ctctcctcgt ggtcctcgag gggccgcaat tcctcaggtt 60
cctcatctgt ggtgcctgag gtggttggtt ctgccccggg gaggaagtcc ttcagctcag 120
tttctttatc gatcatcacc cactccctgc tgtcgaagtc ctcttcctct gccagcggga 180
ctgagcgtat gaaggcattg c 201
<210> 16
<211> 245
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 16
actgggagaa ataggcactg tcctgagatg gaggagaccc gggagaattt ccagcatcct 60
cactgccttc aaccggtgag gacgagagag aaagcccagg tcctgcccag gagattcttg 120
ccttatttct gtgaaactgc tgcagtgtag ataatcctga aggtgtggag gatgaccgct 180
gtctctctgt gctgtctctg gctggatgtg aaacagattt attgagttct ttggtgctcc 240
ctgac 245
<210> 17
<211> 250
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 17
caccgatgac tccaaacatg ctcgaacacc agtaaccgtg cccatctccc tctcagagtg 60
ccagctggtg acccttgcag ctgcatccca gtctcctggt gccattcagc agctgttaga 120
ctccggtctg ccttccttgc tggtgcgtag cttggctgac ctttgctgca acctgttggt 180
cagcgcggat cttcctttac cttcaggatt ctcctcacag accgagagac ggccgtattc 240
acataaccaa 250
<210> 18
<211> 237
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 18
gctctaaggg gtcacgacta caggttatag gtttggatgt gagggttaaa gatatgctgg 60
acagacgctg gagacggcca cgagtcaatt catacacaca ggtttggatg tcaggatgct 120
gaatttcctc aagggactca gatgtggagt gtttggtgtc ttggtgcagc tccacggtca 180
ggatatggta gggttgggtc agactaaatc tgcagtctat aggatccccg tccgttc 237
<210> 19
<211> 248
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 19
ttcattctga agtgcagcgt gtgtgggaac aacatgtgtt cttgatgttc agtgtgtgct 60
attggagctt atttcattgg cagacgagat ctcatcaatg cctgagggac gctggctgtg 120
ctaatgcatc actgtgtatc aaagatttct cttagtagtt tcaaggggcg ttaatttcat 180
cgaattcatt taaatggtct gtgtttgtgt atcagtcaca tgttgacttg gagctttaat 240
cccagcgc 248
<210> 20
<211> 204
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 20
gcagcttccg cttcttaaac catctagcga cagagtgtac agacgaccac ggggtaaaga 60
gaccgaaagt tcagctgctg gagatacaat tcctgctgtg agttcggtgt cagctcctgc 120
accagtgatg agcagcaatg caggggttgc tgggagttct ggggtgaagc ctcctgcagg 180
tcggggtaga gtgagggatt acac 204
<210> 21
<211> 221
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 21
agaggcggat gaagtcaagt tcaagtcatt ttgtcccaag cactctggcc tggattggaa 60
cgaggaagag ggcgatgatg acagacctgt gaaggtccca accagggaag acagaagcag 120
aaatagagga atagatttct ctgcttcttc ccaaaccaga ctctcgcaga acccagagga 180
gaccagactc agtgagcgaa agcttcgagt acagcagctg g 221
<210> 22
<211> 216
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 22
ctgagagctg gcagtcttac cataaaatga acacagagtc ttgacatctc agagcctggc 60
tggactcatc tttgtccctt ccatccatcc gacaagatct gtctgtcatt gtttaataca 120
cttttgtgac agctaacact actccacagc tgtgacccag tcaacacatg ccagtatttc 180
tattcacacg tgtggacatg gtggtgagtg aaagtg 216
<210> 23
<211> 224
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 23
tcagatgcct gcatgtacga gaaggtacat tccagcagca tgtctacatc aggtgtagct 60
gcgatttgct cattttcagc aaacacattt tcactgtaca actgacactc catgtctagt 120
gtcagagacg cggggcaagg tggtgaggtc tgtgctgctt ggttaactgc aaccagacat 180
ggctcttggt tcagcaaggg ctctgatggg ctctgaatgg gaaa 224
<210> 24
<211> 207
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 24
caaacagtgg agccaacaac actaaataaa atatgcaagg cttcattctg gcgatgcagc 60
atcacttctg ggtgtgaagt cctcagctgt caacgttact gtccgctatt tactaacatt 120
cgcgaccgct ttctgtatcg cttattaaac gcccatgaca gaagacagct ttaaatatcc 180
atattgagag gacggaacac tgctagc 207
<210> 25
<211> 212
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 25
tgccatctaa agtgcggaag agaacgccac tgtcccatga gtatttgcct gagatgtccc 60
gaatgatgat gcggacctca gaggaatgat ccctggggtt ggcacttagc ggagcagtgt 120
tggaattatc agaggggatc tgcaggtatg aaatgagcgt gctgtcatta aagacgaaga 180
gctgcagatt ggggcttttg aagacctcag at 212
<210> 26
<211> 236
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 26
tgcccactct taaaactgga gctggtggaa tgatgggagt ggctagggat tggtgccata 60
cgactgggca acggctgccc aatcatctgc ctggttcgcc tctgtaaccg actgctgctg 120
ctgttgttgg ttgcatttga agctgtggat attgtggcga ttccgctgtc gatggagcct 180
ccgtcgctgc tgccggagtc tttgcttgcg gtgggcccac tttgagtcat aaacgg 236
<210> 27
<211> 229
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 27
gtctggatgt gaacagcgat gtggtgcggg agactgtgga ctctctgaag ctcctggcgc 60
agggtcacgg agtctcgctc ttagaaaacc tccatgagaa tcactatcag gaggacggaa 120
gtgagaatac agactgtggc aacggaaatg ggtccacggg taatggacac tgtggtaaac 180
ccactgctaa tggtcagatg gttgagaaga gtgacgagga ggtctgtct 229
<210> 28
<211> 223
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 28
cagatccctg gtgctgttgt agagggccag cacttggtag ggcacctgac tagggcccag 60
ggtctgcggc gggctggtca gacggagttt gctgaggatc tgaccccgga tggcctccac 120
cctcttcttc ttaatgttat caatgtccac tgtggtgcag gtggacagag acaagctcat 180
ggtcacactg tttaaaagca gaacaaacag cagtcctttg ccc 223
<210> 29
<211> 229
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 29
tctccagttt gagcacagac acagtgcagt gcagaacagc attaaagact gaaggagtct 60
ggaggagttt cagtgcataa agcacaagag cgcaagccta cactgaacaa ccgtgacctc 120
cgacccctca ggggtcctct ggtatctttt ccagaaaacg tcttgcacaa aatgaattcc 180
agcacttcag gcggtgtgga tgagtgcgcg attcacaaca acacaaaac 229
<210> 30
<211> 207
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 30
gtaataattt gtgtgcgcgc gtgtgtgtgt gcctatgtgc gtgtgtgtgc atcggcagag 60
gagcgtgagc gggcggttct cctggagcag caggtggagg tgcaggagca gacgcggctg 120
cagctggagc agcagatgga gactcagcag cgcaacaatg aagagcagat ccagcagatg 180
ctgcagcaga tgcagacaga gctcagc 207
<210> 31
<211> 201
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 31
agattagacg tctgcatttg cgctctttaa ccccagctca ttagagcctt catttattta 60
tatggtgacc aaatattgtc agaggtgtgc tgccagaact gacgaaacca acacagtcgc 120
agagagaaac tccactgaag gaccgctctg tgcttattta acacacacac actcgcgcac 180
tacaccgcag tggagatgta g 201
<210> 32
<211> 211
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 32
cgtcacgtta tgccagcact aagaaatctg agatgcagtt gtcacggtaa agtcagcact 60
tagaattttg ggatgcggtc gtcacagtaa cgccagcact gagaaatcag agatgcagtc 120
gtccacggta atgtcagcac tacgaaatct ggaatgcagt cgtcacgata acatcagcat 180
tcagatctgg gatgtagtcg tcacggtaac g 211
<210> 33
<211> 228
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 33
accaggagaa atgtgtggtg tcttcagcct ggggtttgga cacttgcttg tatttcttta 60
catcccaaac ttccatctgt cctctcaggt ttccaaagcc agcgaggacc aggatgtggc 120
cttgtggact gtagaaagca gcatttcgag ggccggtgcc gaaatcgaac acagactcac 180
acttgttgtt gaatacggtg gccttggcgg gcataaaacc ataaacca 228
<210> 34
<211> 207
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 34
actagcctgt tttctggagc actgctgctc cctgtcctgc gtgggcacag cgagtcgatc 60
tcatcgatca gcagaacaca aggaccgtca tcagcagcgt ctcgagcctg ttcaaacact 120
cgccgcaggt tctcctcgct ctctccgggt cgagaccccg tgacttctgg cccgttcaca 180
gtcactaaag tcgccccgat gtcttta 207
<210> 35
<211> 225
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 35
gaatgcgcag gaaagggatg aaatcggcag ggtttccgct gcccacgatc ttcccgaact 60
catcgctcat attaaccagt cgcaccagtt catcatcatc atgactatgc cggcgtccga 120
aacagatccc gcagattacg ttagccacgg atactacgat atgtctgaat ggatcaaagc 180
ttccatcggc tttcataaca gagtgcagcc tctggaccaa atata 225
<210> 36
<211> 218
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 36
tatagccagt ggactgtcct cctgaagagc gtaagacccg tcgggacaga tgaactccgt 60
atcatccact ttcgtaaggg acgccctgac gaactccaat gcctgttcga gagcataggt 120
gtccctcgag cacgtgtcca aaatatggac tcccaaaacc acacccggca gcagcgccac 180
gtcctgattg atctgatcga tagcgaagag cattgcct 218
<210> 37
<211> 215
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 37
gtgtcatgct ggactactac cgtcagagtc gggtcacacg tagtggcagt ctcaaaggcc 60
cagaagaccc acgagccctg ctttctccac gtttagctcg gcgtcttgca gctgtgaact 120
cctcagacat gtccaagagt cctcaagact ctccttcgaa ggaacccctt ggagacggaa 180
ttaaagggga aggaggaagt cccaatagaa cccca 215
<210> 38
<211> 229
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 38
tagattgcag gtaggtggag cacaccgctt tggagacgtg actagcagat ccgaagtcga 60
tcaccttgac cctgtagggt tggcgggctg ggtctacaag catgatgttc tcaggcttca 120
agtcagcgtg gatcagtcct aggctcttga gcttcatcag ggcagtggcg acctgctgca 180
ggatcggtcg gatgtacttg agcggcaacg ggctgaactt gttctgttt 229
<210> 39
<211> 216
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 39
tcacccagtc atgaagttgc tgaagaggct tcagtatcgg gtatataaca gactgtatcc 60
tatagtgagc cagtgctctc ctctaaacac aacatctggt cactctctat ccttaaagcc 120
ttcccgaagt gcccatagcc tcctcctctc agactgtccc atctctccac atcatcagca 180
gagccccttc aaatcagccc tgacacacag cttatc 216
<210> 40
<211> 221
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 40
atttcgaaga tgaccagggc gtagttgtag aatagattgc gtcctcggat gacgttgagg 60
ttagggaaga gcacactcag gctgtccaga ccggagacac ggaacaggag aatgtagtcc 120
gttaccatgg tcaacttggg gaaggacagt gtgcgaaagt gttcctggtt gaggttgttg 180
ttcttgtctc caataaggag aatctgcagg tagccttcca c 221
<210> 41
<211> 241
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 41
agcatcgttt ctccatggca atgcctcttt gctcttcaaa cggacaaaca agcagcagca 60
gcttcctttg ccacctgttc ctcataccgg tgactcgctg accaataata acaacatctc 120
agcctatcag tcagggacac cagaaagggc caacatccag tcccgtccat taccctcccc 180
tcccaaattc tcagccgagg aggaggctcc agataggccg tatgagacaa cagaggaggg 240
t 241
<210> 42
<211> 215
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 42
ggcatcacga tgaaagtcac cagcaggtcg gcaacggtga ggttcatgat taaaattcgt 60
acatgggact tgcgcttgtt gttggtgctg gcagcccaca acacgccgag gttgcacaca 120
gctgacactg cgcaaagagt gaaggtaatt atcaccctca cttttgctgc catggaaaat 180
gtgggcagct gcaatgccgc ttcacctgtg ttatt 215
<210> 43
<211> 245
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 43
gacgaggatg tgaacccagc tataaggcgg tactatgaat ccagcatgac agcatatgaa 60
gctgctgaga ttggtctgcc gggagattat gaagagggtg gccagcccat ggtttgggct 120
gagagtgaaa actccctcgg tagacggatg cagatcgacc ggctagatat caacgtgcaa 180
attgacgaat cgtactgtgt ggatgtgggt gaaggtttga agagatggaa gtgtcgcatg 240
tgtga 245
<210> 44
<211> 248
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 44
atggaggatg atttggctga gctctgcagt aggttttcag cttttcgggt gtagggtcgt 60
cctattcgag aatggttctg ctgctgatga tgatgaggac gatgatgctg agaccatcta 120
atgttagaca tgtggtccag agtgtggcct cgagcatctt gtcttctgtc cacagtcttc 180
atctggttga gtttgcagga ggagatgaga ggtctgtcta tgtccacctc tctgctctct 240
gtcagacg 248
<210> 45
<211> 205
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 45
aaatctacct tctcccagac cgcaaaacta agcaccagac caaggtgcat cgtaagactc 60
tgaaccctgt ctttgatgag gtcttcctct tccctgtggc gtatgcagat ctgcccacaa 120
ggaagttgca cttcagcgtc tacgattttg atcgattttc acgccacgat attattgggc 180
aggtggtggt tgacaacttt ctgga 205
<210> 46
<211> 232
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 46
ctcctcttgc tcttcctcct tccacctgct gcagttaaga ggctttgtat gttagacctg 60
ctgacctata gacttgagct ttcatcccat ttactttccc agtgactgaa agcacttctt 120
tactctcgcg tcaaccggat aggctgtgct ctcaaagcaa agcgctgcaa gagcaagact 180
gcgcatcgcc tgggaagctg tagcggttaa agttgccagt agagggtgtg tc 232
<210> 47
<211> 233
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 47
aggtctccct tagccatctc agagccagat tcctctgcat ggtgccacgt ggaatcctgg 60
gatctctcgt gtcccctcgc agcttgtagt tccgtggggt ctccacattg aggtgtgtgt 120
agttcagccc ggtttccctc agaagcctcg tgaccagagg ggttctcctc tgagagtcct 180
ccaccaggat ccagtgcagg ttgggcacat gaaggaatgt gttggccaat cgc 233
<210> 48
<211> 248
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 48
taggagatcc tctgaggcat ggactacata ttatctcaat cttcctggga ctgagatttt 60
cagagagtct cctttcacct cgtttctata aaagtgaggg atatttgtgt cacgcactgc 120
tcctatggtt tcattggagt gttcgttcag tcttctctgc ctttctctct tccgctctct 180
gcctctgcga tcatgctctg aaatcatcag tttgcacatc gagggcacac ctgtctctct 240
caaatgcg 248
<210> 49
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 49
tacacgacgc tcttccgatc tcttcagctg gaagtttgtg gcaa 44
<210> 50
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 50
tccttggcac ccgagaattc caaatctcag aggtgttcct gctcc 45
<210> 51
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 51
tacacgacgc tcttccgatc tgctggaagt ttgtggcaaa ctct 44
<210> 52
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 52
tccttggcac ccgagaattc caaatctcag aggtgttcct gctcc 45
<210> 53
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 53
tacacgacgc tcttccgatc tcgatctgaa ccacagttaa ccgc 44
<210> 54
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 54
tccttggcac ccgagaattc cagagccgtt ttcagtcctg atgtg 45
<210> 55
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 55
tacacgacgc tcttccgatc tgagaatcgg gttcaaaacg ctgt 44
<210> 56
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 56
tccttggcac ccgagaattc caggtcgatc gctttaacgc tgaaa 45
<210> 57
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 57
tacacgacgc tcttccgatc tacaccctta aaaccagctg ttgc 44
<210> 58
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 58
tccttggcac ccgagaattc cataactccg actttctgga cgcat 45
<210> 59
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 59
tacacgacgc tcttccgatc tcggtatcga gagtgacttc gagg 44
<210> 60
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 60
tccttggcac ccgagaattc caagtgtgtt gtctgctgga tgagt 45
<210> 61
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 61
tacacgacgc tcttccgatc tctccacaca ggattctcct ccag 44
<210> 62
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 62
tccttggcac ccgagaattc caaacagagc ggatcacttc taccc 45
<210> 63
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 63
tacacgacgc tcttccgatc tgtttccagg tcaaactgac tggc 44
<210> 64
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 64
tccttggcac ccgagaattc caggggtttc agatgggctc aaatg 45
<210> 65
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 65
tacacgacgc tcttccgatc tatttatcca tctctacccc ggcg 44
<210> 66
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 66
tccttggcac ccgagaattc caaaagggct gaaggcggat cttat 45
<210> 67
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 67
tacacgacgc tcttccgatc tctgctctgg atgtcaagcc tttg 44
<210> 68
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 68
tccttggcac ccgagaattc cagtgtgagg gttttgtggt actgc 45
<210> 69
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 69
tacacgacgc tcttccgatc tggagcgggt catctctcta gttc 44
<210> 70
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 70
tccttggcac ccgagaattc cacaggttag cccggtcatc tagg 44
<210> 71
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 71
tacacgacgc tcttccgatc tgtaaaatcc caacgcggtc tgag 44
<210> 72
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 72
tccttggcac ccgagaattc cataatgccc ggttcatcat gttgc 45
<210> 73
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 73
tacacgacgc tcttccgatc tagccaattt ctttagccgg ttcg 44
<210> 74
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 74
tccttggcac ccgagaattc caaactcaaa gacctcacgt cgtca 45
<210> 75
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 75
tacacgacgc tcttccgatc tgcttcaagt tctgcagaga gctg 44
<210> 76
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 76
tccttggcac ccgagaattc cagacaaaca gaacaactcc gcgaa 45
<210> 77
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 77
tacacgacgc tcttccgatc tctccatgca ctctccttct cctc 44
<210> 78
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 78
tccttggcac ccgagaattc cacaatgcct tcatacgctc agtcc 45
<210> 79
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 79
tacacgacgc tcttccgatc tactgggaga aataggcact gtcc 44
<210> 80
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 80
tccttggcac ccgagaattc catcagggag caccaaagaa ctcaa 45
<210> 81
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 81
tacacgacgc tcttccgatc tcaccgatga ctccaaacat gctc 44
<210> 82
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 82
tccttggcac ccgagaattc catggttatg tgaatacggc cgtct 45
<210> 83
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 83
tacacgacgc tcttccgatc tgctctaagg ggtcacgact acag 44
<210> 84
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 84
tccttggcac ccgagaattc caaacggacg gggatcctat agact 45
<210> 85
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 85
tacacgacgc tcttccgatc tttcattctg aagtgcagcg tgtg 44
<210> 86
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 86
tccttggcac ccgagaattc cacgctggga ttaaagctcc aagtc 45
<210> 87
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 87
tacacgacgc tcttccgatc tgcagcttcc gcttcttaaa ccat 44
<210> 88
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 88
tccttggcac ccgagaattc catgtaatcc ctcactctac cccga 45
<210> 89
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 89
tacacgacgc tcttccgatc tagaggcgga tgaagtcaag ttca 44
<210> 90
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 90
tccttggcac ccgagaattc cacagctgct gtactcgaag ctttc 45
<210> 91
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 91
tacacgacgc tcttccgatc tctgagagct ggcagtctta ccat 44
<210> 92
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 92
tccttggcac ccgagaattc caactttcac tcaccaccat gtcca 45
<210> 93
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 93
tacacgacgc tcttccgatc ttcagatgcc tgcatgtacg agaa 44
<210> 94
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 94
tccttggcac ccgagaattc cattcccatt cagagcccat cagag 45
<210> 95
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 95
tacacgacgc tcttccgatc tcaaacagtg gagccaacaa cact 44
<210> 96
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 96
tccttggcac ccgagaattc cactagcagt gttccgtcct ctcaa 45
<210> 97
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 97
tacacgacgc tcttccgatc ttgccatcta aagtgcggaa gaga 44
<210> 98
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 98
tccttggcac ccgagaattc catctgaggt cttcaaaagc cccaa 45
<210> 99
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 99
tacacgacgc tcttccgatc ttgcccactc ttaaaactgg agct 44
<210> 100
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 100
tccttggcac ccgagaattc cacgtttatg actcaaagtg ggccc 45
<210> 101
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 101
tacacgacgc tcttccgatc tgtctggatg tgaacagcga tgtg 44
<210> 102
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 102
tccttggcac ccgagaattc cagacagacc tcctcgtcac tcttc 45
<210> 103
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 103
tacacgacgc tcttccgatc tcagatccct ggtgctgttg taga 44
<210> 104
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 104
tccttggcac ccgagaattc caggcaaagg actgctgttt gttct 45
<210> 105
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 105
tacacgacgc tcttccgatc ttctccagtt tgagcacaga caca 44
<210> 106
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 106
tccttggcac ccgagaattc cattttgtgt tgttgtgaat cgcgc 45
<210> 107
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 107
tacacgacgc tcttccgatc tgtaataatt tgtgtgcgcg cgtg 44
<210> 108
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 108
tccttggcac ccgagaattc cactgagctc tgtctgcatc tgct 44
<210> 109
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 109
tacacgacgc tcttccgatc tagattagac gtctgcattt gcgc 44
<210> 110
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 110
tccttggcac ccgagaattc catacatctc cactgcggtg tagtg 45
<210> 111
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 111
tacacgacgc tcttccgatc tcgtcacgtt atgccagcac taag 44
<210> 112
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 112
tccttggcac ccgagaattc cagttaccgt gacgactaca tccca 45
<210> 113
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 113
tacacgacgc tcttccgatc taccaggaga aatgtgtggt gtct 44
<210> 114
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 114
tccttggcac ccgagaattc caggtttatg gttttatgcc cgcca 45
<210> 115
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 115
tacacgacgc tcttccgatc tactagcctg ttttctggag cact 44
<210> 116
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 116
tccttggcac ccgagaattc caaaagacat cggggcgact ttagt 45
<210> 117
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 117
tacacgacgc tcttccgatc tgaatgcgca ggaaagggat gaaa 44
<210> 118
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 118
tccttggcac ccgagaattc caatatttgg tccagaggct gcact 45
<210> 119
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 119
tacacgacgc tcttccgatc ttatagccag tggactgtcc tcct 44
<210> 120
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 120
tccttggcac ccgagaattc caggcaatgc tcttcgctat cgatc 45
<210> 121
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 121
tacacgacgc tcttccgatc tgtgtcatgc tggactacta ccgt 44
<210> 122
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 122
tccttggcac ccgagaattc caggggttct attgggactt cctcc 45
<210> 123
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 123
tacacgacgc tcttccgatc ttagattgca ggtaggtgga gcac 44
<210> 124
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 124
tccttggcac ccgagaattc caaacagaac aagttcagcc cgttg 45
<210> 125
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 125
tacacgacgc tcttccgatc ttcacccagt catgaagttg ctga 44
<210> 126
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 126
tccttggcac ccgagaattc caataagctg tgtgtcaggg ctgat 45
<210> 127
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 127
tacacgacgc tcttccgatc tatttcgaag atgaccaggg cgta 44
<210> 128
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 128
tccttggcac ccgagaattc catggaaggc tacctgcaga ttctc 45
<210> 129
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 129
tacacgacgc tcttccgatc tagcatcgtt tctccatggc aatg 44
<210> 130
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 130
tccttggcac ccgagaattc caccctcctc tgttgtctca tacgg 45
<210> 131
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 131
tacacgacgc tcttccgatc tggcatcacg atgaaagtca ccag 44
<210> 132
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 132
tccttggcac ccgagaattc caataacaca ggtgaagcgg cattg 45
<210> 133
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 133
tacacgacgc tcttccgatc tgacgaggat gtgaacccag ctat 44
<210> 134
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 134
tccttggcac ccgagaattc cacacacatg cgacacttcc atctc 45
<210> 135
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 135
tacacgacgc tcttccgatc tatggaggat gatttggctg agct 44
<210> 136
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 136
tccttggcac ccgagaattc cagtctgaca gagagcagag aggtg 45
<210> 137
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 137
tacacgacgc tcttccgatc taaatctacc ttctcccaga ccgc 44
<210> 138
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 138
tccttggcac ccgagaattc caccagaaag ttgtcaacca ccacc 45
<210> 139
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 139
tacacgacgc tcttccgatc tctcctcttg ctcttcctcc ttcc 44
<210> 140
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 140
tccttggcac ccgagaattc caacacaccc tctactggca acttt 45
<210> 141
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 141
tacacgacgc tcttccgatc taggtctccc ttagccatct caga 44
<210> 142
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 142
tccttggcac ccgagaattc cacgattggc caacacattc cttca 45
<210> 143
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 143
tacacgacgc tcttccgatc ttaggagatc ctctgaggca tgga 44
<210> 144
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 144
tccttggcac ccgagaattc cagcatttga gagagacagg tgtgc 45
Claims (5)
1. The reference gene set is characterized by comprising nucleotide sequences shown as SEQ ID NO. 1-SEQ ID NO. 48 in a sequence table; the gene length of each reference gene in the reference gene set is 180-250bp, the GC content is 40-60%, the base G, C is not concentrated at the 3 'or 5' end of the DNA, and the number of continuous bases is less than 5; the reference genes in the reference gene set are derived from zebra fish genes; the dilution concentration of each reference gene in the reference gene set is 1000-1500 copies/. Mu.L.
2. A universal primer set for use in a multiplex PCR system, the universal primer set comprising: a universal adaptor for ligating specific nucleic acid fragments at both ends of the reference gene, and a primer pair corresponding to each reference gene of the reference gene set as set forth in claim 1 or a DNA sequence differing from the primer pair by one base, respectively;
wherein each primer pair consists of a forward primer and a reverse primer, and the nucleotide sequences of the forward primer and the reverse primer of each primer pair are respectively shown as SEQ ID NO. 49-SEQ ID NO. 144 in the sequence table in sequence.
3. The universal primer set for use in a multiplex PCR system as claimed in claim 2, wherein the universal adaptors comprise a first universal adaptor and a second universal adaptor;
the nucleotide sequence of the first universal joint is as follows: TACACGACGCTCTTCCGATCT;
the nucleotide sequence of the second universal joint is as follows: TCCTTGGCACCCGAGAATTCCA.
4. A kit for use in a multiplex PCR system, comprising the reference gene set according to claim 1 and the universal primer set according to any one of claims 2 to 3 for use in a multiplex PCR system.
5. The reaction system for a multiplex PCR system, which comprises the reference gene set according to claim 1 and the universal primer set according to any one of claims 2 to 3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011171377.5A CN112251501B (en) | 2020-10-28 | 2020-10-28 | Internal reference gene set, screening method thereof, universal primer group, kit, reaction system and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011171377.5A CN112251501B (en) | 2020-10-28 | 2020-10-28 | Internal reference gene set, screening method thereof, universal primer group, kit, reaction system and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112251501A CN112251501A (en) | 2021-01-22 |
| CN112251501B true CN112251501B (en) | 2023-07-25 |
Family
ID=74262728
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011171377.5A Active CN112251501B (en) | 2020-10-28 | 2020-10-28 | Internal reference gene set, screening method thereof, universal primer group, kit, reaction system and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112251501B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112680797B (en) * | 2021-02-04 | 2023-09-26 | 广州大学 | Sequencing library for removing high-abundance RNA and construction method thereof |
| CN113025692B (en) * | 2021-05-18 | 2021-11-30 | 江苏为真生物医药技术股份有限公司 | Primate DNA methylation relative quantification kit |
| CN114672594A (en) * | 2022-04-02 | 2022-06-28 | 深圳市国赛生物技术有限公司 | Primer and probe combination for detecting enterovirus 71 and kit thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109554443A (en) * | 2018-12-29 | 2019-04-02 | 杭州迪安医学检验中心有限公司 | A kind of primer and its application based on high throughput sequencing technologies detection DMD genetic mutation |
Family Cites Families (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109996877A (en) * | 2016-12-16 | 2019-07-09 | 深圳华大基因股份有限公司 | A kind of gene label, kit and its application for nucleic acid samples mark |
| CN107513576A (en) * | 2017-10-18 | 2017-12-26 | 北京生命科学研究所 | A kind of kit and its application for being used to detect heredity cardiomyopathies |
| CN109207579B (en) * | 2018-09-06 | 2022-03-22 | 宁波海尔施基因科技股份有限公司 | Multiple detection kit for detecting malignant high fever susceptibility gene and application thereof |
| CN109811055A (en) * | 2019-01-08 | 2019-05-28 | 广州金域医学检验中心有限公司 | Sarcoma fusion detection kit and system |
| CN110257503B (en) * | 2019-06-28 | 2022-07-08 | 北京和合医学诊断技术股份有限公司 | Primer group for detecting vitamin E metabolic gene TTPA and multiplex PCR detection method |
| CN110628880B (en) * | 2019-09-30 | 2021-03-16 | 深圳恒特基因有限公司 | Method for detecting gene variation by synchronously using messenger RNA and genome DNA template |
| CN110724731A (en) * | 2019-11-22 | 2020-01-24 | 上海冰缘医疗科技有限公司 | Method for adding internal reference quantity of nucleic acid copy number in multiplex PCR system |
| CN111020061B (en) * | 2019-12-31 | 2021-01-05 | 广州迈景基因医学科技有限公司 | Multiplex PCR primer group, kit and method for detecting HPV based on high-throughput sequencing |
-
2020
- 2020-10-28 CN CN202011171377.5A patent/CN112251501B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109554443A (en) * | 2018-12-29 | 2019-04-02 | 杭州迪安医学检验中心有限公司 | A kind of primer and its application based on high throughput sequencing technologies detection DMD genetic mutation |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112251501A (en) | 2021-01-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112251501B (en) | Internal reference gene set, screening method thereof, universal primer group, kit, reaction system and application | |
| US6376191B1 (en) | Microarray-based analysis of polynucleotide sequence variations | |
| JP5596891B2 (en) | Probe set, probe fixing carrier, and genetic testing method | |
| JP5201818B2 (en) | Probe set, probe fixing carrier, and genetic testing method | |
| JP5596893B2 (en) | Probe set, probe fixing carrier, and genetic testing method | |
| JP5037905B2 (en) | Probe, probe set, probe fixing carrier, and genetic testing method | |
| US20070141604A1 (en) | Method of target enrichment | |
| US20080274904A1 (en) | Method of target enrichment | |
| JP5596894B2 (en) | Probe set, probe fixing carrier, and genetic testing method | |
| JP2004313181A (en) | Probe for detecting infection-inducing microbe, probe set, carrier and method for testing gene | |
| JP2008118914A (en) | Probe, probe set, probe-immobilized carrier and genetic testing method | |
| JP2008118904A (en) | Probe, probe set, probe-immobilized carrier and method for testing gene | |
| JP2008118908A (en) | Probe, probe set, probe-immobilized carrier and method for testing gene | |
| CN112725410B (en) | Primer group for detecting pathogenic microorganisms | |
| CN100354298C (en) | Methods and compositions for analyzing compromised samples using single nucleotide polymorphism panels | |
| US7923546B2 (en) | Base sequence for control probe and method of designing the same | |
| CN105936940B (en) | Nucleic acid sequence for detecting deafness gene and application thereof | |
| JP2006129810A (en) | Probe set for detecting phlogogenic bacterium of infectious disease, carrier and method for examining gene | |
| JP2002537824A (en) | Bacterial identification | |
| CN112592981B (en) | Primer group, kit and method for DNA archive construction | |
| EP3485034B1 (en) | System and method for transposase-mediated amplicon sequencing | |
| JP2009000099A (en) | Method for detecting nucleic acid in sample, and method and system for designing probe used therefor | |
| CN111500748B (en) | Primer combination for detecting 617 SNPs and InDel and application thereof in forensic identification and genetic relationship identification | |
| CN113444769B (en) | Construction method and application of DNA tag sequence | |
| CN113186265A (en) | Long-range PCR method and kit for detecting polymorphism variation of CYP2D6 gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |