CN112226428A - Oleic acid hydratase mutant and application thereof in preparation of 10-hydroxystearic acid - Google Patents

Oleic acid hydratase mutant and application thereof in preparation of 10-hydroxystearic acid Download PDF

Info

Publication number
CN112226428A
CN112226428A CN202011182795.4A CN202011182795A CN112226428A CN 112226428 A CN112226428 A CN 112226428A CN 202011182795 A CN202011182795 A CN 202011182795A CN 112226428 A CN112226428 A CN 112226428A
Authority
CN
China
Prior art keywords
oleic acid
acid
phenylalanine
seq
amino acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202011182795.4A
Other languages
Chinese (zh)
Other versions
CN112226428B (en
Inventor
潘江
孙启帆
许建和
陈琦
钱小龙
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Suzhou Baifu Enzyme Technology Co ltd
Original Assignee
Suzhou Baifu Enzyme Technology Co ltd
East China University of Science and Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Suzhou Baifu Enzyme Technology Co ltd, East China University of Science and Technology filed Critical Suzhou Baifu Enzyme Technology Co ltd
Priority to CN202011182795.4A priority Critical patent/CN112226428B/en
Publication of CN112226428A publication Critical patent/CN112226428A/en
Application granted granted Critical
Publication of CN112226428B publication Critical patent/CN112226428B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6409—Fatty acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y402/00—Carbon-oxygen lyases (4.2)
    • C12Y402/01—Hydro-lyases (4.2.1)
    • C12Y402/01053—Oleate hydratase (4.2.1.53)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The invention relates to an oleic acid hydratase mutant and application thereof in preparation of 10-hydroxystearic acid, and discloses an oleic acid hydratase mutant with remarkably improved activity and stability, a coding gene and an amino acid sequence thereof, a recombinant expression vector and a recombinant expression transformant containing the gene sequence, a recombinant oleic acid hydratase mutant catalyst, and practical application of the oleic acid hydratase mutant or the recombinant oleic acid hydratase mutant catalyst in preparation of 10-hydroxystearic acid and 10-carbonyl stearic acid by catalytic conversion of oleic acid. Compared with the prior art, the oleic acid hydratase mutant has remarkably high activity and stability, so that the dosage of a catalyst is greatly reduced, and in the enzymatic oxidation preparation process of 10-carbonyl stearic acid, cheap hydrogen peroxide is used as an oxidant, so that the cost is low, the method is green and environment-friendly, and the method has a good application prospect in the production of 10-carbonyl stearic acid.

Description

Oleic acid hydratase mutant and application thereof in preparation of 10-hydroxystearic acid
Technical Field
The invention belongs to the technical field of bioengineering, and particularly relates to a Paracoccus ammoniaphilus (Paracoccus aminophyllius) derived oleic acid hydratase mutant, a coding gene thereof, a recombinant expression vector containing a gene sequence and a recombinant expression transformant; the recombinant oleic acid hydratase mutant catalyst also relates to application of the oleic acid hydratase mutant or the recombinant oleic acid hydratase mutant catalyst in preparation of 10-hydroxystearic acid and preparation of 10-carbonyl stearic acid by cascading with 10-hydroxystearic acid dehydrogenase.
Background
Oleic acid is an important natural product, is a typical renewable resource, and has low price and rich sources. With the successful research and development of high-purity oleic acid production technology and the popularization of high-oleic acid plants, the production amount of oleic acid in China tends to increase year by year. The yield of the high-purity oleic acid industry in China is about 1.65 ten thousand tons (development research report of the oleic acid industry in China) in 2015, the yield is increased by 22.2 percent on a year-by-year basis, and the production scale of the high-purity oleic acid industry is continuously expanded along with the continuous expansion of the oleic acid market.
Oleic acid is a long-chain fatty acid containing a carbon-carbon double bond, and its functional group is modified to obtain products such as 10-hydroxystearic acid and 10-carbonylstearic acid. Wherein, the 10-hydroxystearic acid and the 10-carbonyl stearic acid can be used as chemical intermediates for synthesizing fine chemicals, medicaments and the like, and have higher industrial application value. 10-hydroxystearic acid has been reported to have beneficial cosmetic effects and can be used to treat or prevent any symptoms caused by the negative development of physiological homeostasis of healthy skin, as well as to promote hair growth and hair loss protection, improve skin age spots and prominent pores.
In 2011, Oh et al used whole cells of wild-type Stenotrophomonas nitroreducens to catalyze the hydration reaction of oleic acid under anaerobic condition with a substrate concentration of 30 g.L-1The wet cell load was 20 g.L-1When it is reacted with4h could be completely converted, whereas 4h could only be 63% under aerobic conditions (Biotechnol. Lett.,2011,33: 993-. In 2019, oleic acid hydratase (PaOH for short) derived from Paracoccus aminophilus is created and excavated by the same method, and when the concentration of oleic acid is 90g/L and the loading capacity of freeze-dried enzyme powder is 5kU/L, the conversion rate is higher than 95% after 4h of reaction; on the basis, hydroxystearic acid dehydrogenase is used for catalyzing the dehydrogenation reaction of hydration product 10-hydroxystearic acid to generate 10-carbonyl stearic acid, and coupled lactate dehydrogenase is used for catalyzing the oxidation reaction of pyruvic acid to realize coenzyme NAD+The reaction is continued for 2 hours, and the final yield of the 10-carbonyl stearic acid is 95.8 percent (Chinese patent CN 110004133A).
At present, the activity of the oleic acid hydratase is relatively low, and due to the lack of an effective high-throughput screening method, the activity and stability modification research is less; in the process of preparing 10-carbonyl stearic acid by oleic acid hydratase cascade hydroxystearic acid dehydrogenase, expensive pyruvic acid is used as a cosubstrate for coenzyme cyclic regeneration, and the coenzyme has high cyclic cost and is not beneficial to industrial utilization.
Disclosure of Invention
In view of the reported defects of low activity, poor stability and low space-time yield of catalytic reaction of the oleic acid hydratase, the invention establishes a high-efficiency and simple high-throughput screening method of the oleic acid hydratase, and the oleic acid hydratase mutant with higher catalytic performance is obtained by starting from oleic acid hydratase PaOH from Paracoccus ammoniaphilus (Paracoccus ammoniaphilus) and improving the activity and stability of the oleic acid hydratase PaOH through a molecular engineering means. On the basis, the oleic acid hydratase mutant is used in the preparation of 10-hydroxystearic acid, so that the coenzyme regeneration process for preparing 10-carbonyl stearic acid by enzymatic conversion of 10-hydroxystearic acid is improved, and the production cost of 10-carbonyl stearic acid is effectively reduced.
The invention aims to establish an efficient high-throughput screening method, improve the activity and the thermal stability of the oleic acid hydratase by a molecular modification means, and establish a relatively cheap and suitable coenzyme circulation system to reduce the production cost.
The purpose of the invention can be realized by the following technical scheme:
according to one technical scheme of the invention, the oleic acid hydratase mutant with obviously improved catalytic performance is obtained.
The invention uses an oleic acid hydratase (named PaOH) from Paracoccus ammoniaphilus JCM 7686 as a female parent, finds key amino acid residues near a substrate binding site through comparison of amino acid sequences and spatial structures, adopts a strategy of site-specific saturated mutation to successfully obtain a mutant with improved stability and catalytic activity, performs directed evolution transformation on the mutant through modification strategies such as error-prone PCR (polymerase chain reaction) and the like on the basis, and combines high-throughput primary screening and gas chromatography rescreening of a microplate reader to identify and obtain a batch of oleic acid hydratase mutants with obviously improved stability and catalytic activity.
Wherein, the nucleic acid sequence of the oleic acid hydratase PaOH is shown in SEQ ID No.1, and the amino acid sequence thereof is shown in SEQ ID No. 2. The strain Paracoccus aminophilus (Paracoccus aminophilius) JCM 7686 is purchased from the Japanese culture Collection of microorganisms.
The currently known oleic acid hydratases are all flavoproteins, and no colored compound is involved in the reaction for catalyzing the conversion of oleic acid into 10-hydroxystearic acid, so that the mutant is difficult to screen directly by a high-throughput spectrophotometric method. In the invention, the reaction catalyzed by oleic acid hydratase and the enzymatic oxidation reaction of the product 10-hydroxystearic acid are coupled, so that a rapid high-flux primary screening method of an enzyme-labeling instrument is established. The high-throughput primary screening method of the microplate reader is carried out in an elisa plate, the oleic acid hydratase mutant is added into a buffer solution containing an oleic acid substrate to react for a certain time, the reaction conversion rate is controlled within 10%, and then a proper amount of hydration reaction liquid is added into a buffer solution containing 10-hydroxystearic acid dehydrogenase and NAD+In a color reaction solution of Phenazine Ethosulfate (PES) and 3- (4, 5-dimethyl-2-thiazolyl) -2,5-diphenyl tetrazolium bromide (3- (4, 5-dimethyl-2-yl) -2,5-diphenyl tetrazolium bromide, MTT, thiazole blue). The 10-hydroxystearic acid dehydrogenase can catalyze the oxidation of 10-hydroxystearic acid and can simultaneously oxidize NAD+Converting into NADH; NADH can then reduce PES from an oxidized state to a reduced state while regenerating NAD+(ii) a The reduced PES can oxidize MTTThe reduction state is converted, and meanwhile, PES in an oxidation state is regenerated, and the process is repeated, so that 10-hydroxystearic acid can be completely converted into 10-carbonyl stearic acid, and simultaneously, the same amount of MTT in a reduction state is generated. The reduced MTT is blue-violet, has a maximum absorption peak at 580nm, can be quickly detected by an enzyme-labeling instrument, and is converted to obtain the yield of 10-hydroxystearic acid in the oleic acid hydration reaction, so that the activity of the oleic acid hydratase mutant is calculated.
The oleic acid hydratase mutant is a protein corresponding to a new amino acid sequence formed by replacing one or more amino acid residues in threonine 15, phenylalanine 122, phenylalanine 233, histidine 332, tyrosine 444, aspartic acid 451 and glutamic acid 622 of an amino acid sequence shown in SEQ ID No.2 with other amino acid residues.
Specifically, the oleic acid hydratase mutant is a protein consisting of any one of the following amino acid sequences:
(1) the 233 rd site phenylalanine of the amino acid sequence shown as SEQ ID No.2 is replaced by leucine;
(2) the phenylalanine at position 233 of the amino acid sequence shown in SEQ ID No.2 is replaced by leucine, and the phenylalanine at position 122 is replaced by leucine;
(3) the 233 rd phenylalanine and 622 nd glutamic acid of the amino acid sequence shown in SEQ ID No.2 are replaced by leucine and glycine respectively;
(4) substituting phenylalanine at position 233, phenylalanine at position 122, and threonine at position 15 of the amino acid sequence shown in SEQ ID No.2 with leucine;
(5) substituting phenylalanine at position 233, phenylalanine at position 122, and threonine at position 15 of the amino acid sequence shown in SEQ ID No.2 with leucine;
(6) replacing phenylalanine at position 233, phenylalanine at position 122, and threonine at position 15 of the amino acid sequence shown in SEQ ID No.2 with leucine, and asparagine;
(7) the phenylalanine at position 233, the phenylalanine at position 122 and the threonine at position 15 of the amino acid sequence shown in SEQ ID No.2 are replaced by leucine, leucine and glycine respectively;
(8) the phenylalanine at position 233, the phenylalanine at position 122 and the threonine at position 15 of the amino acid sequence shown in SEQ ID No.2 are replaced by leucine, leucine and cysteine respectively;
(9) substituting phenylalanine at position 233, phenylalanine at position 122, and threonine at position 15 of the amino acid sequence shown in SEQ ID No.2 with leucine, and isoleucine;
(10) replacing histidine at position 332 of the amino acid sequence shown as SEQ ID No.2 with tyrosine;
(11) the tyrosine at position 444 of the amino acid sequence shown as SEQ ID No.2 is replaced by phenylalanine, and the aspartic acid at position 451 is replaced by glutamic acid;
(12) the amino acid sequence shown in SEQ ID No.2 has the amino acid sequence with tyrosine substituted at position 332 and threonine substituted at position 451.
The method for obtaining the oleic acid hydratase mutant can adopt the conventional method in the field, and is preferably obtained by separating from a transformant which recombinantly expresses the oleic acid hydratase mutant; or obtained by artificial synthesis.
The second technical scheme of the invention provides a coding gene of the oleic acid hydratase mutant and a recombinant expression vector containing the coding gene. The encoding gene codes and expresses the modified oleic acid hydratase mutant according to the technical scheme I, and the source of the mutant comprises: cloning the gene sequence of the series of oleic acid hydratase mutants in the technical scheme I by using a genetic engineering technology; or obtaining the nucleic acid molecule for coding the oleic acid hydratase mutant according to the technical scheme I by a method of artificial complete sequence synthesis.
The recombinant expression vector can be constructed by connecting the nucleotide sequence of the oleic acid hydratase mutant gene of the invention to various commercial empty vectors by a conventional method in the field. The commercially available empty vector may be any of various plasmid vectors which are conventional in the art, so long as the recombinant expression vector can normally replicate in a corresponding expression host and express the corresponding oleate hydratase mutant. The preferred plasmid vectors are different for different expression hosts. It will be clear to one of ordinary skill in the art how to select appropriate vectors, promoters, enhancers and host cells. For E.coli hosts, the plasmid vector is preferably plasmid pET-28a (+). The recombinant expression vector of the escherichia coli can be prepared by the following method: the DNA fragment of the gene sequence of the oleic acid hydratase mutant obtained by PCR amplification is subjected to double digestion by using restriction enzymes EcoR I and Xho I, meanwhile, the unloaded plasmid pET28a is subjected to double digestion by using the restriction enzymes EcoR I and Xho I, the DNA fragment of the oleic acid hydratase mutant subjected to the enzyme digestion and the unloaded plasmid are recovered, and the DNA fragment and the unloaded plasmid are connected by using T4 DNA ligase to construct a recombinant expression vector containing the nucleic acid molecule encoding the oleic acid hydratase mutant and used for escherichia coli expression.
The third technical scheme of the invention provides a recombinant expression transformant containing the oleic acid hydratase mutant gene or a recombinant expression vector thereof. The recombinant expression transformant can be prepared by transforming the above recombinant expression vector into a corresponding host cell by a conventional technique in the art. The host cell is conventional in the art, as long as the recombinant expression vector can stably replicate by itself and the encoded oleic acid hydratase mutant gene can be efficiently expressed. Coli BL21(DE3) is preferably used for high-efficiency expression of the oleic acid hydratase mutant.
The fourth technical scheme of the invention provides a recombinant oleic acid hydratase mutant catalyst, which is any one of the following forms:
(1) culturing the recombinant expression transformant, and separating a transformant cell containing the oleic acid hydratase mutant;
(2) culturing the recombinant expression transformant, and separating a crude enzyme solution containing the oleic acid hydratase mutant;
(3) and drying the crude enzyme liquid of the oleic acid hydratase mutant to obtain crude enzyme powder.
Wherein the culturing methods and conditions of the recombinant expression transformant are conventional in the art and comprise the steps of: culturing the recombinant expression transformant of the invention to obtain the recombinant oleic acid hydratase mutant. For recombinant E.coli, the preferred medium is LB medium: 10g/L of peptone, 5g/L of yeast extract, 10g/L of NaCl and 6.5-7.0 of pH. The preferred culture method is: the recombinant Escherichia coli constructed as described above was inoculated into LB medium containing kanamycin and cultured overnight at 37 ℃ with shaking at 180 rpm. Inoculating to 500mL Erlenmeyer flask containing 100mL LB medium (containing kanamycin) at an inoculum size of 1-2% (v/v), shaking and culturing at 37 deg.C and 180rpm, when OD of culture solution is600When the concentration reaches 0.6-0.8, adding isopropyl-beta-D-thiogalactoside (IPTG) with the final concentration of 0.1-0.5mmol/L as an inducer, inducing for 16-24h at 16-25 ℃, centrifuging the culture solution, collecting the precipitate, and then washing twice with physiological saline to obtain the recombinant expression transformant cell. And freeze-drying the harvested recombinant cells to obtain the freeze-dried cells containing the oleic acid hydratase mutant. Suspending the harvested recombinant cells in a buffer solution with 5-10 times volume (v/w), ultrasonically crushing, centrifuging and collecting supernatant to obtain a crude enzyme solution of the recombinant oleic acid hydratase mutant. And (3) freezing the collected crude enzyme solution at-80 ℃, and then drying at low temperature by using a vacuum freeze dryer to obtain freeze-dried enzyme powder. The obtained freeze-dried enzyme powder is stored in a refrigerator at 4 ℃ and can be conveniently used.
The method for determining the activity of the oleic acid hydratase mutant comprises the following steps: the reaction was carried out in a 2mL round-bottom EP tube, the enzyme solution was appropriately diluted and added to potassium phosphate buffer (100mM, pH 6.5) containing oleic acid as a substrate, and after the reaction was carried out at 30 ℃ for 5 minutes with shaking the reactor at 1,000rpm, 20. mu.L of sulfuric acid (20%, w/v) was added to terminate the reaction. Adding equal volume of ethyl acetate containing 2mM internal standard palmitic acid, shaking for extraction, and centrifuging at centrifugal force of 16,200 Xg for 2 min. mu.L of the upper organic phase was aspirated off by a pipette into a fresh EP tube and dried overnight with an appropriate amount of anhydrous sodium sulfate. Adding 40 μ L of the supernatant into a lining tube of a gas chromatography bottle, adding 40 μ L of methanol/diethyl ether (1:1) mixed solution and 20 μ L of trimethylsilylated diazomethane, keeping the temperature at 20-40 deg.C for 15min, performing gas chromatography, and detecting the contents of substrate and product.
The unit of oleic acid hydratase activity (U) is defined as: under the above reaction conditions, the amount of enzyme required to catalyze the conversion of 1.0. mu. mol of oleic acid to 10-hydroxystearic acid per minute.
The fifth technical scheme of the invention provides application of the recombinant oleic acid hydratase mutant or the oleic acid hydratase mutant catalyst in synthesis of 10-hydroxystearic acid, namely a method for preparing 10-hydroxystearic acid by enzymatic conversion of the recombinant oleic acid hydratase mutant.
The specific reaction conditions, such as substrate concentration, buffer composition, pH, enzyme dosage and the like, under which the oleic acid hydratase mutant catalyzes oleic acid to 10-hydroxystearic acid can be selected according to the conventional conditions of such reactions in the art. Preferably, the reaction buffer is KPB buffer with pH of 6.0-7.5, the concentration of the buffer is 0.05-0.2mol/L, more preferably KPB buffer with concentration of 0.1mol/L, and pH of 6.5; the reaction temperature is 15-35 ℃, and more preferably 30 ℃; the concentration of substrate oleic acid in the reaction solution is 10-100g/L, and the activity upload of the oleic acid hydratase mutant is 0.1-5 kU/L.
After the reaction is completed, the extraction of the product can be performed by a method conventional in the art. Adding acid into the reaction solution, adjusting the pH of the reaction solution to be strong acid, preferably, adding concentrated hydrochloric acid, adjusting the pH of the reaction solution to be about 2, extracting for multiple times by using ethyl acetate, combining extract liquor, carrying out rotary evaporation to remove a solvent, then adding a proper amount of methanol for recrystallization, carrying out suction filtration, and drying a filter cake to obtain a target product.
The sixth technical scheme of the invention provides application of the recombinant oleic acid hydratase mutant or the oleic acid hydratase mutant catalyst in synthesis of 10-carbonyl stearic acid, namely a method for preparing 10-hydroxystearic acid by enzymatic conversion of the recombinant oleic acid hydratase mutant and then adding 10-hydroxystearic acid dehydrogenase to prepare 10-carbonyl stearic acid. The invention adopts a green and cheap coenzyme circulating method, and reduces the cost of coenzyme application.
The preparation route of the 10-carbonyl stearic acid can be referred to as the following mode:
the recombinant oleic acid hydratase mutant is used as a catalyst to catalyze the hydration of oleic acid to generate 10-hydroxystearic acid; when the conversion rate of the reaction reaches the expected level, the pH value of the reaction system is adjusted, and then 10-hydroxystearic acid dehydrogenase MlADH and NAD (P) H oxidase SmNOX are addedVarCatalase, hydrogen peroxide and coenzyme NAD+And in-situ catalyzing the 10-hydroxystearic acid generated in the first step of reaction to be converted into 10-carbonyl stearic acid.
The 10-hydroxystearic acid dehydrogenase can be selected conventionally in the field, and the invention provides a source mode of the 10-hydroxystearic acid dehydrogenase: the protein is derived from Micrococcus luteus (Micrococcus luteus) and is named MlADH, and the amino acid sequence of the protein is shown as SEQ ID No. 3. The specific reaction conditions, such as substrate concentration, buffer composition, pH, enzyme dosage, etc., under which the 10-hydroxystearic acid dehydrogenase catalyzes the production of 10-carbonyl stearic acid from 10-hydroxystearic acid can be selected according to the conditions conventional in such reactions in the art. Preferably, the reaction buffer has a pH of 7.5 to 9.0, more preferably a pH of 8.0; the reaction temperature is 15-35 ℃, and more preferably 30 ℃; the activity upload of the 10-hydroxystearic acid dehydrogenase is 0.1-10 kU/L.
The 10-hydroxystearic acid dehydrogenase catalyzes the reaction of 10-hydroxystearic acid to 10-carbonyl stearic acid by using coenzyme NAD+In the presence of coenzyme NAD+In a concentration of 0.1-0.5mM, coenzyme NAD during the reaction+Reducing to NADH. NAD can be coupled in the course of the reaction by reaction catalysed by NAD (P) H oxidase+In situ regeneration. The NAD (P) H oxidase takes oxygen as a substrate to catalyze the oxidation of NADH to generate NAD+While oxygen is reduced to produce water. Since the oxygen in the system is limited, hydrogen peroxide is decomposed by catalase to provide oxygen.
The NAD (P) H oxidase is derived from a mutant of Streptococcus mutans (Streptococcus mutans) and is named SmNOXVarThe amino acid sequence is shown in SEQ ID No. 4. The SmNOXVarCatalytic oxygenGas oxidation of NADH to NAD+The specific reaction conditions, such as buffer composition, pH, enzyme dosage, etc., under which water is co-produced, may be selected according to the conditions conventional in the art for such reactions. Preferably, the SmNOXVarThe vitality upload of (A) is 0.1-10 kU/L.
The catalase was purchased from Biotechnology engineering (Shanghai) Inc., with an activity of 2000-. The catalase may be SmNOXVarThe hydrogen peroxide is catalyzed and decomposed to generate oxygen under the same catalytic reaction condition.
After the reaction is completed, the extraction of the product can be performed by a method conventional in the art. Adding acid into the reaction solution, adjusting the pH of the reaction solution to be strong acid, preferably, adding concentrated hydrochloric acid, adjusting the pH of the reaction solution to be about 2, extracting for multiple times by using ethyl acetate, combining the extract liquor, carrying out rotary evaporation to remove the solvent, then adding a proper amount of methanol for recrystallization, carrying out suction filtration, and drying a filter cake to obtain a target product.
Compared with the prior art, the invention has the advantages that: the invention provides an oleic acid hydratase mutant with remarkably improved activity and thermal stability, which can efficiently catalyze oleic acid to generate 10-hydroxystearic acid, and in the synthesis application of 10-hydroxystearic acid and 10-carbonyl stearic acid, the dosage of the catalyst is small, the concentration of substrate oleic acid is up to 100g/L, and the conversion rate of more than 99 percent is realized; and a more green and cheap coenzyme circulation mode is provided, cheap hydrogen peroxide is used as an oxidant, the enzymatic cascade realizes the circulation regeneration of expensive coenzyme NAD +, the cost of the enzymatic cascade for producing 10-carbonyl stearic acid is effectively reduced, and the method has a good industrial application prospect.
Drawings
FIG. 1: schematic representation of the conversion of oleic acid to 10-carbonyl stearic acid catalyzed by the oleic acid hydratase mutant and 10-hydroxystearic acid dehydrogenase cascade.
Detailed Description
The individual reaction or detection conditions described in the context of the present invention may be combined or modified according to common general knowledge in the art and may be verified experimentally. The technical solutions and technical effects of the present invention will be clearly and completely described below with reference to the specific embodiments, but the scope of the present invention is not limited to these embodiments, and all changes or equivalent substitutions that do not depart from the spirit of the present invention are included in the scope of the present invention.
The material sources in the following examples are:
the parent recombinant plasmid pET28a-PaOH contains a nucleic acid sequence shown in a sequence table SEQ ID No.1 and is also disclosed in a patent CN 110004133A.
Plasmid vector pET28a was purchased from Novagen.
Coli DH5 α, E.coli BL21(DE3), 2 XTaq PCR MasterMix, agarose gel DNA recovery kits were purchased from Beijing Tiangen Biochemical technology Ltd.
The restriction enzymes EcoR I and Xho I are commercially available from New England Biolabs (NEB).
Unless otherwise indicated, specific experiments in the following examples were performed according to methods and conditions conventional in the art, or according to the commercial instructions of the kits.
Example 1 high throughput screening method for oleic acid hydratase mutants
Transforming the mutant DNA of the oleic acid hydratase mutant gene into escherichia coli E.coli BL21(DE3) competent cells, picking single colonies growing on a transformed plate into a 96-hole deep-hole plate containing 200 mu L of LB culture medium in each hole by using a sterilized toothpick, and culturing at 37 ℃ and 220rpm to obtain a first-level plate. After the primary plate is cultured for 12 hours, the growth conditions of the bacteria liquid in each hole tend to be consistent after exponential growth, and then the bacteria liquid can be transferred to the secondary deep hole plate. Sucking 20 μ L of first-level bacterial liquid with a row gun, transferring to 96-well deep-well plate containing 600 μ L of LB medium per well, culturing for 2.5 hr, and culturing at OD600After reaching 1-2, 50 μ L of LB medium containing IPTG was added to make the final concentration of IPTG in the secondary plate 0.1mM, after inducing at 16 ℃ for 20h, cells were collected by centrifugation at 2395 Xg for 10min, and the supernatant was decanted off. The primary plate was stored at 4 ℃ after the transfer of the secondary plate.
mu.L of lysis buffer (containing 750mg/L Lysozyme and 10mg/L DNase I dissolved in 100mM KPB pH 7.5) was added to each well of the secondary plate, the lid was closed, the cells were suspended by vigorous shaking on a shaker, and then the secondary plate was incubated at 30 ℃ on a shaker and shaken at 180rpm to lyse the cells sufficiently, and the reaction was carried out for 1 hour.
The screening of the oleic acid hydratase mutant is carried out in two steps: in the first step, 300. mu.L of potassium phosphate buffer (100mM, pH 7.5) containing oleic acid substrate at a final concentration of 8mM was added to the above cell lysis mixture, incubated at 30 ℃ on a shaker, and reacted for 1 hour with shaking at 180 rpm.
And secondly, taking 20 mu L of reaction liquid from each hole to a corresponding hole of the ELISA plate on the basis of the reaction in the first step, and then adding 180 mu L of colorimetric reaction liquid. The colorimetric reaction solution contains KPB (100mM, pH 7.5), 50U/mL MlADH and 0.8mM NAD+1mM PES and 2mM MTT, placed in a microplate reader, shaken for 5min, and then detected, and the absorbance value at 580nm is read. The first column in each deep-hole plate is used as a female parent, and the oleic acid hydratase mutant with the absorbance value obviously higher than that of the female parent is picked by taking the female parent as a reference, namely the preferable high-activity or high-stability mutant.
Example 2 construction of oleate hydratase mutants by semi-rational design
Performing homologous modeling on the oleic acid hydratase parent PaOH, performing molecular docking on the oleic acid hydratase parent PaOH and substrate molecules, and further performing site-directed saturated mutation on amino acids near a substrate pocket to improve the enzyme activity. Through Uniprot, NCBI BLAST and spatial structure modeling, in the steric structure of the oleic acid hydratase PaOH of the amino acid sequence shown in SEQ ID No.1 of the sequence listing, the amino acid residues around the binding site of the substrate oleic acid include: glycine at position 108, glutamic acid at position 110, asparagine at position 112, methionine at position 214, phenylalanine at position 233, cysteine at position 245, tryptophan at position 377, tryptophan at position 442, and phenylalanine at position 537. Site-directed saturation mutagenesis is carried out on the amino acid residues at the sites by adopting a site-directed saturation mutagenesis technology.
The primers used are shown in table 1:
TABLE 1 primer Table
Figure BDA0002750674730000091
Figure BDA0002750674730000101
Wherein N represents any one of four bases of A/T/C/G, K represents any one of two bases of G/T, and M represents any one of two bases of C/A. In single point saturation mutagenesis, NNK requires more than 90 clones to achieve 95% coverage.
Using pET28a-PaOH as a template, PCR amplification was performed using PrimeStar HS premix to construct a site-directed saturation mutation library. PCR System (20. mu.L): 2 XPrimeStar HS premix 10. mu.L, upstream and downstream primers (10. mu.M) 1. mu.L each, pET28a-PaOH plasmid 0.5ng, dimethyl sulfoxide 1. mu.L, make up to 20. mu.L with sterile distilled water. PCR reaction procedure: (1) pre-denaturation at 95 ℃ for 5 min; (2) denaturation at 94 ℃ for 30 s; (3) annealing at 55 ℃ for 30 s; (4) extending for 8min at 72 ℃; carrying out 15 cycles in all of the steps (2) to (4); finally, extension is carried out for 10min at 72 ℃, and the product is stored at 4 ℃. After the reaction, 1. mu.L of restriction enzyme Dpn I was added to 20. mu.L of PCR product, and the mixture was incubated at 37 ℃ for 2 hours to sufficiently digest and degrade the template, and the digested product was transformed into E.coli BL21(DE3) competent cells, spread evenly on LB agar plates containing 50. mu.g/mL kanamycin, and left to stand in a 37 ℃ incubator for about 12 hours. The obtained monoclonal colonies were picked up to 96-well deep-well plates for culture, the expressed proteins were screened for high-throughput activity according to the method described in example 1, the mutants with higher activity were purified and characterized, and the corresponding genes were sequenced.
The method for determining the activity of the oleic acid hydratase mutant comprises the following steps: the reaction was carried out in a 2mL round-bottom EP tube, and the enzyme solution was added to potassium phosphate buffer (100mM, pH 6.5) containing oleic acid as a substrate in an appropriate dilution, followed by reaction at 30 ℃ with shaking at 1,000rpm for 5min, and then 20. mu.L of sulfuric acid (20%, w/v) was added to terminate the reaction. Adding equal volume of ethyl acetate containing 2mM internal standard palmitic acid, shaking for extraction, and centrifuging at centrifugal force of 16,200 Xg for 2 min. mu.L of the upper organic phase was aspirated off by a pipette into a fresh EP tube and dried overnight with an appropriate amount of anhydrous sodium sulfate. Adding 40 μ L of the supernatant into a lining tube of a gas chromatography bottle, adding 40 μ L of methanol/diethyl ether (1:1) mixed solution and 20 μ L of trimethylsilylated diazomethane, keeping the temperature at 20-40 deg.C for 15min, performing gas chromatography, and detecting the contents of oleic acid as substrate and 10-hydroxystearic acid as product.
Mutant PaOH obtained by screening and finding replacement of phenylalanine at position 233 of oleic acid hydratase PaOH with leucineF233LThe stability and the activity of catalyzing the oil acid hydration reaction are improved.
Example 3 random mutagenesis to screen for improved stability of oleate hydratase mutants
Mutant PaOH as described in example 2F233LOn the basis, the error-prone PCR modification is carried out on the modified xylanase, so that the stability and the activity of the enzyme are further improved.
The primers used were:
the sequence of the upstream primer is as follows: gGAATTCATGAGCCCCAAGACCTCCAAACCC
The sequence of the downstream primer is as follows: CCGCTCGAGTCACTTGCGGGTCCTCTCTTTGA
Wherein the sequence underlined of the upstream primer is the restriction site of EcoR I, and the sequence underlined of the downstream primer is the restriction site of Xho I.
pET28a-PaOH is used as a template, and rTaq DNA polymerase is used for error-prone PCR to construct a random mutation library. PCR System (50. mu.L): rTaq DNA polymerase 0.5. mu.L, 10 XPCR buffer (Mg)2+Plus) 5.0. mu.L, dNTP mix (2.0 mM each) 4.0. mu.L, MnCl at a final concentration of 75. mu.M2pET28a-PaOH plasmid 0.5ng, 2. mu.L each of upstream and downstream primers (10. mu.M), and sterile distilled water was added to make up to 50. mu.L. PCR reaction procedure: (1) pre-denaturation at 95 ℃ for 5 min; (2) denaturation at 94 ℃ for 30 s; (3) annealing at 50 ℃ for 30 s; (4) extending for 2min at 72 ℃; carrying out 20 cycles in all of the steps (2) to (4); finally, extension is carried out for 10min at 72 ℃, and the product is stored at 4 ℃. And (3) carrying out agarose gel electrophoresis analysis and verification on the PCR product, then cutting, purifying and recovering the PCR product, and carrying out double digestion on the recovered target gene DNA fragment and the unloaded plasmid pET28a for 12h at 37 ℃ by using restriction enzymes EcoR I and Xho I respectively. The double restriction products are analyzed and verified by agarose gel electrophoresis, then the gel is cut, purified and recovered, and the obtained linearized pET28a plasmid and the purified target gene DNA fragment are placed at 16 ℃ for overnight connection by using T4 DNA ligase. Transformation of the ligation products into E.coliColi BL21(DE3) competent cells, and evenly spread on LB agar plates containing 50. mu.g/mL kanamycin, and placed in an incubator at 37 ℃ for static culture for about 12 hours. The obtained monoclonal colonies were picked up to 96-well deep-well plates for culture, high-throughput activity screening was performed on the expressed proteins according to the method described in example 1, mutants with higher activity and stability were purified and characterized, and the corresponding genes were sequenced.
Through screening, mutants with obviously improved oleic acid activity are obtained, and the heat stability of the mutants is further characterized, a series of mutants with improved heat stability is preferred, and the sequences of the mutants and the activity and stability of the mutants in catalyzing the oleic acid hydration reaction are listed in table 1. In table 1, the sequence numbers correspond to a series of sequences following table 1, respectively. In the activity column, a plus sign "+" indicates a 1-2 fold increase in the activity of the mutant protein towards oleic acid compared to the parent PaOH; the two plus signs "+" indicate that the activity of the mutant protein on oleic acid is increased by 2-3 times; three plus signs "+++" indicate that the activity of the mutant protein on oleic acid is increased 3-4 fold. In the thermostability column, a plus "+" corresponds to a residual activity of the mutant protein remaining 10.0-20.0% after incubation at 30 ℃ for 1 h; the two plus signs "+" correspond to a residual activity of the mutant protein remaining 20.1-30.0% after incubation for 1h at 30 ℃; three plus signs "+++" correspond to a residual activity of the mutant protein remaining 30.1-40.0% after incubation at 30 ℃ for 1 h.
Table 1: oleic acid hydratase mutant sequences and corresponding list of improved activities
Figure BDA0002750674730000121
The amino acid sequences of the oleic acid hydratase mutants corresponding to the sequence numbers are as follows:
(1) the 233 rd site phenylalanine of the amino acid sequence shown as SEQ ID No.2 is replaced by leucine;
(2) the phenylalanine at position 233 of the amino acid sequence shown in SEQ ID No.2 is replaced by leucine, and the phenylalanine at position 122 is replaced by leucine;
(3) the 233 rd phenylalanine and 622 nd glutamic acid of the amino acid sequence shown in SEQ ID No.2 are replaced by leucine and glycine respectively;
(4) substituting phenylalanine at position 233, phenylalanine at position 122, and threonine at position 15 of the amino acid sequence shown in SEQ ID No.2 with leucine;
(5) substituting phenylalanine at position 233, phenylalanine at position 122, and threonine at position 15 of the amino acid sequence shown in SEQ ID No.2 with leucine;
(6) replacing phenylalanine at position 233, phenylalanine at position 122, and threonine at position 15 of the amino acid sequence shown in SEQ ID No.2 with leucine, and asparagine;
(7) the phenylalanine at position 233, the phenylalanine at position 122 and the threonine at position 15 of the amino acid sequence shown in SEQ ID No.2 are replaced by leucine, leucine and glycine respectively;
(8) the phenylalanine at position 233, the phenylalanine at position 122 and the threonine at position 15 of the amino acid sequence shown in SEQ ID No.2 are replaced by leucine, leucine and cysteine respectively;
(9) substituting phenylalanine at position 233, phenylalanine at position 122, and threonine at position 15 of the amino acid sequence shown in SEQ ID No.2 with leucine, and isoleucine;
(10) replacing histidine at position 332 of the amino acid sequence shown as SEQ ID No.2 with tyrosine;
(11) the tyrosine at position 444 of the amino acid sequence shown as SEQ ID No.2 is replaced by phenylalanine, and the aspartic acid at position 451 is replaced by glutamic acid;
(12) replacing histidine at position 332 of the amino acid sequence shown as SEQ ID No.2 with tyrosine and aspartic acid at position 451 with threonine;
example 4 recombinant oleic acid hydratase mutant PaOHM6Expression and Activity measurement of
The recombinant large intestine rod expressing mutant M6 obtained in example 3 was usedColi BL21(DE3)/pET28a-PaOHM6Inoculating to LB medium containing 50. mu.g/mL kanamycin, shaking and culturing at 37 ℃ for 12 hours, inoculating to 500mL Erlenmeyer flask containing 100mL LB medium (containing 50. mu.g/mL kanamycin) in an amount of 1% (v/v), shaking and culturing at 37 ℃ and 180rpm, when OD of the culture solution is600When the concentration reached 0.6, IPTG was added as an inducer at a final concentration of 0.2mM, and induction was carried out at 16 ℃ for 24 hours. The culture solution was centrifuged at 8000 Xg for 10min, and the cells were collected and washed twice with physiological saline to obtain resting cells. The cells obtained in 100mL of the culture broth were suspended in 10mL of potassium phosphate buffer (100mM, pH 8.0), and subjected to ultrasonication in an ice-water bath as follows: the power is 400W, the work is 4s, the intermittence is 6s, 99 cycles are carried out, the centrifugation is carried out for 40 minutes at 12000 Xg at the temperature of 4 ℃, and the supernatant crude enzyme solution is collected, and the activity is 9.0U/mL; and (4) freeze-drying the crude enzyme solution to obtain crude enzyme powder with the activity of 1.9U/mg. In addition, the harvested cells were freeze-dried to obtain lyophilized cells with a viability of 0.5U/mg.
Example 5 PaOH and PaOHM6Comparison of catalytic Properties
To 0.5mL KPB (100mmol/L, pH 6.5) was added 0.1mg/mL PaOH pure enzyme or PaOHM6Pure enzyme, oleic acid was added to a final concentration of 10 g/L. The reaction was shaken at 1000rpm at 30 ℃ for 12 hours. After the reaction is finished, the pH value is adjusted to be below 2 by sulfuric acid (20 percent, w/v), 0.5mL of ethyl acetate (containing 2mM of internal standard palmitic acid) is added for extraction, the extraction is repeated for 3 times, the extracts are combined, a proper amount of anhydrous sodium sulfate is added for drying overnight, and the gas chromatographic analysis and determination result shows that the conversion rate of the maternal enzyme PaOH catalytic reaction is 40 percent, while the mutant PaOHM6The catalytic conversion was 99%.
The specific analysis conditions of the product were as follows: the analysis was performed using a gas chromatograph with Rxi-5Sil MS as the column, nitrogen as the carrier gas, the inlet and hydrogen flame detector temperatures both 280 deg.C, the initial column temperature 180 deg.C, and the 4 deg.C/min ramp-up to 250 deg.C. The sample introduction amount is 1 mu L, the split ratio is 25:1, and the constant pressure mode control is carried out. The retention time of oleic acid was 12.24min and that of 10-hydroxystearic acid was 16.34 min.
Example 6 PaOHM6Catalytic conversion of oleic acid to 10-hydroxy-hardFatty acid
The reaction was carried out in a 250mL three-necked flask, and the reaction system was 100mL, containing KPB buffer (100mM, pH 6.5), 10g oleic acid, 0.2g Tween-80, oleic acid and Tween-80, emulsified beforehand using a high pressure homogenizer, and then 0.5kU of oleic acid hydratase PaOH as described in example 4 was addedM6The reaction was carried out at 25 ℃ with stirring at 200rpm for 4 hours with a conversion of 99.5%.
Example 7 PaOHM6Catalytic conversion of oleic acid to 10-hydroxystearic acid
The reaction was carried out in a 250mL three-necked flask, and the reaction system was 100mL, containing KPB buffer (100mM, pH 6.5), 5g oleic acid, 0.2g Tween-80, oleic acid and Tween-80, emulsified beforehand using a high pressure homogenizer, and then 0.5kU of oleic acid hydratase PaOH as described in example 4 was addedM6The reaction was carried out at 40 ℃ with stirring at 200rpm for 2 hours with a conversion of 96.8%.
Example 8 PaOHM6Catalytic conversion of oleic acid to 10-hydroxystearic acid
The reaction was carried out in a 1L mechanically stirred tank reactor, the reaction system being 600ml, containing KPB buffer (100mM, pH 6.5), 30g oleic acid, 1.2g Tween-80, oleic acid and Tween-80, emulsified beforehand using a high pressure homogenizer, and then 1.5kU of oleic acid hydratase PaOH as described in example 4 was addedM6The crude enzyme solution of the supernatant was disrupted, and the reaction was carried out at 30 ℃ under stirring at 200rpm for 2 hours. Adjusting pH of the reaction solution to below 2 with concentrated hydrochloric acid, extracting with equal volume of ethyl acetate, repeating for 3 times, mixing extractive solutions, adding anhydrous sodium sulfate, drying, rotary evaporating to remove solvent, recrystallizing with methanol, and purifying to obtain 27.8g 10-hydroxystearic acid with purity of 99.0%.
Example 9 MlADH catalyzed conversion of 10-hydroxystearic acid to 10-carbonyl stearic acid
The reaction was carried out in a 250mL mechanically stirred tank reactor, the reaction system being 100mL, containing KPB buffer (100mM, pH 8.0), 5g of 10-hydroxystearic acid as described in example 8, 0.2g of Tween-80, 10-hydroxystearic acid and Tween-80, previously emulsified with high pressure homogenizer, followed by the addition of 0.5mM NAD+、0.4kU MlADH、2kU SmNOXVarAnd 2kU of catalase as a lyophilized enzyme powder, and 15% H was fed at a rate of 25. mu.L/min2O2The reaction of the second step was started, and the reaction was continued for 4 hours at 30 ℃ with stirring at 200rpm, with a conversion of 98.7%.
Example 10 PaOHM6Cascade catalysis of oleic acid conversion with MlADH to generate 10-carbonyl stearic acid
As shown in FIG. 1, the oleic acid hydratase mutant (PaOH) of the present invention was usedM6) And 10-hydroxystearic acid dehydrogenase (MlADH) cascade catalysis of the conversion of oleic acid to 10-carbonyl stearic acid.
The reaction was carried out in a 1L mechanically stirred tank reactor, the reaction system being 600ml, containing KPB buffer (100mM, pH 6.5), 30g oleic acid, 1.2g Tween-80, oleic acid and Tween-80, emulsified beforehand using a high pressure homogenizer, and then 1.5kU of oleic acid hydratase PaOH as described in example 4 was addedM6The reaction was carried out at 30 ℃ with stirring at 200rpm for 2 hours, and oleic acid was hydrated to give 10-hydroxystearic acid. Then NaOH solution was added to adjust the pH of the reaction system to 8.0, and 0.1mM NAD was added+、2.4kU MlADH、9kU SmNOXVarAnd 12kU of catalase as lyophilized enzyme powder, and 15% H was fed at a rate of 0.15mL/min2O2The reaction of the second step was started and continued for 4 hours. Adjusting pH of the reaction solution to below 2 with concentrated hydrochloric acid, extracting with equal volume of ethyl acetate, repeating for 3 times, mixing extractive solutions, adding anhydrous sodium sulfate, drying, rotary evaporating to remove solvent, recrystallizing with methanol, and purifying to obtain 25.3g 10-carbonyl stearic acid with purity of 99.0%.
The embodiments described above are described to facilitate an understanding and use of the invention by those skilled in the art. It will be readily apparent to those skilled in the art that various modifications to these embodiments may be made, and the generic principles described herein may be applied to other embodiments without the use of the inventive faculty. Therefore, the present invention is not limited to the above embodiments, and those skilled in the art should make improvements and modifications within the scope of the present invention based on the disclosure of the present invention.
Sequence listing
<110> university of east China's college of science
Suzhou Baifu enzyme technology Co., Ltd
<120> oleic acid hydratase mutant and application thereof in preparation of 10-hydroxystearic acid
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1965
<212> DNA
<213> Paracoccus aminophilus (Paracoccus aminophilius)
<400> 1
atgagcccca agacctccaa acccttccac gtcgagaacg acacgaccgc cggatattgg 60
tcaaatcgac cagaaaatac cctgcctgtg cccgatatga tgggcgctta tatgcgcaac 120
cacccctatc ccggcaacca ggtcgagggt cgcaaggcct ggatcattgg cagcggtatc 180
gccgggctgg cagcggcgtt ctacctgatc cgtgatggcg ggatgaaagg gcaagacatc 240
accattctgg atgcgctgga tgtcacgggc ggctcgctcg acggggctgg caatcccgag 300
gatggctata tcatccgcgg cggccgcgag atgaacttta attacgacaa cctttgggac 360
atgttccagg acgtgcaggc gctggagctg cccgagggct acagcgtgct cgacgagtat 420
cgccaactga acgatgccga tcccaactgg tcaaagtctc ggctgatgca caatcagggc 480
gagattcgcg atttctcaac cttcggcctg accaagccgc agcaatggga gctgatccgc 540
ctgctcttga agcgcaaaga ggatctcgat gatctgacca tcgaggatta tttcagcccc 600
ggcttcctgc agtcgaactt ttggttcctg tggcgctcga tgttcgcctt tgagaactgg 660
cagagcttgc tggagatgaa gctttatacc caccgctttc tcgattccat cgacgggttt 720
gcggatatgt cctgcctcgt tttcccgaag tataatcagc atgatacctt cgttaagccg 780
ctggtcgacc acctaaagaa gctcggcgtt caggtccagt tcgcgacccg tgtctctgat 840
ttggaaatga ccgaagacgc aggcaagcgc agtgtgacgg gcattctggc cagcgtgaac 900
ggtcaggaac accgcatccc agtcgatgaa aaggatgtgg tctttgcgct gaccggctcg 960
atgaccgagg gcaccgccta tggcgatatg gatcatgccc ccgtgatgga gcgcgggcgc 1020
tcggatccgg gaccagacag tgattgggct ttgtggcaaa acctcgccgc gaaatcgccg 1080
atctttggca atcccaagaa gttctatggc gatatcgaca agtcgatgtg ggaatccggc 1140
acgctgacgt gcaagccctc gcccctgact gaccggctga cagagctgtc ggtcaacgac 1200
ccctattccg gcaagaccgt gaccggcggc atcattacct tcaccgactc gaattgggtg 1260
atgagcgtga cctgtaaccg ccagccgcat ttcctcggcc agcccaagga tgttctggtg 1320
ctctgggtct atgcgctgct gatggacaag gatggcaaca aggtcaaaaa gcccatgccc 1380
gcctgcaccg ggcgcgagat tttggccgag ctgtgccatc atttgggcat tcccgacgat 1440
caattcgagg ccgtcgccgc gaagaccaag gtacggttgg cgttgatgcc ctatattacc 1500
tcgatgttca tgccgcgtgc caaaggtgac cgtccccatg tcgtgcccga gggctgcacg 1560
aacctcgcgc tgatgggcca gttcgtcgag acggcgaatg atatcgtctt caccatggat 1620
agctcgatcc gcacggcgcg cattggcgtc tatacgctgt tggggctgcg caagcaggtg 1680
cccgatatca gcccggtgca atatgatatc cgcaccttga tcaaggccgc ccgcacggtg 1740
aacaacaacc agcccttccc gggtgaacgc ctgctgcatc gtctcttggg aaagacctac 1800
tatgcccata tcctgccgcc gctgcccgat cgcacccaaa ccacccgcga cgctgccgag 1860
accgaactga aggcgtttct cggtactggc ggcactgctc tggcggccgt gggcggttgg 1920
ctgcaaaggg ttcgcgagga cctcaaagag aggacccgca agtga 1965
<210> 2
<211> 654
<212> PRT
<213> Paracoccus aminophilus (Paracoccus aminophilius)
<400> 2
Met Ser Pro Lys Thr Ser Lys Pro Phe His Val Glu Asn Asp Thr Thr
1 5 10 15
Ala Gly Tyr Trp Ser Asn Arg Pro Glu Asn Thr Leu Pro Val Pro Asp
20 25 30
Met Met Gly Ala Tyr Met Arg Asn His Pro Tyr Pro Gly Asn Gln Val
35 40 45
Glu Gly Arg Lys Ala Trp Ile Ile Gly Ser Gly Ile Ala Gly Leu Ala
50 55 60
Ala Ala Phe Tyr Leu Ile Arg Asp Gly Gly Met Lys Gly Gln Asp Ile
65 70 75 80
Thr Ile Leu Asp Ala Leu Asp Val Thr Gly Gly Ser Leu Asp Gly Ala
85 90 95
Gly Asn Pro Glu Asp Gly Tyr Ile Ile Arg Gly Gly Arg Glu Met Asn
100 105 110
Phe Asn Tyr Asp Asn Leu Trp Asp Met Phe Gln Asp Val Gln Ala Leu
115 120 125
Glu Leu Pro Glu Gly Tyr Ser Val Leu Asp Glu Tyr Arg Gln Leu Asn
130 135 140
Asp Ala Asp Pro Asn Trp Ser Lys Ser Arg Leu Met His Asn Gln Gly
145 150 155 160
Glu Ile Arg Asp Phe Ser Thr Phe Gly Leu Thr Lys Pro Gln Gln Trp
165 170 175
Glu Leu Ile Arg Leu Leu Leu Lys Arg Lys Glu Asp Leu Asp Asp Leu
180 185 190
Thr Ile Glu Asp Tyr Phe Ser Pro Gly Phe Leu Gln Ser Asn Phe Trp
195 200 205
Phe Leu Trp Arg Ser Met Phe Ala Phe Glu Asn Trp Gln Ser Leu Leu
210 215 220
Glu Met Lys Leu Tyr Thr His Arg Phe Leu Asp Ser Ile Asp Gly Phe
225 230 235 240
Ala Asp Met Ser Cys Leu Val Phe Pro Lys Tyr Asn Gln His Asp Thr
245 250 255
Phe Val Lys Pro Leu Val Asp His Leu Lys Lys Leu Gly Val Gln Val
260 265 270
Gln Phe Ala Thr Arg Val Ser Asp Leu Glu Met Thr Glu Asp Ala Gly
275 280 285
Lys Arg Ser Val Thr Gly Ile Leu Ala Ser Val Asn Gly Gln Glu His
290 295 300
Arg Ile Pro Val Asp Glu Lys Asp Val Val Phe Ala Leu Thr Gly Ser
305 310 315 320
Met Thr Glu Gly Thr Ala Tyr Gly Asp Met Asp His Ala Pro Val Met
325 330 335
Glu Arg Gly Arg Ser Asp Pro Gly Pro Asp Ser Asp Trp Ala Leu Trp
340 345 350
Gln Asn Leu Ala Ala Lys Ser Pro Ile Phe Gly Asn Pro Lys Lys Phe
355 360 365
Tyr Gly Asp Ile Asp Lys Ser Met Trp Glu Ser Gly Thr Leu Thr Cys
370 375 380
Lys Pro Ser Pro Leu Thr Asp Arg Leu Thr Glu Leu Ser Val Asn Asp
385 390 395 400
Pro Tyr Ser Gly Lys Thr Val Thr Gly Gly Ile Ile Thr Phe Thr Asp
405 410 415
Ser Asn Trp Val Met Ser Val Thr Cys Asn Arg Gln Pro His Phe Leu
420 425 430
Gly Gln Pro Lys Asp Val Leu Val Leu Trp Val Tyr Ala Leu Leu Met
435 440 445
Asp Lys Asp Gly Asn Lys Val Lys Lys Pro Met Pro Ala Cys Thr Gly
450 455 460
Arg Glu Ile Leu Ala Glu Leu Cys His His Leu Gly Ile Pro Asp Asp
465 470 475 480
Gln Phe Glu Ala Val Ala Ala Lys Thr Lys Val Arg Leu Ala Leu Met
485 490 495
Pro Tyr Ile Thr Ser Met Phe Met Pro Arg Ala Lys Gly Asp Arg Pro
500 505 510
His Val Val Pro Glu Gly Cys Thr Asn Leu Ala Leu Met Gly Gln Phe
515 520 525
Val Glu Thr Ala Asn Asp Ile Val Phe Thr Met Asp Ser Ser Ile Arg
530 535 540
Thr Ala Arg Ile Gly Val Tyr Thr Leu Leu Gly Leu Arg Lys Gln Val
545 550 555 560
Pro Asp Ile Ser Pro Val Gln Tyr Asp Ile Arg Thr Leu Ile Lys Ala
565 570 575
Ala Arg Thr Val Asn Asn Asn Gln Pro Phe Pro Gly Glu Arg Leu Leu
580 585 590
His Arg Leu Leu Gly Lys Thr Tyr Tyr Ala His Ile Leu Pro Pro Leu
595 600 605
Pro Asp Arg Thr Gln Thr Thr Arg Asp Ala Ala Glu Thr Glu Leu Lys
610 615 620
Ala Phe Leu Gly Thr Gly Gly Thr Ala Leu Ala Ala Val Gly Gly Trp
625 630 635 640
Leu Gln Arg Val Arg Glu Asp Leu Lys Glu Arg Thr Arg Lys
645 650
<210> 3
<211> 310
<212> PRT
<213> Micrococcus luteus
<400> 3
Met Ser Glu Phe Thr Arg Phe Glu Gln Val Thr Val Leu Gly Thr Gly
1 5 10 15
Val Leu Gly Ser Gln Ile Ile Met Gln Ala Ala Tyr His Gly Lys Lys
20 25 30
Val Met Ala Tyr Asp Ala Val Pro Ala Ala Leu Glu Asn Leu Asp Lys
35 40 45
Arg Trp Ala Trp Ile Arg Gln Gly Tyr Glu Ala Asp Leu Gly Glu Gly
50 55 60
Tyr Asp Ala Ala Arg Phe Asp Glu Ala Ile Ala Arg Ile Thr Pro Thr
65 70 75 80
Ser Asp Leu Ala Glu Ala Val Ala Asp Ala Asp Ile Val Ile Glu Ala
85 90 95
Val Pro Glu Asn Leu Glu Leu Lys Arg Lys Val Trp Ala Gln Val Gly
100 105 110
Glu Leu Ala Pro Ala Thr Thr Leu Phe Ala Thr Asn Thr Ser Ser Leu
115 120 125
Leu Pro Ser Asp Phe Ala Asp Ala Ser Gly His Pro Glu Arg Phe Leu
130 135 140
Ala Leu His Tyr Ala Asn Arg Ile Trp Ala Gln Asn Thr Ala Glu Val
145 150 155 160
Met Gly Thr Ala Ala Thr Ser Pro Glu Ala Val Ala Gly Ala Leu Gln
165 170 175
Phe Ala Glu Glu Thr Gly Met Val Pro Val His Val Arg Lys Glu Ile
180 185 190
Pro Gly Tyr Phe Leu Asn Ser Leu Leu Ile Pro Trp Leu Gln Ala Gly
195 200 205
Ser Lys Leu Tyr Met His Gly Val Gly Asn Pro Ala Asp Ile Asp Arg
210 215 220
Thr Trp Arg Val Ala Thr Gly Asn Glu Arg Gly Pro Phe Gln Thr Tyr
225 230 235 240
Asp Ile Val Gly Phe His Val Ala Ala Asn Val Ser Arg Asn Thr Gly
245 250 255
Val Asp Trp Gln Leu Gly Phe Ala Glu Met Leu Glu Lys Ser Ile Ala
260 265 270
Glu Gly His Ser Gly Val Ala Asp Gly Gln Gly Phe Tyr Arg Tyr Gly
275 280 285
Pro Asp Gly Glu Asn Leu Gly Pro Val Glu Asp Trp Asn Leu Gly Asp
290 295 300
Lys Asp Thr Pro Leu Gly
305 310
<210> 4
<211> 457
<212> PRT
<213> Streptococcus mutans (Streptococcus mutans)
<400> 4
Met Ser Lys Ile Val Ile Val Gly Ala Asn His Ala Gly Thr Ala Ala
1 5 10 15
Ile Asn Thr Val Leu Asp Asn Tyr Gly Ser Glu Asn Glu Val Val Val
20 25 30
Phe Asp Gln Asn Ser Asn Ile Ser Phe Leu Gly Cys Gly Met Ala Leu
35 40 45
Trp Ile Gly Lys Gln Ile Ser Gly Pro Gln Gly Leu Phe Tyr Ala Asp
50 55 60
Lys Glu Ser Leu Glu Ala Lys Gly Ala Lys Ile Tyr Met Glu Ser Pro
65 70 75 80
Val Thr Ala Ile Asp Tyr Asp Ala Lys Arg Val Thr Ala Leu Val Asn
85 90 95
Gly Gln Glu His Val Glu Ser Tyr Glu Lys Leu Ile Leu Ala Thr Gly
100 105 110
Ser Thr Pro Ile Leu Pro Pro Ile Lys Gly Ala Ala Ile Lys Glu Gly
115 120 125
Ser Arg Asp Phe Glu Ala Thr Leu Lys Asn Leu Gln Phe Val Lys Leu
130 135 140
Tyr Gln Asn Ala Glu Asp Val Ile Asn Lys Leu Gln Asp Lys Thr Gln
145 150 155 160
Asn Leu Asn Arg Ile Ala Val Val Gly Ala Gly Tyr Ile Gly Val Glu
165 170 175
Leu Ala Glu Ala Phe Lys Arg Leu Gly Lys Glu Val Ile Leu Ile Asp
180 185 190
Arg His Asp Thr Cys Leu Ala Gly Tyr Tyr Asp Gln Asp Leu Ser Glu
195 200 205
Met Met Arg Gln Asn Leu Glu Asp His Gly Ile Glu Leu Ala Phe Gly
210 215 220
Glu Thr Val Lys Ala Ile Glu Gly Asp Gly Lys Val Glu Arg Ile Val
225 230 235 240
Thr Asp Lys Ala Ser His Asp Val Asp Met Val Ile Leu Ala Val Gly
245 250 255
Phe Arg Pro Asn Thr Ala Leu Gly Asn Ala Lys Leu Lys Thr Phe Arg
260 265 270
Asn Gly Ala Phe Leu Val Asp Lys Lys Gln Glu Thr Ser Ile Pro Asp
275 280 285
Val Tyr Ala Ile Gly Asp Cys Ala Thr Val Tyr Asp Asn Ala Ile Asn
290 295 300
Asp Thr Asn Tyr Ile Ala Leu Ala Ser Asn Ala Leu Arg Ser Gly Ile
305 310 315 320
Val Ala Gly His Asn Ala Ala Gly His Lys Leu Glu Ser Leu Gly Val
325 330 335
Gln Gly Ser Asn Gly Ile Ser Ile Phe Gly Leu Asn Met Val Ser Thr
340 345 350
Gly Leu Thr Gln Glu Lys Ala Lys Arg Phe Gly Tyr Asn Pro Glu Val
355 360 365
Thr Ala Phe Thr Asp Phe Gln Lys Ala Ser Phe Ile Glu His Asp Asn
370 375 380
Tyr Pro Val Thr Leu Lys Ile Val Tyr Asp Lys Asp Ser Arg Leu Val
385 390 395 400
Leu Gly Ala Gln Met Ala Ser Lys Glu Asp Met Ser Met Gly Ile His
405 410 415
Met Phe Ser Leu Ala Ile Gln Glu Lys Val Thr Ile Glu Arg Leu Ala
420 425 430
Leu Leu Asp Tyr Phe Phe Leu Pro His Phe Asn Gln Pro Tyr Asn Tyr
435 440 445
Met Ile Lys Ala Ala Leu Lys Ala Lys
450 455

Claims (10)

1. An oleic acid hydratase mutant which is a protein consisting of any one of the following amino acid sequences:
(1) the 233 rd site phenylalanine of the amino acid sequence shown as SEQ ID No.2 is replaced by leucine;
(2) the phenylalanine at position 233 of the amino acid sequence shown in SEQ ID No.2 is replaced by leucine, and the phenylalanine at position 122 is replaced by leucine;
(3) the 233 rd phenylalanine and 622 nd glutamic acid of the amino acid sequence shown in SEQ ID No.2 are replaced by leucine and glycine respectively;
(4) substituting phenylalanine at position 233, phenylalanine at position 122, and threonine at position 15 of the amino acid sequence shown in SEQ ID No.2 with leucine;
(5) substituting phenylalanine at position 233, phenylalanine at position 122, and threonine at position 15 of the amino acid sequence shown in SEQ ID No.2 with leucine;
(6) replacing phenylalanine at position 233, phenylalanine at position 122, and threonine at position 15 of the amino acid sequence shown in SEQ ID No.2 with leucine, and asparagine;
(7) the phenylalanine at position 233, the phenylalanine at position 122 and the threonine at position 15 of the amino acid sequence shown in SEQ ID No.2 are replaced by leucine, leucine and glycine respectively;
(8) the phenylalanine at position 233, the phenylalanine at position 122 and the threonine at position 15 of the amino acid sequence shown in SEQ ID No.2 are replaced by leucine, leucine and cysteine respectively;
(9) substituting phenylalanine at position 233, phenylalanine at position 122, and threonine at position 15 of the amino acid sequence shown in SEQ ID No.2 with leucine, and isoleucine;
(10) replacing histidine at position 332 of the amino acid sequence shown as SEQ ID No.2 with tyrosine;
(11) the tyrosine at position 444 of the amino acid sequence shown as SEQ ID No.2 is replaced by phenylalanine, and the aspartic acid at position 451 is replaced by glutamic acid;
(12) the amino acid sequence shown in SEQ ID No.2 has the amino acid sequence with tyrosine substituted at position 332 and threonine substituted at position 451.
2. An isolated nucleic acid encoding the oleic acid hydratase mutant of claim 1.
3. A recombinant expression vector comprising the nucleic acid of claim 2.
4. A recombinant expression transformant comprising the recombinant expression vector according to claim 3.
5. A recombinant oleic acid hydratase mutant catalyst which is in any one of the following forms:
(1) culturing the recombinant expression transformant according to claim 4, and isolating a transformant cell containing the oleic acid hydratase mutant according to claim 1;
(2) culturing the recombinant expression transformant according to claim 4, and isolating a crude enzyme solution containing the oleic acid hydratase mutant according to claim 1;
(3) culturing the recombinant expression transformant according to claim 4, isolating a crude enzyme solution containing the oleic acid hydratase mutant according to claim 1, and drying the crude enzyme solution to obtain a crude enzyme powder.
6. Use of an oleic acid hydratase mutant according to claim 1 or a recombinant oleic acid hydratase mutant catalyst according to claim 5 in the preparation of 10-carbonyl stearic acid comprising the steps of:
(1) catalyzing the hydration reaction of the substrate oleic acid to produce 10-hydroxystearic acid using the oleic acid hydratase mutant of claim 1 or the recombinant oleic acid hydratase mutant catalyst of claim 5.
7. Use of an oleic acid hydratase mutant according to claim 1 or a recombinant oleic acid hydratase mutant catalyst according to claim 5 in the preparation of 10-carbonyl stearic acid comprising the steps of:
(1) catalyzing the hydration reaction of the substrate oleic acid to produce 10-hydroxystearic acid using the oleic acid hydratase mutant of claim 1 or the recombinant oleic acid hydratase mutant catalyst of claim 5;
(2) and (2) catalyzing the reaction product 10-hydroxystearic acid in the step (1) to be oxidized into 10-carbonyl stearic acid by using 10-hydroxystearic acid dehydrogenase with an amino acid sequence shown as SEQ ID No. 3.
8. Use according to claim 7, characterized in that: coenzyme NAD is required for the reaction of catalyzing the oxidation of 10-hydroxystearic acid to 10-carbonyl stearic acid by 10-hydroxystearic acid dehydrogenase+In the course of the reaction, NAD+Converting to NADH, coupling the reaction with oxygen reduction reaction catalyzed by NADH oxidase to oxidize coenzyme NADH to regenerate NAD+；
Preferably, the coenzyme NAD+The concentration of (A) is 0.1-0.5 mM;
preferably, the oxygen is obtained by catalase-catalyzed decomposition of hydrogen peroxide.
9. The use according to claim 7, wherein in step (2) the oxidation of 10-hydroxystearic acid to 10-carbonyl stearic acid is catalyzed by a 10-hydroxystearic acid dehydrogenase having an amino acid sequence as shown in SEQ ID No.3, wherein the NAD (P) H oxidase SmNOX is addedVarCatalase, hydrogen peroxide and coenzyme NAD+；
Preferably, the NAD (P) H oxidase is derived from a mutant of Streptococcus mutans (Streptococcus mutans), named SmNOXVarThe amino acid sequence is shown in SEQ ID No. 4.
10. Use according to claim 7, characterized in that:
the steps (1) and (2) are carried out step by step, after the step (1) is finished, the product 10-hydroxystearic acid is extracted by a conventional method, and then the reaction of the step (2) is carried out, so that the 10-hydroxystearic acid is oxidized to generate 10-carbonyl stearic acid; or the like, or, alternatively,
the steps (1) and (2) are carried out in series, after the step (1) is finished, the pH of the reaction liquid is adjusted to a required range, and then the reaction of the step (2) is carried out to oxidize the 10-hydroxystearic acid to generate the 10-carbonyl stearic acid.
CN202011182795.4A 2020-10-29 2020-10-29 Oleic acid hydratase mutant and application thereof in preparation of 10-hydroxystearic acid Active CN112226428B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202011182795.4A CN112226428B (en) 2020-10-29 2020-10-29 Oleic acid hydratase mutant and application thereof in preparation of 10-hydroxystearic acid

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202011182795.4A CN112226428B (en) 2020-10-29 2020-10-29 Oleic acid hydratase mutant and application thereof in preparation of 10-hydroxystearic acid

Publications (2)

Publication Number Publication Date
CN112226428A true CN112226428A (en) 2021-01-15
CN112226428B CN112226428B (en) 2022-11-08

Family

ID=74122402

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202011182795.4A Active CN112226428B (en) 2020-10-29 2020-10-29 Oleic acid hydratase mutant and application thereof in preparation of 10-hydroxystearic acid

Country Status (1)

Country Link
CN (1) CN112226428B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114752576A (en) * 2022-04-06 2022-07-15 鲁东大学 Catalase mutant and application thereof

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2813575A1 (en) * 2013-06-14 2014-12-17 Evonik Industries AG Method for the preparation of organic compounds from oxyhydrogen and CO2 using acetoacetyl-CoA as an intermediate product
CN104704124A (en) * 2012-09-07 2015-06-10 巴斯夫欧洲公司 Process for preparing sebacic acid
CN110004133A (en) * 2019-04-18 2019-07-12 华东理工大学 Oleate hydratase and its application in 10 hydroxy stearic acid is synthesized with 10- carbonyl stearic acid
US20200270646A1 (en) * 2017-09-29 2020-08-27 Technische Universität München A process for the cell-free enzymatic production of 10-hydroxystearic acid (10-hsa) from bio-based oils for lubricant formulation

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104704124A (en) * 2012-09-07 2015-06-10 巴斯夫欧洲公司 Process for preparing sebacic acid
EP2813575A1 (en) * 2013-06-14 2014-12-17 Evonik Industries AG Method for the preparation of organic compounds from oxyhydrogen and CO2 using acetoacetyl-CoA as an intermediate product
US20200270646A1 (en) * 2017-09-29 2020-08-27 Technische Universität München A process for the cell-free enzymatic production of 10-hydroxystearic acid (10-hsa) from bio-based oils for lubricant formulation
CN110004133A (en) * 2019-04-18 2019-07-12 华东理工大学 Oleate hydratase and its application in 10 hydroxy stearic acid is synthesized with 10- carbonyl stearic acid

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
JENQ-KUEN HUANG ET AL.: ""Knockout of secondary alcohol dehydrogenase in Nocardia cholesterolicum NRRL 5767 by CRISPR/Cas9 genome editing technology"", 《PLOS ONE》 *
JING ZHANG ET AL.: ""Sustainable Biotransformation of Oleic Acid to 10-Hydroxystearic Acid by a Recombinant Oleate Hydratase from Lactococcus garvieae"", 《PROCESSES》 *
KIL,K.S. ET AL.: ""oleate hydratase [Paracoccus aminophilus]，NCBI Reference Sequence:WP_020951013.1"", 《GENPEPT》 *
QI-FAN SUN ET AL.: ""Engineering of an oleate hydratase for efficient C10-Functionalization of oleic acid"", 《BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114752576A (en) * 2022-04-06 2022-07-15 鲁东大学 Catalase mutant and application thereof
CN114752576B (en) * 2022-04-06 2023-04-28 鲁东大学 Catalase mutant and application thereof

Also Published As

Publication number Publication date
CN112226428B (en) 2022-11-08

Similar Documents

Publication Publication Date Title
CN108546691B (en) 7 β -hydroxysteroid dehydrogenase mutant and application thereof in preparation of ursodeoxycholic acid
CN110387360B (en) Hydroxysteroid dehydrogenase and application thereof in synthesis of ursodeoxycholic acid precursor
CN110573605B (en) Slow rhizobium monooxygenase and application thereof in preparation of chiral sulfoxide
CN113462665B (en) 7 alpha-HSDH enzyme mutant and coding gene and application thereof
CN114854707A (en) 7 beta-hydroxysteroid dehydrogenase mutant
CN117778342B (en) Carbonyl reductase mutant and application thereof in synthesis of 11 beta-hydroxy steroid compounds
CN112226428B (en) Oleic acid hydratase mutant and application thereof in preparation of 10-hydroxystearic acid
CN113430181B (en) Bacterial laccase derived from Asian elephant intestinal metagenome and gene thereof
CN113652408A (en) Carbonyl reductase mutant and application thereof in synthesis of (R) -4-chloro-3-hydroxybutyric acid ethyl ester
CN109706189B (en) Preparation method of D-chiro-inositol
WO2024002131A1 (en) Engineered microorganism for efficiently expressing d-psicose 3-epimerase and use thereof
CN111593030B (en) Chemically tolerant glucose dehydrogenase mutants and their use in coenzyme regeneration
CN111454918B (en) Enol reductase mutant and application thereof in preparation of (R) -citronellal
CN106957812B (en) Construction and application of cytochrome P450 enzyme and electron transfer system engineering bacteria thereof
CN110257312B (en) Recombinant gene engineering bacterium and application thereof in producing vanillin by fermentation
CN110004133B (en) Oleic acid hydratase and application thereof in synthesis of 10-hydroxystearic acid and 10-carbonyl stearic acid
CN114686451A (en) Amine dehydrogenase mutant and application thereof in preparation of (S) -5-methyl-2-pyrrolidone
CN110846288B (en) Glutathione bifunctional enzyme mutant and application thereof
CN112300971B (en) Method for improving carbon monoxide utilization rate of clostridium aerovorans by high-throughput gene synthesis
CN110872595B (en) Acid-resistant expression cassette and application thereof in fermentation production of organic acid
CN109897872B (en) Enzymatic preparation of (2S, 3S) -N-t-butoxycarbonyl-3-amino-1-chloro-2-hydroxy-4-phenylbutane
CN106047826B (en) Aldehyde dehydrogenase, its recombinant expression transformants and the application in the synthesis of statin precursor
CN118726285A (en) Alkene reductase mutant, nucleic acid, recombinant expression vector and application thereof
CN113201511B (en) (R) -5-carbonyl decanoate (ester) reductase mutant and application thereof in preparation of (R) -gamma/delta-lactone
CN118126972B (en) Carbonyl reductase mutant and preparation method and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
TR01 Transfer of patent right

Effective date of registration: 20240417

Address after: Room 207, No. 8, Sihai Road Research Institute Road, Changshu Economic and Technological Development Zone, Suzhou City, Jiangsu Province

Patentee after: SUZHOU BAIFU ENZYME TECHNOLOGY CO.,LTD.

Country or region after: China

Address before: 200237 No. 130, Meilong Road, Shanghai, Xuhui District

Patentee before: EAST CHINA University OF SCIENCE AND TECHNOLOGY

Country or region before: China

Patentee before: SUZHOU BAIFU ENZYME TECHNOLOGY CO.,LTD.

TR01 Transfer of patent right