CN112251391A - Construction method and application of lysine production strain - Google Patents

Abstract

The invention discloses a construction method and application of a lysine production strain. The invention provides a method for constructing engineering bacteria, which comprises the following steps: in the starting strain, a SpeB protein, a SecY protein and/or an AtpB protein are modified to obtain an engineering strain with improved lysine tolerance and/or improved lysine yield compared with the starting strain. The invention provides a mutant of SpeB, AtpB and SecY proteins, and improves the yield of lysine. The invention provides a construction method of a lysine high-producing strain which over-expresses SpeB and weakens SecY. The invention provides a brand new idea for constructing the lysine production strain.

Description

Construction method and application of lysine production strain

The application is a divisional application with the application number of 201910393041.4, the application date of 2019, 5 and 13, and the name of 'construction method and application of lysine production strain'.

Technical Field

The invention relates to the field of genetic engineering, in particular to a construction method and application of a lysine production strain.

Background

Lysine is essential amino acid for animal and human body, and has effects of promoting human body development, enhancing immunity, and improving central nervous tissue function. L-lysine cannot be synthesized by human body, and can only be taken from food, but because the content of lysine in cereal food is very low, it is also called the first limiting amino acid, and has a very important position in the industries of medicine, health, food, animal feed, cosmetics, and the like. Currently, lysine is mainly produced by fermentation of microorganisms belonging to the genus Escherichia (Escherichia), Corynebacterium (Corynebacterium), Brevibacterium (Brevibacterium), and the like. In recent years, there have been many reports on the construction of engineered strains of Escherichia coli for lysine production, such as WO1994011517 reporting a mutant aspartate kinase LysC for relieving lysine feedback inhibition, WO1995016042 reporting a mutant DapA for relieving lysine feedback inhibition, CN101243177A reporting overexpression of lysine transporter, and the like. Therefore, a great deal of improvement and development has been carried out in various aspects related to the publicly known lysine metabolism, and the acid-producing ability of the current industrial lysine-producing strains has reached a high level.

As is known, a cell is a complex metabolic network aggregate, and in the synthesis process of a certain compound, people usually modify pathways directly related to metabolism (including substrate transportation, product transportation and the like) without modifying other unrelated pathways in the cell, because the influence of the change of the unrelated pathways on strains is unknown, and the metabolic pathways in the cell are numerous, so that it is very difficult to dig out modifiable points related to lysine production from the numerous pathways, and especially, under the condition that the current lysine industrial strains reach high levels, it is very difficult to further promote the modifiable points, even slightly promote the modifiable points.

Disclosure of Invention

The SpeB protein, guanidinobutylase, catalyzes the production of urea and putrescine from agmatine. The AtpB protein, a subunit of the ATP synthase F0 complex. SecY protein, Sec transporter subunit. None of the above three proteins are in the major metabolic pathway of lysine synthesis, nor in the glycolytic pathway, and thus, one skilled in the art would not normally appreciate whether modification of these proteins would be beneficial for lysine production. In a number of studies conducted in the early stage of this application, a strain capable of tolerating lysine at high concentrations was obtained by lysine tolerance screening of the strain, and after genome sequencing and comparative genome analysis of the strain, point mutations were found in the SpeB protein, AtpB protein, and SecY protein in the strain, and these mutants could improve lysine production, leading to completion of the present invention.

In a first aspect, the invention claims a method for constructing engineering bacteria with improved lysine tolerance and/or lysine yield.

The method for constructing engineering bacteria claimed by the invention can comprise the following steps: in the starting strain, a SpeB protein, a SecY protein and/or an AtpB protein are modified to obtain the engineering strain with improved lysine tolerance and/or lysine yield compared with the starting strain.

The 'modification of SpeB protein, SecY protein and/or AtpB protein in the outbreak' can be direct modification of SpeB protein, SecY protein and/or AtpB protein endogenous to the outbreak, or can be introduction of modified exogenous SpeB protein, SecY protein and/or AtpB protein into the outbreak.

In the development, the SpeB protein may be engineered as any one of:

(a1) overexpresses the SpeB protein;

(a2) overexpressed SpeB^A302VA protein; the SpeB^A302VThe protein is obtained by mutating alanine (A) at position 302 of the SpeB protein into valine (V);

(a3) alanine to valine mutation at position 302 of the SpeB protein.

In the development bacterium, the modification of the SecY protein may be any of:

(b1) inhibiting the expression of said SecY protein;

(b2) mutating methionine (M) at position 145 of the SecY protein to valine;

(b3) the initiation codon atg of the gene encoding the SecY protein was mutated to gtg.

In the developing strain, the modification of the AtpB protein may be any of:

(c1) overexpression of AtpB^S165NA protein; the AtpB^S165NThe protein is obtained by mutating serine (S) at the 165 th site of the AtpB protein into asparagine (N);

(c2) the 165 th serine of the AtpB protein was mutated to asparagine.

In a specific embodiment of the present invention, the method is specifically any one of:

method A, comprising the steps of: and (3) over-expressing the SpeB protein in the outbreak bacteria to obtain the engineering bacteria.

The method B comprises the following steps: overexpressing the SpeB in the hairline^A302VAnd (3) obtaining the engineering bacteria.

Method C, comprising the steps of: in the development of the bacteriaOverexpresses the AtpB^S165NAnd (3) obtaining the engineering bacteria.

Method D, comprising the steps of: and inhibiting the expression of the SecY protein in the outbreak bacteria to obtain the engineering bacteria.

Method E, comprising the steps of: and (3) mutating the methionine at the 145 th site of the SecY protein in the outbreak bacterium into valine to obtain the engineering bacterium.

Method F, comprising the steps of: and mutating the initiation codon atg of the coding gene of the SecY protein in the outbreak bacterium into gtg to obtain the engineering bacterium.

Method G, comprising the steps of: and (3) mutating alanine at the 302 th site of the SpeB protein in the outbreak bacteria into valine, mutating serine at the 165 th site of the AtpB protein into asparagine, and mutating methionine at the 145 th site of the SecY protein into valine to obtain the engineering bacteria.

Further, in particular embodiments of the invention, overexpression of the SpeB protein is achieved by introducing a gene encoding the SpeB protein into the construct.

Further, in particular embodiments of the invention, the SpeB is overexpressed^A302VProtein is produced by introducing the SpeB into the starting material^A302VThe coding gene of the protein.

Further, in a specific embodiment of the present invention, inhibiting the expression of the SecY protein in the outgoing bacteria is achieved by introducing sRNA targeting nucleotides 1 to 24 of the gene encoding the SecY protein into the outgoing bacteria.

Further, in a specific embodiment of the present invention, the mutation of methionine at position 145 of the SecY protein in the starting bacterium to valine is performed by introducing a SecY433 fragment into the starting bacterium, wherein the nucleotide sequence of the SecY433 fragment is shown in SEQ ID No. 7. Wherein, the 1-442 site and the 1435-2804 site of SEQ ID No.7 are homologous arms at both ends of the first homologous recombination, the 443-482 site and the 1395-1434 site are homologous sequences of the second recombination, and the 483-1394 site is a chloramphenicol resistance gene plus an N20PAM fragment.

Further, in a specific embodiment of the present invention, mutating the initiation codon atg of the gene encoding the SecY protein in the outgrowth bacterium to gtg is performed by introducing a secYgtg fragment into the outgrowth bacterium, wherein the nucleotide sequence of the secYgtg fragment is represented by SEQ ID No. 8. Wherein, the 1-78 th site and 1071-1113 th site of SEQ ID No.8 are homologous arms at two ends of the first homologous recombination, the 79-118 th site and 1031-1070 th site are homologous sequences of the second recombination, and the 119-1030 th site is a chloramphenicol resistance gene plus an N20PAM fragment.

Further, in a specific embodiment of the present invention, the AtpB is overexpressed^S165NThe protein was prepared by introducing the AtpB into the starting^S165NThe coding gene of the protein.

In the invention, the starting bacterium can be specifically a lysine production strain.

Further, the starting bacterium is escherichia coli or corynebacterium glutamicum.

Further, the E.coli may be E.coli overexpressing LysC protein and DapA protein.

Wherein the amino acid sequence of the LysC protein is SEQ ID No. 9; the amino acid sequence of the DapA protein is SEQ ID No. 10.

In a particular embodiment of the invention, the E.coli is in particular E.coli LYS 1; the Corynebacterium glutamicum is specifically Corynebacterium glutamicum B253.

In a second aspect, the invention claims any one of the following biomaterials:

(I) a protein or a protein set;

the protein is SpeB^A302VProtein, AtpB^S165NProtein or SecY^M145VA protein;

the set of proteins consists of at least two of the following proteins: SpeB^A302VProtein, AtpB^S165NProteins and SecY^M145VProtein composition;

the SpeB^A302VThe protein is obtained by mutating alanine at position 302 of SpeB protein into valine; the AtpB^S165NProteinIs a protein obtained by mutating 165 th serine of AtpB protein into asparagine; the SecY^M145VThe protein is obtained by mutating the 145 th methionine of the SecY protein into valine;

(II) a gene or set of genes;

the gene is the SpeB^A302VCoding gene of protein, AtpB^S165NGene encoding protein or the SecY^M145VA gene encoding a protein;

said set of genes consists of said SpeB^A302VCoding gene of protein, AtpB^S165NEncoding gene of protein and SecY^M145VAt least two of the genes encoding the proteins;

(III) a DNA fragment which is a secY433 fragment or a secYgtg fragment;

the nucleotide sequence of the secY433 fragment is shown as SEQ ID No.7 (used for mutating methionine at position 145 of the secY protein in the outbreak bacteria into valine); the nucleotide sequence of the secYgtg fragment is shown as SEQ ID No.8 (used for mutating the initiation codon atg of the coding gene of the SecY protein in the outbreak bacteria into gtg);

(III) an expression cassette or set of expression cassettes;

the expression cassette is a vector comprising the SpeB^A302VExpression cassette of coding gene of protein, containing AtpB^S165NExpression cassette of protein-encoding gene, and SecY-containing vector^M145VAn expression cassette of a gene encoding a protein or an expression cassette containing the DNA fragment;

the set of expression cassettes consists of a vector comprising the SpeB^A302VExpression cassette of coding gene of protein, containing AtpB^S165NExpression cassette of protein-encoding gene, and SecY-containing vector^M145VAt least two of an expression cassette of a gene encoding a protein and an expression cassette containing the DNA fragment;

(IV) a recombinant vector or a set of recombinant vectors;

the recombinant vector contains the SpeB^A302VRecombinant vector of protein coding gene and recombinant vector containing AtpB^S165NRecombinant vector of protein coding gene and SecY-containing recombinant vector^M145VA recombinant vector of a gene encoding a protein or a recombinant vector containing the DNA fragment;

the set of recombinant vectors consists of a vector comprising the SpeB^A302VRecombinant vector of protein coding gene and recombinant vector containing AtpB^S165NRecombinant vector of protein coding gene and SecY-containing recombinant vector^M145VAt least two of recombinant vector of coding gene of protein and recombinant vector containing said DNA fragment;

(V) recombinant bacteria or a set of recombinant bacteria;

the recombinant bacterium contains the SpeB^A302VRecombinant strain of protein coding gene and gene containing AtpB^S165NRecombinant strain of protein coding gene and containing SecY^M145VRecombinant bacteria of coding genes of the protein or recombinant bacteria containing the DNA segments;

the recombinant bacterium set consists of the SpeB^A302VRecombinant strain of protein coding gene and gene containing AtpB^S165NRecombinant strain of protein coding gene and containing SecY^M145VAt least two of recombinant bacteria of the coding gene of the protein and recombinant bacteria containing the DNA segment;

(VI) the engineered bacteria prepared by the method of the first aspect.

In a third aspect, the invention claims any of the following applications:

(a) use of a biomaterial as described in the second aspect for improving the starting bacterial lysine tolerance and/or lysine production;

(b) use of the biomaterial of the second aspect in the production of lysine;

(c) the application of the SpeB protein in improving the starting bacteria tolerance capability and/or lysine yield;

(d) use of a SpeB protein in the production of lysine.

In each of the above aspects, the SpeB protein may specifically be any of the proteins set forth below:

(A1) a protein having the amino acid sequence of SEQ ID No.1 (E.coli SpeB protein);

(A2) protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence shown in SEQ ID No.1 and has the same function;

(A3) a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more homology to the amino acid sequence defined in any one of (A1) to (A2) and having the same function;

(A4) a fusion protein obtained by attaching a tag to the N-terminus and/or C-terminus of the protein defined in any one of (A1) to (A3).

In the above aspects, the AtpB protein may specifically be any one of the following proteins:

(B1) a protein (E.coli AtpB protein) having the amino acid sequence of SEQ ID No. 2;

(B2) protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence shown in SEQ ID No.2 and has the same function;

(B3) a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more homology to the amino acid sequence defined in any one of (B1) to (B2) and having the same function;

(B4) a fusion protein obtained by attaching a tag to the N-terminus and/or C-terminus of the protein defined in any one of (B1) to (B3).

In the above aspects, the SecY protein may specifically be any one of the following proteins:

(C1) a protein having an amino acid sequence of SEQ ID No.3 or SEQ ID No.11 (SEQ ID No.3 is a Escherichia coli SecY protein, and SEQ ID No.11 is a Corynebacterium glutamicum SecY protein);

(C2) protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence shown in SEQ ID No.3 and has the same function;

(C3) a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more homology to the amino acid sequence defined in any one of (C1) to (C2) and having the same function;

(C4) a fusion protein obtained by attaching a tag to the N-terminus and/or C-terminus of the protein defined in any one of (C1) to (C3).

The gene encoding the SpeB protein may specifically be a DNA molecule according to any one of the following:

(D1) DNA molecule (E.coli SpeB gene) shown in SEQ ID No.4 or 101-1021 position (CDS) of SEQ ID No. 4;

(D2) a DNA molecule that hybridizes under stringent conditions to the DNA molecule defined in (D1) and encodes the SpeB protein;

(D3) a DNA molecule having 99% or more, 95% or more, 90% or more, 85% or more or 80% or more homology to the DNA sequence defined in (D1) or (D2) and encoding said SpeB protein.

The coding gene of the AtpB protein may specifically be any one of the following DNA molecules, corresponding to the gene level:

(E1) DNA molecule (E.coli AtpB gene) shown in SEQ ID No.5 or position 101-916 (CDS) of SEQ ID No. 5;

(E2) a DNA molecule which hybridizes under stringent conditions to the DNA molecule defined in (E1) and which encodes said AtpB protein;

(E3) and (c) a DNA molecule which has more than 99%, more than 95%, more than 90%, more than 85% or more than 80% homology with the DNA sequence defined in (E1) or (E2) and encodes the AtpB protein.

The gene encoding the SecY protein may specifically be a DNA molecule according to any one of the following:

(F1) DNA molecule (E.coli SecY gene) shown in SEQ ID No.6 or 505-1836 th bit (CDS) of SEQ ID No. 6;

(F2) a DNA molecule (Corynebacterium glutamicum SecY gene) represented by SEQ ID No.12 or position 138-1460 (CDS) of SEQ ID No. 12;

(F3) a DNA molecule that hybridizes under stringent conditions to the DNA molecule defined in (F1) or (F2) and encodes the SecY protein;

(F4) a DNA molecule which has 99% or more, 95% or more, 90% or more, 85% or more or 80% or more homology with the DNA sequence defined in any one of (F1) to (F3) and which encodes the SecY protein.

Accordingly, the SpeB^A302VThe encoding gene of the protein can be specifically C905T, namely the encoding gene of the SpeB protein is obtained by replacing a codon (GCG) of alanine at position 302 of the SpeB protein with a codon (GTG) of valine, and the gene is named speB^C905T。

Accordingly, the AtpB^S165NThe gene encoding the protein may specifically be a gene in which the codon (AGC) encoding the 165 th serine of the AtpB protein in the gene encoding the AtpB protein is replaced with the codon (AAC) encoding asparagine, i.e., G494A, and the gene is named as atpB^G494A。

Accordingly, the SecY^M145VThe gene encoding the protein may specifically be a gene in which the codon encoding methionine at position 145 of the SecY protein (ATG) is replaced with the codon encoding valine (GTG), namely A433G, and the gene is named as secY^A433G。

In the above protein, the tag is a polypeptide or protein that is expressed by fusion with a target protein using in vitro recombinant DNA technology, so as to facilitate expression, detection, tracking and/or purification of the target protein. The protein tag may be a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag, and/or a SUMO tag, among others.

In the above genes, the stringent conditions may be as follows: 50 ℃ in 7% Sodium Dodecyl Sulfate (SDS), 0.5M NaPO₄Hybridization with 1mM EDTA, rinsing in 2 XSSC, 0.1% SDS at 50 ℃; also can be: 50 ℃ in 7% SDS, 0.5M NaPO₄Hybridization with 1mM EDTA, rinsing at 50 ℃ in 1 XSSC, 0.1% SDS; also can be: 50 ℃ in 7% SDS, 0.5M NaPO₄Hybridization with 1mM EDTA, rinsing in 0.5 XSSC, 0.1% SDS at 50 ℃; also can be: 50 ℃ in 7% SDS, 0.5M NaPO₄Hybridization with 1mM EDTA, rinsing in 0.1 XSSC, 0.1% SDS at 50 ℃; also can be: 50 ℃ in 7% SDS, 0.5M NaPO₄Hybridization with 1mM EDTA, rinsing in 0.1 XSSC, 0.1% SDS at 65 ℃; can also be: hybridization in 6 XSSC, 0.5% SDS solution at 65 ℃ howeverThen, the membrane was washed once with 2 XSSC, 0.1% SDS and 1 XSSC, 0.1% SDS, respectively.

In the present invention, the lysine-producing strain is specifically capable of producing lysine and accumulating lysine when the strain is cultured in culture.

The terms "protein of the invention" and "polypeptide of the invention" as used herein are used interchangeably and have the meaning commonly understood by one of ordinary skill in the art.

The "SpeB protein mutant" of the present invention refers to a mutant obtained by mutating an amino acid sequence having an amino acid sequence shown in SEQ ID No. 1. Specifically, the SpeB protein mutants of the present invention have a valine substituted for the amino acid sequence of alanine 302, which corresponds to the amino acid sequence set forth in SEQ ID No. 1. With respect to the present invention, a polypeptide having more than 80%, preferably 90%, more preferably 95%, most preferably 99% or more homology with SEQ ID No.1 derived from large intestine rods and having an activity of catalyzing the production of urea and putrescine from agmatine may also be included as long as it has an alanine substituted with valine at position 302 corresponding to the amino acid sequence shown in SEQ ID No. 1.

Similarly, the "AtpB protein mutant" of the present invention refers to a mutant obtained by mutating an amino acid sequence having an amino acid sequence shown in SEQ ID No. 2. Specifically, the AtpB protein mutant of the present invention has an amino acid sequence in which S at position 165 corresponding to the amino acid sequence shown in SEQ ID No.2 is substituted with N. With regard to the present invention, a polypeptide having more than 80%, preferably 90%, more preferably 95%, most preferably 99% or more homology to SEQ ID No.2 derived from the large intestine rod and having the subunit activity of the ATP synthase F0 complex may also be included as long as it has an asparagine substituted for serine at position 165 corresponding to the amino acid sequence shown in SEQ ID No. 2.

The SecY protein mutant is obtained by mutating an amino acid sequence shown as SEQ ID No. 3. Specifically, the SecY protein mutant of the present invention has an amino acid sequence in which methionine at position 145 corresponding to the amino acid sequence shown in SEQ ID No.3 is substituted with valine. With respect to the present invention, a polypeptide having more than 80%, preferably 90%, more preferably 95%, most preferably 99% or more homology to SEQ ID No.3 derived from the large intestine rod and having Sec transporter subunit activity may also be included as long as it has a valine substituted for methionine at position 145 corresponding to the amino acid sequence shown in SEQ ID No. 3.

The term "native state" as used herein refers to the activity of a polypeptide in a microorganism in an unmodified state, i.e., the activity in the native state.

The term "enhancing the activity of a protein as compared with the natural state" as used herein refers to enhancing the intracellular activity of a protein in a microorganism by modifying the protein as compared with the activity of the protein possessed in the natural state. The term "exogenous" as used herein means that a system contains material that was not originally present. For example, including but not limited to, introducing a gene encoding an enzyme that is not originally present in a strain into the strain by transformation or the like, thereby expressing the enzyme in the strain, the enzyme is "exogenous" to the strain.

The term "enhancing" as used herein includes not only higher effects than the original functions due to the increase in the activity of the protein itself, but also it can be performed by at least one method selected from the group consisting of: increasing the copy number of a polynucleotide encoding a protein, modifying a regulatory sequence of a gene encoding a protein, replacing a regulatory sequence of a gene encoding a protein on a chromosome with a sequence having strong activity, replacing a gene encoding a protein with a mutant gene to increase the activity of a protein, introducing a modification in a gene encoding a protein on a chromosome to enhance the activity of a protein, and may also include, without limitation, any of the existing methods as long as the activity of a protein can be enhanced or the activity of an introduced protein can be enhanced as compared with the endogenous activity.

The term "activity of an introduced protein" as used herein has the meaning conventionally understood by those skilled in the art and can be carried out by methods known in the art, including, but not limited to, such as: inserting a polynucleotide comprising a polynucleotide sequence encoding a protein into a chromosome, and/or cloning a polynucleotide into a vector, and/or increasing the copy number of the polynucleotide directly on the chromosome, and/or engineering a promoter having a polynucleotide encoding a protein to enhance the transcription initiation rate, and/or the transcription of a polynucleotide encoding a protein is modified to enhance its activity, and/or the translation regulatory sequence of a messenger RNA carrying the polynucleotide encoding the protein is modified to enhance the translation strength, and/or modifying the polynucleotide encoding the protein itself to enhance mRNA stability, protein stability, release of feedback inhibition of the protein, and the like, and may include, without limitation, any known method by which protein activity may be introduced.

As described above, the control sequences include a promoter capable of initiating transcription, any operator sequence for transcriptional control, sequences encoding suitable mRNA ribosome binding domains, sequences which control termination of transcription and translation. Modifications to regulatory sequences include, but are not limited to, such as: modifications introduced by deletions, insertions, conservative or non-conservative mutations, or combinations thereof in a polynucleotide sequence may also be made by replacing the original polynucleotide sequence with a polynucleotide sequence having enhanced activity. A vector is a DNA construct comprising a polynucleotide sequence encoding a target protein operably linked to suitable control sequences to allow expression of the target protein in a host cell. The vector may replicate or function independently of the host cell genome, or may be integrated into the genome of the host cell, after being transferred into a suitable host cell. These vectors may not be particularly limited as long as the vector is replicable in host cells, and it may be constructed using a hot river vector known in the art. Examples of vectors include natural or recombinant plasmids, cosmids, viruses, and phages. For example, pWE15, pET, pUC vectors and the like. In addition, by inserting the vector into the chromosome of the host cell, a polynucleotide encoding the endogenous target protein on the chromosome can be replaced with a modified polynucleotide. Insertion of the polynucleotide into the chromosome can be performed using any method known in the art, including, but not limited to, such as: by homologous recombination. Polynucleotides include DNA and RNA encoding target proteins, which may be inserted into the chromosome of a host cell in any form so long as they are capable of expression in the host cell. Including, but not limited to, such as: the polynucleotide may be introduced into the host cell in its native state, and/or in the form of an expression cassette. An expression cassette is a genetic construct that includes all the necessary elements for self-expression, and may also be an expression vector capable of self-replication, and may include a promoter operably linked to a polynucleotide, a transcription termination signal, a ribosome binding domain, and a translation termination signal.

Similarly, the term "attenuation" as used herein refers to the reduction, attenuation, reduction or complete elimination of the activity of a protein, e.g., an enzyme. In particular embodiments, attenuating the activity of an enzyme may be accomplished by methods of knocking out the gene encoding the enzyme partially or completely, inactivating or partially inactivating the gene by mutation, altering the promoter or translational regulatory region of the gene to attenuate its transcription or translation, altering the gene sequence to weaken its mRNA stability or destabilize the enzyme structure, regulating the gene by sRNA, or combinations thereof, including but not limited to the above methods.

The term "host cell" as used herein is a strain having the meaning commonly understood by those of ordinary skill in the art, i.e., comprising a SpeB protein, an AtpB protein, a SecY protein, or a mutant thereof. In other words, the present invention may utilize any host cell as long as the cell contains a SpeB protein, an AtpB protein, a SecY protein, or a mutant thereof and is capable of producing lysine. The host cell may be from the genera Escherichia (Escherichia), Pantoea (Pantoea), Brevibacterium (Brevibacterium sp), Bacillus (Bacillus), Klebsiella (Klebsiella), Serratia (Serratia) or Vibrio (Vibrio). Coli (e.coli) is preferred. Specifically, the host according to the present invention refers to a strain capable of producing lysine, i.e., capable of producing lysine and accumulating lysine when the bacterium is cultured in culture, or capable of secreting lysine into a medium, i.e., capable of obtaining extracellular free lysine, and particularly refers to the ability to accumulate more lysine as compared to a wild-type strain or a parent strain. In order to impart lysine-producing ability to the strain, conventional breeding methods such as breeding auxotrophic mutant strains, analogue-resistant strains, or metabolic control mutant strains capable of producing lysine, and breeding recombinant strains having improved activity of enzymes involved in amino acid biosynthesis, or a combination thereof can be employed.

The term "comprising a SpeB protein, AtpB protein, SecY protein mutant of the present invention" as used herein has the meaning conventionally understood by those skilled in the art and can be carried out by methods known in the art, including, but not limited to, such as: the insertion of a polynucleotide comprising a polynucleotide sequence encoding a protein into a chromosome, and/or the introduction of a polynucleotide into a microorganism by cloning the polynucleotide into a vector, and/or the direct addition of copies of the polynucleotide on a chromosome, may also be accomplished by any known method that can introduce protein activity, without limitation.

It is known to those skilled in the art that it is more important to mutate the wild-type polypeptide in order to increase its activity to find a site that achieves the desired purpose. Therefore, based on the teaching of the present invention, the skilled person will mutate the amino acid residue at position 302 of the amino acid sequence shown in SEQ ID No.1, the amino acid residue at position 165 of the amino acid sequence shown in SEQ ID No.2, and the amino acid residue at position 145 of the amino acid sequence shown in SEQ ID No.3, and test the mutants for the relevant activity. In a specific embodiment, a SpeB protein mutant of the invention is valine at position 302 corresponding to the amino acid sequence set forth in SEQ ID No.1, an AtpB protein mutant is asparagine at position 165 corresponding to the amino acid sequence set forth in SEQ ID No.2, and a SecY protein mutant is valine at position 145 corresponding to the amino acid sequence set forth in SEQ ID No. 3.

Furthermore, it will be appreciated by those of ordinary skill in The art that The alteration of a small number of amino acid residues in certain regions, e.g., non-critical regions, of a polypeptide does not substantially alter The biological activity, e.g., The sequence resulting from The appropriate substitution of certain amino acids does not affect The activity (see Watson et al, Molecular Biology of The Gene, fourth edition, 1987, The Benjamin/Cummings pub. Co. P224). Thus, one of ordinary skill in the art would be able to effect such a substitution and ensure that the resulting molecule still possesses the desired biological activity.

Thus, it is apparent that further mutations in the SpeB proteins, AtpB proteins, SecY proteins, and mutants thereof of the invention result in further mutants that still possess the corresponding function and activity. For example, it is well known to those skilled in the art that the addition or subtraction of several amino acid residues, e.g., preferably 1-20, more preferably 1-15, more preferably 1-10, more preferably 1-3, most preferably 1 amino acid residue, at either end of a polypeptide does not affect the function of the resulting mutant. For example, for ease of purification, the skilled artisan will often have a 6 × His tag on either end of the resulting protein, which has the same function as a protein without the 6 × His tag. Therefore, the present invention shall include the conservative mutants obtained on the basis of the present invention. These conservative mutants can be generated by, for example, amino acid substitution as shown in Table 1.

TABLE 1 conservative amino acid substitutions

The term "corresponding to" as used herein has the meaning commonly understood by a person of ordinary skill in the art. Specifically, "corresponding to" means the position of one sequence corresponding to a specified position in the other sequence after alignment of the two sequences by homology or sequence identity. Thus, for example, in the case of "amino acid residue corresponding to position 40 of the amino acid sequence shown in SEQ ID No. 1", if a 6 XHis tag is added to one end of the amino acid sequence shown in SEQ ID No.1, position 40 of the resulting mutant corresponding to the amino acid sequence shown in SEQ ID No.1 may be position 46.

In a specific embodiment, the homology or sequence identity may be 90% or more, preferably 95% or more, more preferably 96%, 97%, 98%, 99% homology.

Methods for determining sequence homology or identity known to those of ordinary skill in the art include, but are not limited to: computer Molecular Biology (computerized Molecular Biology), Lesk, a.m. ed, oxford university press, new york, 1988; biological calculation: informatics and genomic Projects (Biocomputing: information and Genome Projects), Smith, d.w. eds, academic press, new york, 1993; computer Analysis of Sequence Data (Computer Analysis of Sequence Data), first part, Griffin, a.m. and Griffin, h.g. eds, Humana Press, new jersey, 1994; sequence Analysis in Molecular Biology (Sequence Analysis in Molecular Biology), von Heinje, g., academic Press, 1987 and Sequence Analysis primers (Sequence Analysis Primer), Gribskov, m. and Devereux, j. eds M Stockton Press, New York, 1991 and Carllo, h. and Lipman, d.s., SIAM j.applied Math., 48:1073 (1988). The preferred method of determining identity is to obtain the greatest match between the sequences tested. Methods for determining identity are compiled in publicly available computer programs. Preferred computer program methods for determining identity between two sequences include, but are not limited to: the GCG program package (Devereux, J. et al, 1984), BLASTP, BLASTN, and FASTA (Altschul, S, F. et al, 1990). BLASTX programs are publicly available from NCBI and other sources (BLAST Manual, Altschul, S. et al, NCBI NLM NIH Bethesda, Md.20894; Altschul, S. et al, 1990). The well-known Smith Waterman algorithm can also be used to determine identity.

The application and the advantages of the invention are as follows:

1. the invention provides a mutant of SpeB, AtpB and SecY proteins, and improves the yield of lysine.

2. The invention provides a construction method of a lysine high-producing strain which over-expresses SpeB and weakens SecY.

3. The invention provides a brand new idea for constructing the lysine production strain.

Detailed Description

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Experimental procedures without specific conditions noted in the following examples, molecular cloning is generally performed according to conventional conditions such as Sambrook et al: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,1989), or according to the manufacturer's recommendations.

Example 1 selection of tolerant strains with increased growth rates in lysine fermentation broths

Coli DNA polymerase epsilon subunit mutant KR5-2 can accelerate the error rate in DNA replication process [ Luan G, Cai Z, Li Y, Ma Y. genome replication engineered ligation dependent ligation evolution (greece) to advanced microbial ligation for biologics production biotechnol biofuels.2013; and 6:137 ], so that the strain is more likely to undergo spontaneous mutation and is adaptive to the external adverse environment. Escherichia coli-derived KR5-2[ Luan G, Cai Z, Li Y, Ma Y. genome replication engineered associated continuous evolution (GREEACE) to advanced microbial ligation for biotechnology production. Biotechnol biofuels.2013 was amplified by PCR; 137.], the PCR primers are KR-F and KR-R in Table 2, and the used template is plasmid pQ-dnaQ-KR5-2 reported in the literature [ Luan G, Cai Z, Li Y, Ma Y. genome reproduction engineering analysis (GREEN) to advanced microbial biology for biological products.Biotechnol Biofuels.2013; 6:137.]. After the PCR product is subjected to double digestion by EcoRI and SmaI, the PCR product is connected to a temperature-sensitive plasmid pKD46(GenBank accession No.: MF287367, the plasmid is stable when cultured at 30 ℃ and can be lost when cultured at above 37 ℃), and the constructed plasmid is named as pKAR, which contains an arabinose inducible promoter and regulates the expression of KR5-2 gene.

TABLE 2 primers used for cloning of the DNA polymerase epsilon subunit mutant KR5-2

Primer and method for producing the same	Sequence (5 '-3')
		KR-F	cctgaattcgagctctaaggaggttataaaaaatgagcactgcaattacacgccag
KR-R	tatcccgggttattatgctcgccagaggcaacttccgcctttc

The lysine-producing Escherichia coli MU-1[ Wang Y, Li Q, Zheng P, Guo Y, Wang L, Zhang T, Sun J, Ma Y. evaporating the L-lysine high-reducing strain of Escherichia coli using a newway depleted high-through plasmid screening method, J Ind Microbiol Biotechnol.2016, was lost by serial passage; 43: 1227-1235 ] to obtain the strain MU-11. The strain MU-11(pKAR) was obtained by electrotransformation of pKAR into MU-11. The strain is used as an original strain and is continuously subcultured and evolved in culture solutions containing different lysine concentrations.

The culture solution with different lysine concentrations is derived from fermentation end point solution of the strain MU-1, wherein the initial lysine content is 136.5g/L, and the supernatant is filtered by a 0.22 MU m filter membrane after centrifugation. Concentrating the obtained filtrate by a rotary evaporator to obtain a concentrated solution with higher lysine concentration, or diluting the concentrated solution with water to obtain a diluted solution with lower lysine concentration, then adding 10g/L peptone and 5g/L yeast powder into the stock solution, the concentrated solution and the diluted solution, and adjusting the pH value to 7.0. MU-11(pKAR) was cultured overnight in LB plus arabinose medium (10g/L peptone, 5g/L yeast powder, 10g/L arabinose, 10g/L sodium chloride), then transferred from the medium with low lysine concentration to the medium with high lysine concentration, and 10g/L arabinose was added when the culture was first transferred to the medium with 125g/L lysine. The inoculation amount is 1% (volume fraction) during transfer, the culture temperature is 30 ℃, and 25mg/L kanamycin is added during culture. MU-11(pKAR) culture broth without arabinose addition from LB culture mediumAs a control, the absorbance (OD) at 600nm after the end of each incubation was measured₆₀₀)，OD₆₀₀The detection method of (2) was that 150. mu.l was put into a 96-well shallow well plate and absorbance at 600nm was measured with a microplate reader (SpectraMax 190, purchased from Molecular Devices, China). As shown in Table 3, it was found that the growth rate of the strain was very slow in the control MU-11(pKAR) medium without arabinose and much higher in the MU-11(pKAR) medium with arabinose added than in the control medium when the strain was transferred to the medium with lysine concentrations of 140g/L and 150g/L by continuous transfer. Indicating that arabinose-added culture broth produced tolerant MU-11(pKAR) mutant strains with increased growth rate in high-concentration lysine fermentation broth.

TABLE 3 growth of MU-11(pKAR) by continuous subculture in lysine-containing fermentation broth

Note: a means no arabinose was added all the time, B means 10g/L arabinose was added to the seed solution and the first medium transferred to 125g/L lysine.

Example 2 isolation and validation of tolerant mutants

The strain which can grow in the high-concentration lysine culture solution at an increased speed is cultured in an LB culture medium at the temperature of 42 ℃ to lose the plasmid pKAR, and the strain is subjected to plate purification to obtain a mutant strain named as RS 3. The growth of MU-11 and RS3 in the culture medium with different lysine concentrations was analyzed at 37 ℃ and the results are shown in Table 4. As can be seen, the growth level of RS3 in the 125g/L and 150g/L high concentration lysine culture solution is obviously higher than that of MU-11. This indicates that RS3 is a mutant strain with improved tolerance.

TABLE 4 growth of MU-11 and RS3 by continuous subculture in lysine-containing fermentation broth

Number of times of switching	Lysine concentration (g/L) in the culture solution	Incubation time (hours)	MU-11(OD600)	RS3(OD600)
					1	75	24	0.6926	0.58545
2	100	40	0.33385	0.35215
					3	125	48	0.19045	0.2635
4	150	90	0.0165	0.09955

Propidium Iodide (PI) stains only cells with incomplete cell membrane structure, so PI staining reflects the integrity of the cell membrane, reflecting the degree of tolerance of the cells [ Li J, Ahn J, Liu D, Chen S, Ye X, Ding T.evaluation of exogenous-induced damage to Escherichia coli and Staphylococcus aureus by flow cytometry and transmission electron microscopy.apple Environ Microbiol.2016; 82:1828-1837.]The higher the rate of positive PI staining in the bacterial suspension, the lower the environmental tolerance of the entire strain. We performed PI staining analysis of MU-11 and RS3 cell sap after culturing in 125g/L lysine medium in Table 4. First, after centrifugation of the culture, the cells were resuspended in PBS buffer (NaCl 8g/L, KCl 0.2g/L, Na)₂HPO₄·12H₂O 3.58g/L,KH₂PO₄0.24g/L, pH 7.2) to OD₆₀₀About 0.5. Then PI was added to a final concentration of 2. mu.g/mL. The reaction was carried out in the dark for 10 minutes at room temperature, and then washed once with PBS buffer. PI staining results were analyzed with a MoFlo XDP flow cytometer (Beckman Coulter inc., USA). The excitation wavelength and the detected emission wavelength were 488nm and 620nm, respectively, and were analyzed using a statistical analysis module of the Summit 5.2 software. As shown in Table 5, the staining ratio of PI of MU-11 was 68.5, while the staining ratio of PI of RS3 was 20.1, indicating that the tolerance of RS3 was much higher than that of MU-11.

TABLE 5 PI staining for strains MU-11 and RS3

Bacterial strains	PI staining Rate (%)
		MU-11	68.5
RS3	20.1

Example 3 fermentation lysine production by mutant RS3 and genomic sequencing analysis

A lysine fermentation medium is used for testing the lysine production condition of strains MU-11 and RS3 through fermentation, and the fermentation medium comprises the following components: glucose 40 g/L; KH (Perkin Elmer)₂PO₄ 5g/L；MgSO₄ 1g/L；(NH₄)₂SO₄ 10g/L；FeSO₄ 0.003g/L；MnSO₄0.003 g/L; 50g/L of corn steep liquor; KCl is 0.7 g/L; 3- (N-morpholinyl) propanesulfonic acid (MOPS)42 g/L. First, MU-11 and RS3 were cultured overnight in LB medium, the culture was inoculated as a seed into a 500ml shake flask containing 20ml of fermentation medium at 220rpm and 37 ℃ for 16 hours, and 400. mu.l of 25% NH was added thereto₃·H₂O, the culture was continued for 24 hours, and samples were taken to measure the glucose and lysine contents using SBA-40D (biosensor, Shandong, China), the results of which are shown in Table 6. It can be seen that RS3 produces lysine at a level much higher than MU-11.

TABLE 6 lysine levels produced by fermentation of strains MU-11 and RS3

Bacterial strains	Lysine yield (g/L)	Lysine conversion (%, g/g glucose)
			MU-11	7.1	24.8
RS3	9.1	31.9

The MU-11 and RS3 genomes were extracted, subjected to whole genome sequencing, and comparative genome analysis revealed that, as shown in Table 7, the RS3 genome has point mutations in 3 important genes and resulted in corresponding amino acid mutations compared with the MU-11 genome.

TABLE 7 Point mutations occurring in the RS3 genome in comparison with E.coli MU-11

Related gene	Gene sequences	Coding protein sequence	Mutant nucleic acid sites	Mutant amino acids	Gene function
						speB	SEQ ID No.4	SEQ ID No.1	C905T	A302V	Arginase family related enzymes
atpB	SEQ ID No.5	SEQ ID No.2	G494A	S165N	FoF 1-type ATP synthetase a subunit
						secY	SEQ ID No.6	SEQ ID No.3	A433G	M145V	Precursor protein translocase subunit

Note: the numbers in the mutant nucleic acid sites in the table indicate the position of the mutant site in the CDS (ORF) sequence of the corresponding gene.

Example 4 construction of a plasmid for overexpression or attenuation of the speB, atpB, secY genes

PCR amplification was carried out using the primers B4K5-F and B4K5-R, using plasmid pSB4K5-I52002 (carrying kanamycin resistance gene, GenBank accession No.: EU496099) as a template, to obtain a PCR product. PCR amplification is carried out by using primers speB-F and speB-R and MU-11 and RS3 genomes as templates to obtain speB with self promoter and mutant speB thereof^C905T(the two amplification products differ in sequence only in that one is the speB gene sequence and the other is speB^C905TGene sequence). Using primers atpB-F and atpB-R, respectively using MU-11 and RS3 genomes as templates, obtaining atpB with self promoter and its mutant atpB by PCR amplification^G494A(the two amplification products differ in sequence only in that one is the atpB gene sequence and the other is atpB^G494AGene sequence). The PCR product of the plasmid pSB4K5-I52002 was treated with T4DNA kinase and T4DNA ligase to obtain a self-ligated plasmid, which was designated pSB. Directional Cloning of seamless Cloning kit by One-Step method (The Clonexpress II One Step Cloning kit, Nanjing Novozam Biotech)Tech Ltd, China), speB and speB were separately prepared^C905T、atpB、atpB^G494AThe PCR product of (a) was ligated with the PCR product of pSB4K5-I52002 to obtain plasmids pSB-speB, which overexpress speB, atpB, and mutants thereof^C905TpSB-atpB and pSB-atpB^G494A。

Methods reported in the literature by small RNAs (sRNA) [ Sun D, Chen J, Wang Y, Li M, Rao D, Guo Y, Chen N, Zheng P, Sun J, Ma Y. Metabolic engineering of Corynebacterium glutamicum by synthetic small nucleic acid molecules biotechnologies.J. Ind Microbiol biotechnol.2019; 46:203-208.]The effect of secY attenuation on lysine production was tested. Using primers secY-F and secY-R, as plasmid pEC-sRNA^gfp-hfq[Sun D,Chen J,Wang Y,Li M,Rao D,Guo Y,Chen N,Zheng P,Sun J,Ma Y.Metabolic engineering of Corynebacterium glutamicum by synthetic small regulatory RNAs.J Ind Microbiol Biotechnol.2019；46:203–208.]And (3) amplifying a framework of the non-coding small RNA gene micC and a terminator T1/TE sequence as a template. The primer secY-F carries a sequence corresponding to 1-24 bases of the secY gene and a sequence of a constitutive promoter J23109 (http:// parts.aspect.org/Part: BBa _ J23100), so that small RNA for attenuating the expression of the secY gene can be expressed. Connecting the amplified PCR product with the PCR product of the plasmid pSB4K5-I52002 by using a one-step directional cloning seamless cloning kit to obtain the plasmid pSB-sRNA^secY-MicC. The plasmid constructed above is transformed into Escherichia coli lysine producing strain LYS1 to obtain LYS1(pSB), LYS1(pSB-speB), LYS1(pSB-speB)^C905T)，LYS1(pSB-atpB)，LYS1(pSB-atpB^G494A) And LYS1 (pSB-sRNA)^secY-MicC). Wherein Escherichia coli LYS1 is a lysine-producing strain obtained by introducing the LysC protein (the sequence of LysC protein is shown in SEQ ID No. 9) and dapA protein (the sequence of dapA protein is shown in SEQ ID No. 10) for releasing feedback inhibition into Escherichia coli MG1655 after overexpression with plasmid pTrc99A (with ampicillin resistance gene, GenBank accession No. U13872), and its construction process is described in reference (Wang, Y., et al. Ecolving the L-lysine high-producing strain of Escherichia coli using a new modified high-throughput screening method (2016). J Ind. biol Biotechol 43(9): 1227-; 97:1963-1971.).

The sequences of the primers used in this example are shown in Table 8.

TABLE 8 primers used for construction of speB, atpB, secY Gene overexpression or attenuation plasmids

Example 5 Point mutation of the secY Gene on the genome

Coli genome rapid manipulation technique using CRISPR/Cas9 [ ZHao, D., et al.CRISPR/Cas 9-associated gRNA-free one-step genome editing with sequence limitations and improved targeting efficiencies (2017). Sci Rep7(1):16624.]The secY gene on the genome is point mutated. PCR amplification was performed using primers SecY-F1 and SecY-R1 in Table 9 using the RS3 genome as a template, and the amplified PCR product was ligated with the PCR product of plasmid pSB4K5-I52002 in example 4 using a one-step directed cloning seamless cloning kit to obtain plasmid pSB-secY^A433G. SecY-F2 and secY-R2 in Table 9 were used as primers, and pSB-secY was used^A433GPCR amplification was performed using CN20-F and CN20-R in Table 9 as primers and chloramphenicol resistance gene plus N20PAM fragment [ ZHAO, D., et al CRISPR/Cas 9-associated gRNA-free one-step genome editing with sequence limitations and improved targeting efficiencies (2017): Sci Rep7(1): 16624).]PCR amplification is carried out for a template, and the two amplified fragments are connected by a one-step directional cloning seamless cloning kit to obtain a plasmid pSB-secY^A433G-N20 PAM. In plasmid pSB-secY^A433GsecY with mutation on N20PAM^A433GGenes and upstream 504 bases, wherein 23-62bp upstream of the initiation codon is a repetitive sequence, and an N20PAM sequence is inserted in the middle of the repetitive sequence for recombination described in the literature. Are respectively provided withYA433G-F, YA433G-R, Yatg-F and Yatg-R are used as primers, and pSB-secY is used as primer^A433GAnd (4) performing PCR amplification by using-N20 PAM as a template to obtain two fragments. One of the fragments, designated secY433, whose nucleotide sequence contains SEQ ID No.7, was used for the A433G mutation in secY; the other fragment was named secYgtg, the nucleotide sequence of which contains SEQ ID No.8 for replacing the start codon atg with gtg. Positions 1-442 and 1435-2804 of SEQ ID No.7 are homologous arms of the first homologous recombination, positions 443-482 and 1395-1434 are homologous sequences of the second homologous recombination, and positions 483-1394 are chloramphenicol resistance gene plus N20PAM fragment. Positions 1-78 and 1071-1113 of SEQ ID No.8 are homologous arms at two ends of the first homologous recombination, positions 79-118 and 1031-1070 are homologous sequences of the second homologous recombination, and position 119-1030 is a chloramphenicol resistance gene plus an N20PAM fragment. Plasmid pCAGO [ ZHao, D., et al.CRISPR/Cas9-assisted gRNA-free one-step genome editing with no sequence limitations and improved targeting efficiencies (2017). Sci Rep7(1):16624.]Transformation into E.coli MG1655 to prepare MG1655(pCAGO) competent cells for electrotransformation, the medium used for the preparation of competence being: 10g/L peptone, 10g/L sodium chloride, 5g/L yeast powder, 10g/L glucose, and IPTG at a final concentration of 0.1 mM. The PCR fragments secY433 and secYgtg described above for the A433G mutation in secY and the substitution of the initiation codon atg to gtg, respectively, were transformed. After culturing at 30 ℃ for 2 hours, colonies capable of growing on LB plates containing 100mg/L ampicillin, 30mg/L chloramphenicol, 10g/L glucose were selected. The obtained colonies were further cultured at 30 ℃ for 6 hours in LB liquid medium containing 100MG/L ampicillin, 0.1mM IPTG and 2g/L arabinose, then spread on a plate of LB medium containing 100MG/L ampicillin, and single colonies were selected, and verified by sequencing to obtain mutants in which the secY gene had the A433G mutation and the secY initiation codon atg was replaced with gtg, and then cultured at 37 ℃ and the pCAGO plasmid was discarded to obtain strains, which were named MG1655-secY, respectively^A433GAnd MG 1655-secYgtg. Yan Wang et al (Wang, Y., et al. Ecolving the L-lysine high-reducing strain of Escherichia coli using a new depleted high-through recombinant screening method (2016.). J Ind Microbiol Biotechnol 43(9) 1227-1235) plasmid pTrc99A, in which the feedback inhibition released aspartokinase gene LysC and dihydrodipicolinate synthase gene dapA were overexpressed in the strain LYS1 constructed, was introduced into MG1655-secY^A433GAnd MG1655-secYgtg, obtaining lysine-producing strain Lys1-secY^A433GAnd Lys 1-secYgtg.

TABLE 9 primers for point mutation of the secY Gene on the genome

Primer name	Primer sequence (5 '-3')
		secY-F1	GaattccctaggatccgtcGCTCCTGCTATTCGCGGTATGATC
SecY-R1	cagcggccgctactagttgACTTCTCGGGCGACCAAttaTCG
		secY-F2	CGGAGAACGAGATGACGTTGTACTAAAGGCGCTCGTGCTG
SecY-R2	ctgatggagctgcacatgaaACCGCCAGCAGCTTCGATAG
		CN20-F	TTCATGTGCAGCTCCATCAG
CN20-R	CAACGTCATCTCGTTCTCCG
		YA433G-F	CTCCTGCTATTCGCGGTATGATC
YA433G-R	CTTCTCGGGCGACCAAttaTCG
		Yatg-F	CGGTATCCAGATCGAGTTCGCGAAAGTG
Yatg-R	TAATCCCGGTTGTTTAGCCACCTGCTACTTATTCCTCGATTTT

Example 6 fermentation test of lysine-producing Escherichia coli

The lysine-producing strains constructed above were tested for lysine production by fermentation using lysine fermentation medium, including LYS1(pSB), LYS1(pSB-speB), LYS1(pSB-speB)^C905T)，LYS1(pSB-atpB)，LYS1(pSB-atpB^G494A)，LYS1(pSB-sRNA^secY-MicC)，LYS1，Lys1-secY^A433GLys 1-secYgtg. The fermentation medium comprises the following components: glucose 40 g/L; KH (Perkin Elmer)₂PO₄ 5g/L；MgSO₄ 1g/L；(NH₄)₂SO₄ 10g/L；FeSO₄ 0.003g/L；MnSO₄0.003 g/L; 8g/L of yeast powder; KCl is 0.7 g/L; 3- (N-morpholinyl) propanesulfonic acid (MOPS)42 g/L. In addition, LYS1(pSB), LYS1(pSB-speB), LYS1(pSB-speB)^C905T)，LYS1(pSB-atpB)，LYS1(pSB-atpB^G494A) And LYS1 (pSB-sRNA)^secY-MicC) seed and fermentation medium were supplemented with ampicillin at a final concentration of 100mg/L and kanamycin at a final concentration of 25mg/L in LYS1, Lys1-secY^A433GAdding 100mg/L final concentration ampicillin into Lys1-secYgtg seed and fermentation medium, culturing the above strain overnight with LB seed medium, inoculating the culture as seed into 96-well deep-well plate containing 200 μ L fermentation medium per well, inoculating amount of 5% (volume fraction), culturing at 37 deg.C for 40 hr, rotating speed of plate shaker at 800rpm, and culturing each strainAfter 3 strains were used in parallel, PI staining of the strains was measured as provided in example 2, and lysine concentration and glucose consumption were measured as provided in example 3. The results of detection of each strain are shown in Table 10. As can be seen from Table 10, the yield of lysine was increased in the strain LYS1(pSB-speB) overexpressing the wild-type speB gene, the degree of cell membrane damage was decreased, and the mutant speB was overexpressed, as compared to the control strain LYS1(pSB)^C905TWhen the gene is used, the lysine yield is improved more, the damage degree of the cell membrane of the strain is lower, and the result shows that the C905T point mutation of the speB gene can improve the performance of the strain and is beneficial to producing lysine. The lysine production level and degree of cell membrane damage were less variable for strain LYS1(pSB-atpB) overexpressing the wild-type atpB gene compared to the control strain LYS1(pSB), however, overexpression of the mutant atpB^G494AStrain of the Gene LYS1(pSB-atpB)^G494A) The yield of lysine is improved, the damage degree of cell membranes is reduced, and the result shows that the G494A point mutation of the atpB gene can improve the performance of the strain and is beneficial to producing the lysine. Strain LYS1 (pSB-sRNA) attenuating secY Gene expression Using sRNA^secYMicC) has higher lysine production and lower damage to the cell membrane of the strain than the control strain LYS1(pSB), which indicates that weakening of secY gene can improve the performance of the strain and is beneficial to lysine production. Strain Lys1-secY in which the A433G point mutation of secY gene on genome is occurred, as compared with control strain LYS1^A433GAnd the lysine yield of the strain Lys1-secYgtg with the start codon of the secY gene mutated from atg to gtg on the genome is higher, the damage degree of the cell membrane of the strain is lower, which shows that the A433G point mutation of the secY gene and the expression attenuation caused by the start codon of the secY gene from atg to gtg (the start codon from atg to gtg is a gene expression attenuation method known in the field) can improve the performance of the strain and is beneficial to producing lysine.

TABLE 10 lysine production by the engineered strains

The significance of the results was shown by p-value analysis using the following method: student's two-tailed t-test denotes p<0.05 (difference). star represents p<0.01 (significant difference), none indicates no difference. Strains LYS1(pSB-speB), LYS1(pSB-speB)^C905T)，LYS1(pSB-atpB)，LYS1(pSB-atpB^G494A) And LYS1 (pSB-sRNA)^secY-MicC) results were analyzed by comparison with LYS1 (pSB). Strain Lys1-secY^A433GAnd the significance of the Lys1-secYgtg results was analyzed by comparison with LYS 1.

Example 7 attenuated expression of the secY Gene of Corynebacterium glutamicum

In order to verify the influence of attenuation of SecY gene expression in Corynebacterium glutamicum on the yield of lysine, the present application first constructed an attenuation vector for SecY using sRNA-based gene expression regulation technology. Primers RsecY-F1 and RsecY-R1 in Table 11 were designed based on the secY gene sequence (SEQ ID No.12, whose corresponding encoded protein sequence is shown in SEQ ID No. 11) of C.glutamicum lysine-producing strain B253(GeneBank accession number CP010451) published at NCBI to carry the vector pEC-sRNA of the sRNA element^gfpHfq (reference to construction Process: Sun, et al., (2019). Metabolic engineering of Corynebacterium glutamicum by synthetic small regulating RNAs. journal of Industrial Microbiology&Biotechnology,46:203-208) as a template, performing PCR amplification, treating the PCR product with T4DNA kinase and T4DNA ligase, obtaining a self-ligating plasmid, named pECsRNA-secY, capable of constitutively expressing sRNA, wherein the expressed sRNA contains a sequence corresponding to 1-24bp of the secY gene (SEQ ID No.12), thereby being capable of weakening the expression of the secY gene. pECsRNA-secY was transformed into the strain B253 to obtain a strain B253 (pECsRNA-secY).

Using the primers RsecY-F2 and RsecY-R2 in Table 11, the vector pEC-sRNA was used in the same manner^gfpHfq is template PCR amplification, and after self-ligation of the product, plasmid pEC-hfq is obtained, pEC-hfq lacks the sequence corresponding to 1-24bp of secY gene, compared with pECsRNA-secY, and thus cannot weaken the expression of secY gene. pEC-hfq was transformed into strain B253 to obtain strain B253 (pEC-hfq).

TABLE 11 primers used for construction of plasmids for the attenuated expression of the secY Gene of C.glutamicum

Primer name	Primer sequence (5 '-3')
		RsecY-F1	AATGGCGGACACtttctgttgggccattgcattgc
RsecY-R1	ATTCAGGCATTCtgaattacactgtacctgttg
		RsecY-F2	Tttctgttgggccattgcattgc
RsecY-R2	Tgaattacactgtacctgttg

Example 8 fermentation test of Corynebacterium glutamicum producing lysine

To test the effect of attenuation of secY gene expression in C.glutamicum on lysine production by the strain, fermentation tests were carried out on B253(pEC-hfq) and B253(pECsRNA-secY), respectively, with the following fermentation medium components: 80g/L of glucose; 8g/L of yeast powder; 9g/L of urea; k₂HPO₄ 1.5g/L；MnSO₄ 0.01g/L；MgSO₄ 0.6g/L；FeSO₄0.01 g/L; MOPS 42 g/L. The strain was first inoculated into LB medium containing 10g/L glucose for overnight culture, the culture was inoculated as a seed into a 96-well deep-well plate containing 200. mu.l of fermentation medium per well, the inoculum size was 5%, the culture was cultured at 30 ℃ for 48 hours, the rotation speed of the plate shaker was 800rpm, 3 strains each were paralleled, and the lysine production and glucose consumption were measured after the end of fermentation according to the method provided in example 3. ResultsAs shown in table 12. As can be seen from the table, attenuation of the secY gene of Corynebacterium glutamicum enables a large increase in lysine production.

TABLE 12 Effect of attenuation of the secY Gene in Corynebacterium glutamicum B253 on lysine production

The significance of the results was shown by p-value analysis using the following method: student's two-tailed t-test represents p <0.01 (with significant difference). The significance of the results for strain B253(pECsRNA-secY) was analyzed by comparison with B253 (pEC-hfq).

<110> institute of biotechnology for Tianjin industry of Chinese academy of sciences

<120> construction method and application of lysine production strain

<130> GNCLN202471

<160> 12

<170> PatentIn version 3.5

<210> 1

<211> 306

<212> PRT

<213> Escherichia coli

<400> 1

Met Ser Thr Leu Gly His Gln Tyr Asp Asn Ser Leu Val Ser Asn Ala

1 5 10 15

Phe Gly Phe Leu Arg Leu Pro Met Asn Phe Gln Pro Tyr Asp Ser Asp

20 25 30

Ala Asp Trp Val Ile Thr Gly Val Pro Phe Asp Met Ala Thr Ser Gly

35 40 45

Arg Ala Gly Gly Arg His Gly Pro Ala Ala Ile Arg Gln Val Ser Thr

50 55 60

Asn Leu Ala Trp Glu His Asn Arg Phe Pro Trp Asn Phe Asp Met Arg

65 70 75 80

Glu Arg Leu Asn Val Val Asp Cys Gly Asp Leu Val Tyr Ala Phe Gly

85 90 95

Asp Ala Arg Glu Met Ser Glu Lys Leu Gln Ala His Ala Glu Lys Leu

100 105 110

Leu Ala Ala Gly Lys Arg Met Leu Ser Phe Gly Gly Asp His Phe Val

115 120 125

Thr Leu Pro Leu Leu Arg Ala His Ala Lys His Phe Gly Lys Met Ala

130 135 140

Leu Val His Phe Asp Ala His Thr Asp Thr Tyr Ala Asn Gly Cys Glu

145 150 155 160

Phe Asp His Gly Thr Met Phe Tyr Thr Ala Pro Lys Glu Gly Leu Ile

165 170 175

Asp Pro Asn His Ser Val Gln Ile Gly Ile Arg Thr Glu Phe Asp Lys

180 185 190

Asp Asn Gly Phe Thr Val Leu Asp Ala Cys Gln Val Asn Asp Arg Ser

195 200 205

Val Asp Asp Val Ile Ala Gln Val Lys Gln Ile Val Gly Asp Met Pro

210 215 220

Val Tyr Leu Thr Phe Asp Ile Asp Cys Leu Asp Pro Ala Phe Ala Pro

225 230 235 240

Gly Thr Gly Thr Pro Val Ile Gly Gly Leu Thr Ser Asp Arg Ala Ile

245 250 255

Lys Leu Val Arg Gly Leu Lys Asp Leu Asn Ile Val Gly Met Asp Val

260 265 270

Val Glu Val Ala Pro Ala Tyr Asp Gln Ser Glu Ile Thr Ala Leu Ala

275 280 285

Ala Ala Thr Leu Ala Leu Glu Met Leu Tyr Ile Gln Ala Ala Lys Lys

290 295 300

Gly Glu

305

<210> 2

<211> 271

<212> PRT

<213> Escherichia coli

<400> 2

Met Ala Ser Glu Asn Met Thr Pro Gln Asp Tyr Ile Gly His His Leu

1 5 10 15

Asn Asn Leu Gln Leu Asp Leu Arg Thr Phe Ser Leu Val Asp Pro Gln

20 25 30

Asn Pro Pro Ala Thr Phe Trp Thr Ile Asn Ile Asp Ser Met Phe Phe

35 40 45

Ser Val Val Leu Gly Leu Leu Phe Leu Val Leu Phe Arg Ser Val Ala

50 55 60

Lys Lys Ala Thr Ser Gly Val Pro Gly Lys Phe Gln Thr Ala Ile Glu

65 70 75 80

Leu Val Ile Gly Phe Val Asn Gly Ser Val Lys Asp Met Tyr His Gly

85 90 95

Lys Ser Lys Leu Ile Ala Pro Leu Ala Leu Thr Ile Phe Val Trp Val

100 105 110

Phe Leu Met Asn Leu Met Asp Leu Leu Pro Ile Asp Leu Leu Pro Tyr

115 120 125

Ile Ala Glu His Val Leu Gly Leu Pro Ala Leu Arg Val Val Pro Ser

130 135 140

Ala Asp Val Asn Val Thr Leu Ser Met Ala Leu Gly Val Phe Ile Leu

145 150 155 160

Ile Leu Phe Tyr Ser Ile Lys Met Lys Gly Ile Gly Gly Phe Thr Lys

165 170 175

Glu Leu Thr Leu Gln Pro Phe Asn His Trp Ala Phe Ile Pro Val Asn

180 185 190

Leu Ile Leu Glu Gly Val Ser Leu Leu Ser Lys Pro Val Ser Leu Gly

195 200 205

Leu Arg Leu Phe Gly Asn Met Tyr Ala Gly Glu Leu Ile Phe Ile Leu

210 215 220

Ile Ala Gly Leu Leu Pro Trp Trp Ser Gln Trp Ile Leu Asn Val Pro

225 230 235 240

Trp Ala Ile Phe His Ile Leu Ile Ile Thr Leu Gln Ala Phe Ile Phe

245 250 255

Met Val Leu Thr Ile Val Tyr Leu Ser Met Ala Ser Glu Glu His

260 265 270

<210> 3

<211> 443

<212> PRT

<213> Escherichia coli

<400> 3

Met Ala Lys Gln Pro Gly Leu Asp Phe Gln Ser Ala Lys Gly Gly Leu

1 5 10 15

Gly Glu Leu Lys Arg Arg Leu Leu Phe Val Ile Gly Ala Leu Ile Val

20 25 30

Phe Arg Ile Gly Ser Phe Ile Pro Ile Pro Gly Ile Asp Ala Ala Val

35 40 45

Leu Ala Lys Leu Leu Glu Gln Gln Arg Gly Thr Ile Ile Glu Met Phe

50 55 60

Asn Met Phe Ser Gly Gly Ala Leu Ser Arg Ala Ser Ile Phe Ala Leu

65 70 75 80

Gly Ile Met Pro Tyr Ile Ser Ala Ser Ile Ile Ile Gln Leu Leu Thr

85 90 95

Val Val His Pro Thr Leu Ala Glu Ile Lys Lys Glu Gly Glu Ser Gly

100 105 110

Arg Arg Lys Ile Ser Gln Tyr Thr Arg Tyr Gly Thr Leu Val Leu Ala

115 120 125

Ile Phe Gln Ser Ile Gly Ile Ala Thr Gly Leu Pro Asn Met Pro Gly

130 135 140

Met Gln Gly Leu Val Ile Asn Pro Gly Phe Ala Phe Tyr Phe Thr Ala

145 150 155 160

Val Val Ser Leu Val Thr Gly Thr Met Phe Leu Met Trp Leu Gly Glu

165 170 175

Gln Ile Thr Glu Arg Gly Ile Gly Asn Gly Ile Ser Ile Ile Ile Phe

180 185 190

Ala Gly Ile Val Ala Gly Leu Pro Pro Ala Ile Ala His Thr Ile Glu

195 200 205

Gln Ala Arg Gln Gly Asp Leu His Phe Leu Val Leu Leu Leu Val Ala

210 215 220

Val Leu Val Phe Ala Val Thr Phe Phe Val Val Phe Val Glu Arg Gly

225 230 235 240

Gln Arg Arg Ile Val Val Asn Tyr Ala Lys Arg Gln Gln Gly Arg Arg

245 250 255

Val Tyr Ala Ala Gln Ser Thr His Leu Pro Leu Lys Val Asn Met Ala

260 265 270

Gly Val Ile Pro Ala Ile Phe Ala Ser Ser Ile Ile Leu Phe Pro Ala

275 280 285

Thr Ile Ala Ser Trp Phe Gly Gly Gly Thr Gly Trp Asn Trp Leu Thr

290 295 300

Thr Ile Ser Leu Tyr Leu Gln Pro Gly Gln Pro Leu Tyr Val Leu Leu

305 310 315 320

Tyr Ala Ser Ala Ile Ile Phe Phe Cys Phe Phe Tyr Thr Ala Leu Val

325 330 335

Phe Asn Pro Arg Glu Thr Ala Asp Asn Leu Lys Lys Ser Gly Ala Phe

340 345 350

Val Pro Gly Ile Arg Pro Gly Glu Gln Thr Ala Lys Tyr Ile Asp Lys

355 360 365

Val Met Thr Arg Leu Thr Leu Val Gly Ala Leu Tyr Ile Thr Phe Ile

370 375 380

Cys Leu Ile Pro Glu Phe Met Arg Asp Ala Met Lys Val Pro Phe Tyr

385 390 395 400

Phe Gly Gly Thr Ser Leu Leu Ile Val Val Val Val Ile Met Asp Phe

405 410 415

Met Ala Gln Val Gln Thr Leu Met Met Ser Ser Gln Tyr Glu Ser Ala

420 425 430

Leu Lys Lys Ala Asn Leu Lys Gly Tyr Gly Arg

435 440

<210> 4

<211> 1121

<212> DNA

<213> Escherichia coli

<400> 4

taatccgcca caatttattg tgacaaatcc aacccttcct cgtcgggcct aacgacgcgg 60

aagggttttt ttatatcgac tttgtaatag gagtccatcc atgagcacct taggtcatca 120

atacgataac tcactggttt ccaatgcctt tggtttttta cgcctgccga tgaacttcca 180

gccgtatgac agcgatgcag actgggtgat tactggcgtg ccgttcgata tggccacttc 240

tggtcgtgcg ggtggtcgcc acggtccggc agcgatccgt caggtttcga cgaatctggc 300

ctgggaacac aaccgcttcc cgtggaattt cgacatgcgt gagcgtctga acgtcgtgga 360

ctgcggcgat ctggtatatg cctttggcga tgcccgtgag atgagcgaaa agctgcaggc 420

gcacgccgag aagctgctgg ctgccggtaa gcgtatgctc tctttcggtg gtgaccactt 480

tgttacgctg ccgctgctgc gtgctcatgc gaagcatttc ggcaaaatgg cgctggtaca 540

ctttgacgcc cacaccgata cctatgcgaa cggttgtgaa tttgaccacg gcactatgtt 600

ctataccgcg ccgaaagaag gtctgatcga cccgaatcat tccgtgcaga ttggtattcg 660

taccgagttt gataaagaca acggctttac cgtgctggac gcctgccagg tgaacgatcg 720

cagcgtggat gacgttatcg cccaagtgaa acagattgtg ggtgatatgc cggtttacct 780

gacttttgat atcgactgcc tggatcctgc ttttgcacca ggcaccggta cgccagtgat 840

tggcggcctg acctccgatc gcgctattaa actggtacgc ggcctgaaag atctcaacat 900

tgttgggatg gacgtagtgg aagtggctcc ggcatacgat cagtcggaaa tcactgctct 960

ggcagcggca acgctggcgc tggaaatgct gtatattcag gcggcgaaaa agggcgagta 1020

agcaccagat gcgatgcgca cgggtaaaac gtgccattaa tgtcggatgc ggcgtgaacg 1080

ccttatccga cctacgttcg gcacccgtag gccggataag a 1121

<210> 5

<211> 1016

<212> DNA

<213> Escherichia coli

<400> 5

taaaggcggt attcttgccg ctgatcgtta cgtgggtttt ggtgctggtg gttcagatac 60

tggcaccggc tgtaattaac aacaaagggt aaaaggcatc atggcttcag aaaatatgac 120

gccgcaggat tacataggac accacctgaa taaccttcag ctggacctgc gtacattctc 180

gctggtggat ccacaaaacc ccccagccac cttctggaca atcaatattg actccatgtt 240

cttctcggtg gtgctgggtc tgttgttcct ggttttattc cgtagcgtag ccaaaaaggc 300

gaccagcggt gtgccaggta agtttcagac cgcgattgag ctggtgatcg gctttgttaa 360

tggtagcgtg aaagacatgt accatggcaa aagcaagctg attgctccgc tggccctgac 420

gatcttcgtc tgggtattcc tgatgaacct gatggattta ctgcctatcg acctgctgcc 480

gtacattgct gaacatgtac tgggtctgcc tgcactgcgt gtggttccgt ctgcggacgt 540

gaacgtaacg ctgtctatgg cactgggcgt atttatcctg attctgttct acagcatcaa 600

aatgaaaggc atcggcggct tcacgaaaga gttgacgctg cagccgttca atcactgggc 660

gttcattcct gtcaacttaa tccttgaagg ggtaagcctg ctgtccaaac cagtttcact 720

cggtttgcga ctgttcggta acatgtatgc cggtgagctg attttcattc tgattgctgg 780

tctgttgccg tggtggtcac agtggatcct gaatgtgccg tgggccattt tccacatcct 840

gatcattacg ctgcaagcct tcatcttcat ggttctgacg atcgtctatc tgtcgatggc 900

gtctgaagaa cattaattta ccaacactac tacgttttaa ctgaaacaaa ctggagactg 960

tcatggaaaa cctgaatatg gatctgctgt acatggctgc cgctgtgatg atgggt 1016

<210> 6

<211> 1852

<212> DNA

<213> Escherichia coli

<400> 6

ctcctgctat tcgcggtatg atcaacgcgg tttccttcat ggttaaagtt gaggagtaag 60

agatgcgttt aaatactctg tctccggccg aaggctccaa aaaggcgggt aaacgcctgg 120

gtcgtggtat cggttctggc ctcggtaaaa ccggtggtcg tggtcacaaa ggtcagaagt 180

ctcgttctgg cggtggcgta cgtcgcggtt tcgagggtgg tcagatgcct ctgtaccgtc 240

gtctgccgaa attcggcttc acttctcgta aagcagcgat tacagccgaa attcgtctgt 300

ctgacctggc taaagtagaa ggcggtgtag tagacctgaa cacgctgaaa gcggctaaca 360

ttatcggtat ccagatcgag ttcgcgaaag tgatcctggc tggcgaagta acgactccgg 420

taactgttcg tggcctgcgt gttactaaag gcgctcgtgc tgctatcgaa gctgctggcg 480

gtaaaatcga ggaataagta gcagatggct aaacaaccgg gattagattt tcaaagtgcc 540

aaaggtggct taggcgagct gaaacgcaga ctgctgtttg ttatcggtgc gctgattgtg 600

ttccgtattg gctcttttat tccgatccct ggtattgatg ccgctgtact tgccaaactg 660

cttgagcaac agcgaggcac catcattgag atgtttaaca tgttctctgg tggtgctctc 720

agccgtgctt ctatctttgc tctggggatc atgccgtata tttcggcgtc gatcattatc 780

cagctgctga cggtggttca cccaacgttg gcagaaatta agaaagaagg ggagtctggt 840

cgtcgtaaga tcagccagta cacccgctac ggtactctgg tgctggcaat attccagtcg 900

atcggtattg ctaccggtct gccgaatatg cctggtatgc aaggcctggt gattaacccg 960

ggctttgcat tctacttcac cgctgttgta agtctggtca caggaaccat gttcctgatg 1020

tggttgggcg aacagattac tgaacgaggt atcggcaacg gtatttcaat cattatcttc 1080

gccggtattg tcgcgggact cccgccagcc attgcccata ctatcgagca agcgcgtcaa 1140

ggcgacctgc acttcctcgt gttgctgttg gttgcagtat tagtatttgc agtgacgttc 1200

tttgttgtat ttgttgagcg tggtcaacgc cgcattgtgg taaactacgc gaaacgtcag 1260

caaggtcgtc gtgtctatgc tgcacagagc acacatttac cgctgaaagt gaatatggcg 1320

ggggtaatcc cggcaatctt cgcttccagt attattctgt tcccggcgac catcgcgtca 1380

tggttcgggg gcggtactgg ttggaactgg ctgacaacaa tttcgctgta tttgcagcct 1440

gggcaaccgc tttatgtgtt actctatgcg tctgcaatca tcttcttctg tttcttctac 1500

acggcgttgg ttttcaaccc gcgtgaaaca gcagataacc tgaagaagtc cggtgcattt 1560

gtaccaggaa ttcgtccggg agagcaaacg gcgaagtata tcgataaagt aatgacccgc 1620

ctgaccctgg ttggtgcgct gtatattacc tttatctgcc tgatcccgga gttcatgcgt 1680

gatgcaatga aagtaccgtt ctacttcggt gggacctcac tgcttatcgt tgttgtcgtg 1740

attatggact ttatggctca agtgcaaact ctgatgatgt ccagtcagta tgagtctgca 1800

ttgaagaagg cgaacctgaa aggctacggc cgataattgg tcgcccgaga ag 1852

<210> 7

<211> 2804

<212> DNA

<213> Artificial sequence

<400> 7

ctcctgctat tcgcggtatg atcaacgcgg tttccttcat ggttaaagtt gaggagtaag 60

agatgcgttt aaatactctg tctccggccg aaggctccaa aaaggcgggt aaacgcctgg 120

gtcgtggtat cggttctggc ctcggtaaaa ccggtggtcg tggtcacaaa ggtcagaagt 180

ctcgttctgg cggtggcgta cgtcgcggtt tcgagggtgg tcagatgcct ctgtaccgtc 240

gtctgccgaa attcggcttc acttctcgta aagcagcgat tacagccgaa attcgtctgt 300

ctgacctggc taaagtagaa ggcggtgtag tagacctgaa cacgctgaaa gcggctaaca 360

ttatcggtat ccagatcgag ttcgcgaaag tgatcctggc tggcgaagta acgactccgg 420

taactgttcg tggcctgcgt gttactaaag gcgctcgtgc tgctatcgaa gctgctggcg 480

gtttcatgtg cagctccatc agcaaaaggg gatgataagt ttatcaccac cgactatttg 540

caacagtgcc gttgatcgtg ctatgatcga ctggtgctta tctctggcgg tgttgacaag 600

agataacaac gttgatataa ttgagcctct cgccccacca attcggttta aaccaggaaa 660

cagctatgga gaaaaaaatc aatggatata ccaccgttga tatatcccaa tggcatcgta 720

aagaacattt tgaggcattt cagtcagttg ctcaatgtac ctataaccag accgttcagc 780

tggatattac ggccttttta aagaccgtaa agaaaaataa gcacaagttt tatccggcct 840

ttattcacat tcttgcccgc ctgatgaatg ctcatccgga attccgtatg gcaatgaaag 900

acggtgagct ggtgatatgg gatagtgttc acccttgtta caccgttttc catgagcaaa 960

ctgaaacgtt ttcatcgctc tggagtgaat accacgacga tttccggcag tttctacaca 1020

tatattcgca agatgtggcg tgttacggtg aaaacctggc ctatttccct aaagggttta 1080

ttgagaatat gtttttcgtc tcagccaatc cctgggtgag tttcaccagt tttgatttaa 1140

acgtggccaa tatggacaac ttcttcgccc ccgttttcac catgggcaaa tattatacgc 1200

aaggcgacaa ggtgctgatg ccgctggcga ttcaggttca tcatgccgtt tgtgatggct 1260

tccatgtcgg cagaatgctt aatgaattac aacagtactg cgatgagtgg cagggcgggg 1320

cgtaacggta gtccatcgaa ccgaagtaag gacaattaac agttaacaaa taagcggaga 1380

acgagatgac gttgtactaa aggcgctcgt gctgctatcg aagctgctgg cggtaaaatc 1440

gaggaataag tagcagatgg ctaaacaacc gggattagat tttcaaagtg ccaaaggtgg 1500

cttaggcgag ctgaaacgca gactgctgtt tgttatcggt gcgctgattg tgttccgtat 1560

tggctctttt attccgatcc ctggtattga tgccgctgta cttgccaaac tgcttgagca 1620

acagcgaggc accatcattg agatgtttaa catgttctct ggtggtgctc tcagccgtgc 1680

ttctatcttt gctctgggga tcatgccgta tatttcggcg tcgatcatta tccagctgct 1740

gacggtggtt cacccaacgt tggcagaaat taagaaagaa ggggagtctg gtcgtcgtaa 1800

gatcagccag tacacccgct acggtactct ggtgctggca atattccagt cgatcggtat 1860

tgctaccggt ctgccgaata tgcctggtgt gcaaggcctg gtgattaacc cgggctttgc 1920

attctacttc accgctgttg taagtctggt cacaggaacc atgttcctga tgtggttggg 1980

cgaacagatt actgaacgag gtatcggcaa cggtatttca atcattatct tcgccggtat 2040

tgtcgcggga ctcccgccag ccattgccca tactatcgag caagcgcgtc aaggcgacct 2100

gcacttcctc gtgttgctgt tggttgcagt attagtattt gcagtgacgt tctttgttgt 2160

atttgttgag cgtggtcaac gccgcattgt ggtaaactac gcgaaacgtc agcaaggtcg 2220

tcgtgtctat gctgcacaga gcacacattt accgctgaaa gtgaatatgg cgggggtaat 2280

cccggcaatc ttcgcttcca gtattattct gttcccggcg accatcgcgt catggttcgg 2340

gggcggtact ggttggaact ggctgacaac aatttcgctg tatttgcagc ctgggcaacc 2400

gctttatgtg ttactctatg cgtctgcaat catcttcttc tgtttcttct acacggcgtt 2460

ggttttcaac ccgcgtgaaa cagcagataa cctgaagaag tccggtgcat ttgtaccagg 2520

aattcgtccg ggagagcaaa cggcgaagta tatcgataaa gtaatgaccc gcctgaccct 2580

ggttggtgcg ctgtatatta cctttatctg cctgatcccg gagttcatgc gtgatgcaat 2640

gaaagtaccg ttctacttcg gtgggacctc actgcttatc gttgttgtcg tgattatgga 2700

ctttatggct caagtgcaaa ctctgatgat gtccagtcag tatgagtctg cattgaagaa 2760

ggcgaacctg aaaggctacg gccgataatt ggtcgcccga gaag 2804

<210> 8

<211> 1113

<212> DNA

<213> Artificial sequence

<400> 8

cggtatccag atcgagttcg cgaaagtgat cctggctggc gaagtaacga ctccggtaac 60

tgttcgtggc ctgcgtgtta ctaaaggcgc tcgtgctgct atcgaagctg ctggcggttt 120

catgtgcagc tccatcagca aaaggggatg ataagtttat caccaccgac tatttgcaac 180

agtgccgttg atcgtgctat gatcgactgg tgcttatctc tggcggtgtt gacaagagat 240

aacaacgttg atataattga gcctctcgcc ccaccaattc ggtttaaacc aggaaacagc 300

tatggagaaa aaaatcaatg gatataccac cgttgatata tcccaatggc atcgtaaaga 360

acattttgag gcatttcagt cagttgctca atgtacctat aaccagaccg ttcagctgga 420

tattacggcc tttttaaaga ccgtaaagaa aaataagcac aagttttatc cggcctttat 480

tcacattctt gcccgcctga tgaatgctca tccggaattc cgtatggcaa tgaaagacgg 540

tgagctggtg atatgggata gtgttcaccc ttgttacacc gttttccatg agcaaactga 600

aacgttttca tcgctctgga gtgaatacca cgacgatttc cggcagtttc tacacatata 660

ttcgcaagat gtggcgtgtt acggtgaaaa cctggcctat ttccctaaag ggtttattga 720

gaatatgttt ttcgtctcag ccaatccctg ggtgagtttc accagttttg atttaaacgt 780

ggccaatatg gacaacttct tcgcccccgt tttcaccatg ggcaaatatt atacgcaagg 840

cgacaaggtg ctgatgccgc tggcgattca ggttcatcat gccgtttgtg atggcttcca 900

tgtcggcaga atgcttaatg aattacaaca gtactgcgat gagtggcagg gcggggcgta 960

acggtagtcc atcgaaccga agtaaggaca attaacagtt aacaaataag cggagaacga 1020

gatgacgttg tactaaaggc gctcgtgctg ctatcgaagc tgctggcggt aaaatcgagg 1080

aataagtagc aggtggctaa acaaccggga tta 1113

<210> 9

<211> 449

<212> PRT

<213> Artificial sequence

<400> 9

Met Ser Glu Ile Val Val Ser Lys Phe Gly Gly Thr Ser Val Ala Asp

1 5 10 15

Phe Asp Ala Met Asn Arg Ser Ala Asp Ile Val Leu Ser Asp Ala Asn

20 25 30

Val Arg Leu Val Val Leu Ser Ala Ser Ala Gly Ile Thr Asn Leu Leu

35 40 45

Val Ala Leu Ala Glu Gly Leu Glu Pro Gly Glu Arg Phe Glu Lys Leu

50 55 60

Asp Ala Ile Arg Asn Ile Gln Phe Ala Ile Leu Glu Arg Leu Arg Tyr

65 70 75 80

Pro Asn Val Ile Arg Glu Glu Ile Glu Arg Leu Leu Glu Asn Ile Thr

85 90 95

Val Leu Ala Glu Ala Ala Ala Leu Ala Thr Ser Pro Ala Leu Thr Asp

100 105 110

Glu Leu Val Ser His Gly Glu Leu Met Ser Thr Leu Leu Phe Val Glu

115 120 125

Ile Leu Arg Glu Arg Asp Val Gln Ala Gln Trp Phe Asp Val Arg Lys

130 135 140

Val Met Arg Thr Asn Asp Arg Phe Gly Arg Ala Glu Pro Asp Ile Ala

145 150 155 160

Ala Leu Ala Glu Leu Ala Ala Leu Gln Leu Leu Pro Arg Leu Asn Glu

165 170 175

Gly Leu Val Ile Thr Gln Gly Phe Ile Gly Ser Glu Asn Lys Gly Arg

180 185 190

Thr Thr Thr Leu Gly Arg Gly Gly Ser Asp Tyr Thr Ala Ala Leu Leu

195 200 205

Ala Glu Ala Leu His Ala Ser Arg Val Asp Ile Trp Thr Asp Val Pro

210 215 220

Gly Ile Tyr Thr Thr Asp Pro Arg Val Val Ser Ala Ala Lys Arg Ile

225 230 235 240

Asp Glu Ile Ala Phe Ala Glu Ala Ala Glu Met Ala Thr Phe Gly Ala

245 250 255

Lys Val Leu His Pro Ala Thr Leu Leu Pro Ala Val Arg Ser Asp Ile

260 265 270

Pro Val Phe Val Gly Ser Ser Lys Asp Pro Arg Ala Gly Gly Thr Leu

275 280 285

Val Cys Asn Lys Thr Glu Asn Pro Pro Leu Phe Arg Ala Leu Ala Leu

290 295 300

Arg Arg Asn Gln Thr Leu Leu Thr Leu His Ser Leu Asn Met Leu His

305 310 315 320

Ser Arg Gly Phe Leu Ala Glu Val Phe Gly Ile Leu Ala Arg His Asn

325 330 335

Ile Ser Val Pro Leu Ile Thr Thr Ser Glu Val Ser Val Ala Leu Thr

340 345 350

Leu Asp Thr Thr Gly Ser Thr Ser Thr Gly Asp Thr Leu Leu Thr Gln

355 360 365

Ser Leu Leu Met Glu Leu Ser Ala Leu Cys Arg Val Glu Val Glu Glu

370 375 380

Gly Leu Ala Leu Val Ala Leu Ile Gly Asn Asp Leu Ser Lys Ala Cys

385 390 395 400

Gly Val Gly Lys Glu Val Phe Gly Val Leu Glu Pro Phe Asn Ile Arg

405 410 415

Met Ile Cys Tyr Gly Ala Ser Ser His Asn Leu Cys Phe Leu Val Pro

420 425 430

Gly Glu Asp Ala Glu Gln Val Val Gln Lys Leu His Ser Asn Leu Phe

435 440 445

Glu

<210>10

<211>292

<212>PRT

<213>Artificialsequence

<400>10

Met Phe Thr Gly Ser Ile Val Ala Ile Val Thr Pro Met Asp Glu Lys

1 5 10 15

Gly Asn Val Cys Arg Ala Ser Leu Lys Lys Leu Ile Asp Tyr His Val

20 25 30

Ala Ser Gly Thr Ser Ala Ile Val Ser Val Gly Thr Thr Gly Glu Ser

35 40 45

Ala Thr Leu Asn His Asp Glu His Ala Asp Val Val Met Met Thr Leu

50 55 60

Asp Leu Ala Asp Gly Arg Ile Pro Val Ile Ala Gly Thr Gly Ala Asn

65 70 75 80

Ala Thr Ala Thr Ala Ile Ser Leu Thr Gln Arg Phe Asn Asp Ser Gly

85 90 95

Ile Val Gly Cys Leu Thr Val Thr Pro Tyr Tyr Asn Arg Pro Ser Gln

100 105 110

Glu Gly Leu Tyr Gln His Phe Lys Ala Ile Ala Glu His Thr Asp Leu

115 120 125

Pro Gln Ile Leu Tyr Asn Val Pro Ser Arg Thr Gly Cys Asp Leu Leu

130 135 140

Pro Glu Thr Val Gly Arg Leu Ala Lys Val Lys Asn Ile Ile Gly Ile

145 150 155 160

Lys Glu Ala Thr Gly Asn Leu Thr Arg Val Asn Gln Ile Lys Glu Leu

165 170 175

Val Ser Asp Asp Phe Val Leu Leu Ser Gly Asp Asp Ala Ser Ala Leu

180 185 190

Asp Phe Met Gln Leu Gly Gly His Gly Val Ile Ser Val Thr Ala Asn

195 200 205

Val Ala Ala Arg Asp Met Ala Gln Met Cys Lys Leu Ala Ala Glu Gly

210 215 220

His Phe Ala Glu Ala Arg Val Ile Asn Gln Arg Leu Met Pro Leu His

225 230 235 240

Asn Lys Leu Phe Val Glu Pro Asn Pro Ile Pro Val Lys Trp Ala Cys

245 250 255

Lys Glu Leu Gly Leu Val Ala Thr Asp Thr Leu Arg Leu Pro Met Thr

260 265 270

Pro Ile Thr Asp Ser Gly Arg Glu Thr Val Arg Ala Ala Leu Lys His

275 280 285

Ala Gly Leu Leu

290

<210>11

<211>440

<212>PRT

<213>Corynebacteriumglutamicum

<400>11

Val Ser Ala Ile Ile Gln Ala Phe Lys Asp Ala Asp Leu Arg Lys Lys

1 5 10 15

Ile Phe Phe Thr Ile Ala Met Ile Val Leu Tyr Arg Ile Gly Ala Gln

20 25 30

Ile Pro Ser Pro Gly Val Asp Tyr Ala Thr Ile Ser Gly Arg Leu Arg

35 40 45

Asp Leu Thr Gln Asp Gln Ser Ser Val Tyr Ser Leu Ile Asn Leu Phe

50 55 60

Ser Gly Gly Ala Leu Leu Gln Leu Ser Ile Phe Ala Ile Gly Ile Met

65 70 75 80

Pro Tyr Ile Thr Ala Ser Ile Ile Val Gln Leu Leu Thr Val Val Ile

85 90 95

Pro His Phe Glu Glu Leu Lys Lys Glu Gly Gln Ser Gly Gln Ala Lys

100 105 110

Met Met Gln Tyr Thr Arg Tyr Leu Thr Val Ala Leu Ala Leu Leu Gln

115 120 125

Ser Ser Gly Ile Val Ala Leu Ala Asp Arg Glu Gln Leu Leu Gly Ala

130 135 140

Gly Ile Arg Val Leu Ser Ala Asp Arg Asn Phe Phe Asp Leu Ile Val

145 150 155 160

Leu Val Ile Thr Met Thr Ala Gly Ala Val Leu Val Met Trp Met Gly

165 170 175

Glu Leu Ile Thr Glu Lys Gly Val Gly Asn Gly Met Ser Leu Leu Ile

180 185 190

Phe Ala Gly Ile Ala Thr Arg Leu Pro Thr Asp Gly Met Asn Ile Leu

195 200 205

Gly Asn Ser Gly Gly Val Val Phe Ala Val Val Leu Ala Ser Val Leu

210 215 220

Ile Leu Val Ile Gly Val Val Phe Val Glu Gln Gly Gln Arg Arg Ile

225 230 235 240

Pro Val Gln Tyr Ala Lys Arg Met Val Gly Arg Arg Gln Tyr Gly Gly

245 250 255

Ser Ser Thr Tyr Leu Pro Leu Lys Val Asn Gln Ala Gly Val Ile Pro

260 265 270

Val Ile Phe Ala Ser Ser Leu Ile Tyr Met Pro Val Leu Ile Thr Gln

275 280 285

Ile Val Asn Ser Gly Ser Leu Glu Val Phe Asp Asn Trp Trp Gln Arg

290 295 300

Asn Ile Ile Ala His Leu Gln Thr Pro Ser Ser Trp Gln Tyr Ile Val

305 310 315 320

Leu Tyr Phe Ala Leu Thr Ile Phe Phe Ser Tyr Phe Tyr Val Ser Val

325 330 335

Gln Tyr Asp Pro Ala Glu Gln Ala Glu Asn Met Lys Lys Tyr Gly Gly

340 345 350

Phe Ile Pro Gly Ile Arg Pro Gly Arg Pro Thr Ala Glu Tyr Leu Gly

355 360 365

Phe Val Met Asn Arg Leu Leu Phe Val Gly Ser Leu Tyr Leu Ala Val

370 375 380

Ile Ala Val Leu Pro Asn Ile Met Leu Asp Leu Gly Val Asp Ala Gly

385 390 395 400

Ser Ala Gly Ala Thr Pro Phe Gly Gly Thr Ala Ile Leu Ile Leu Val

405 410 415

Ser Val Ala Leu Thr Thr Val Lys Gln Ile Glu Ser Gln Leu Leu Gln

420 425 430

Ser Asn Tyr Glu Gly Leu Leu Lys

435 440

<210>12

<211>1323

<212>DNA

<213>Corynebacteriumglutamicum

<400>12

gtgtccgcca ttattcaggc attcaaggac gccgatctgc gtaagaagat tttcttcact 60

atcgcaatga tcgttctata ccgcatcggt gcgcagatcc cttccccggg agttgactac 120

gcaacgatta gtggtcgtct gcgtgacttg actcaggatc agtcaagcgt ttattcgctg 180

attaacctgt tttccggtgg agcgctgttg cagctgtcca tttttgctat tggtatcatg 240

ccgtacatca cggcgtctat tatcgtgcag ctgctgactg tggttattcc gcactttgag 300

gagttgaaga aggaaggcca gtccggccag gccaagatga tgcagtacac caggtactta 360

acggttgctt tggcgttgct gcagtcttca ggcattgtcg cgttggcgga ccgtgagcag 420

ctgcttggcg caggcattcg cgtgctgtcg gctgatcgca acttcttcga cctcattgtt 480

ttggtcatca ccatgactgc gggtgcagtg cttgtgatgt ggatgggtga gctcatcacg 540

gaaaagggcg tcggcaatgg tatgtcgttg ctgattttcg ctggtatcgc aactcgcctc 600

ccaactgatg gcatgaacat tctgggtaac tccggcggcg tggttttcgc tgttgttctg 660

gcttccgttc tgatcctggt cattggtgtt gtattcgttg agcagggcca gcgtcgtatt 720

ccagtgcagt acgcaaagcg catggtgggt cgtcgtcagt acggtggttc ttccacctac 780

ctgcctttga aggtcaacca agctggtgtt atcccagtga tcttcgcgtc ttccttgatt 840

tacatgccag tgctgattac tcagatcgtg aactctggtt cgctggaagt gtttgataac 900

tggtggcagc gcaacatcat tgcgcacctg cagacgcctt cttcttggca gtacattgtt 960

ttgtactttg cactgaccat cttcttctct tacttctatg tttccgttca gtatgatcct 1020

gctgagcagg ctgaaaatat gaagaagtac ggtggattta tccctggtat tcgtccgggc 1080

cgcccgactg ctgagtactt gggattcgtc atgaaccgcc tgctgtttgt tggttccctg 1140

tacctggctg tcattgctgt gctgccaaac attatgctgg atctaggtgt tgacgccggt 1200

tcggccggag caactccatt cggcggaacc gcaatcttga ttcttgtatc tgttgcactg 1260

accacagtga agcagattga gagccagctc ctgcaaagca actatgaagg acttctaaaa 1320

taa 1323

Claims (10)

1. A method for constructing engineering bacteria comprises the following steps: in the starting strain, the SecY protein is modified to obtain the engineering strain with improved lysine tolerance and/or lysine yield compared with the starting strain.

2. The method of claim 1, wherein:

in the development strain, the SecY protein is modified into any one of the following:

(b1) inhibiting the expression of said SecY protein;

(b2) mutating the methionine at position 145 of the SecY protein to valine;

(b3) the initiation codon atg of the gene encoding the SecY protein was mutated to gtg.

3. The method according to claim 1 or 2, characterized in that: the method is any one of the following steps:

method A, comprising the steps of: inhibiting the expression of the SecY protein in the outbreak bacteria to obtain the engineering bacteria;

the method B comprises the following steps: mutating the methionine at the 145 th site of the SecY protein in the outbreak bacteria into valine to obtain the engineering bacteria;

method C, comprising the steps of: and mutating the initiation codon atg of the coding gene of the SecY protein in the outbreak bacterium into gtg to obtain the engineering bacterium.

4. The method of claim 3, wherein:

inhibiting the expression of the SecY protein in the outbreak is achieved by introducing sRNA targeting nucleotides 1-24 of the coding gene for the SecY protein into the outbreak;

and/or

The methionine at position 145 of the SecY protein in the starting bacterium is mutated into valine by introducing a SecY433 fragment into the starting bacterium, wherein the nucleotide sequence of the SecY433 fragment is shown as SEQ ID No. 7;

and/or

The method is realized by introducing a secYgtg fragment into the outbreak bacterium, wherein the nucleotide sequence of the secYgtg fragment is shown as SEQ ID No. 8.

5. The method according to any one of claims 1-4, wherein: the germination bacteria are lysine production strains;

further, the starting bacterium is escherichia coli or corynebacterium glutamicum.

6. Any one of the following biomaterials:

(I) a protein;

the protein is SecY^M145VA protein;

the SecY^M145VThe protein is obtained by mutating the 145 th methionine of the SecY protein into valine;

(II) a gene;

the gene is the SecY^M145VA gene encoding a protein;

(III) a DNA fragment which is a secY433 fragment or a secYgtg fragment;

the nucleotide sequence of the secY433 fragment is shown as SEQ ID No. 7; the nucleotide sequence of the secYgtg fragment is shown as SEQ ID No. 8;

(III) an expression cassette;

the expression cassette is a cassette containing the SecY^M145VList of genes encoding proteinsAn expression cassette or an expression cassette comprising said DNA fragment;

(IV) a recombinant vector;

the recombinant vector contains the SecY^M145VA recombinant vector of a gene encoding a protein or a recombinant vector containing the DNA fragment;

(V) recombinant bacteria;

the recombinant strain contains the SecY^M145VRecombinant bacteria of coding genes of the protein or recombinant bacteria containing the DNA segments;

(VI) the engineered bacteria prepared by the method of claims 1-5.

7. Any of the following applications:

(a) use of the biomaterial of claim 6 to improve starter lysine tolerance and/or lysine production;

(b) use of the biomaterial of claim 6 in the production of lysine.

8. The method or biomaterial or use according to any one of claims 1 to 7, wherein:

the SecY protein is any one of the following proteins:

(C1) a protein having an amino acid sequence of SEQ ID No.3 or SEQ ID No. 11;

(C2) protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence shown in SEQ ID No.3 or SEQ ID No.11 and has the same function;

(C3) a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more homology to the amino acid sequence defined in any one of (C1) to (C2) and having the same function;

(C4) a fusion protein obtained by attaching a tag to the N-terminus and/or C-terminus of the protein defined in any one of (C1) to (C3).

9. The method or biomaterial or use according to any one of claims 1 to 8, wherein:

the encoding gene of the SecY protein is a DNA molecule as follows:

(F1) a DNA molecule shown in SEQ ID No.6 or 505-1836 of SEQ ID No. 6;

(F2) a DNA molecule as shown in SEQ ID No.12 or position 138-1460 of SEQ ID No. 12;

(F3) a DNA molecule that hybridizes under stringent conditions to the DNA molecule defined in (F1) or (F2) and encodes the SecY protein;

(F4) a DNA molecule having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more homology to the DNA sequence defined in any one of (F1) to (F3) and encoding the SecY protein;

and/or

The SecY^M145VThe encoding gene of the protein is obtained by replacing a codon encoding methionine at position 145 of the SecY protein in the encoding gene of the SecY protein with a codon of valine.

10. A method for preparing lysine, comprising the steps of: cultivating the recombinant bacterium or the engineered bacterium of claim 6 to produce lysine, thereby separating lysine from the culture solution.