CN112210568A - Ph-like acute lymphoblastic leukemia fusion gene and application and detection kit thereof - Google Patents

Abstract

The invention provides a Ph-like acute lymphoblastic leukemia fusion gene, application thereof and a detection kit, wherein the fusion gene is TPR-PDGFRB. According to the invention, the existence of a new fusion gene TPR-PDGFRB in acute lymphocytic leukemia is firstly discovered and identified, and the TPR-PDGFRB is considered to be a specific molecular marker of the acute lymphocytic leukemia through evaluation, so that a kit which can be clinically used for diagnosing and detecting Minimal Residual Disease (MRD) of a patient is developed. The kit carries out absolute quantification on the TPR-PDGFRB fusion gene in a leukemia patient by using Taqman probe real-time fluorescent PCR, has good detection specificity, high sensitivity, simple, convenient and efficient method and low cost, and can meet the clinical diagnosis and treatment requirements.

Description

Ph-like acute lymphoblastic leukemia fusion gene and application and detection kit thereof

Technical Field

The invention relates to the technical field of biomedicine, in particular to a Ph-like acute lymphoblastic leukemia fusion gene and application thereof and a detection kit.

Background

Ph-like Acute Lymphoblastic Leukemia (Philadelphia chromosome-like Acute Lymphoblastic Leukemia) is an Acute Lymphoblastic Leukemia (ALL) discovered in recent years, accounts for about 20% of ALLs, and has short patient survival and poor clinical prognosis. 80% of Ph-like ALL patients have molecular genetic abnormality of fusion genes, so that the detection of the Ph-like ALL-related fusion genes has important clinical significance for disease diagnosis, treatment scheme formulation, treatment effect evaluation, prognosis evaluation and disease recurrence monitoring.

Disclosure of Invention

The first purpose of the invention is to provide a Ph-like acute lymphoblastic leukemia fusion gene.

The second purpose of the invention is to provide the application of the fusion gene in preparing a kit for diagnosing or monitoring Ph-like acute lymphoblastic leukemia.

The third purpose of the invention is to provide a kit for detecting Ph-like acute lymphoblastic leukemia fusion genes.

The fourth objective of the invention is to provide a method for detecting the TPR-PDGFRB fusion gene for non-disease diagnosis.

In order to achieve the first object, the present invention provides a Ph-like acute lymphoblastic leukemia fusion gene, wherein the fusion gene is TPR-PDGFRB.

As a preferred scheme, the fusion gene sequence is shown as SEQ ID NO. 1.

In order to achieve the second object, the invention provides an application of the fusion gene in preparing a kit for diagnosing or monitoring Ph-like acute lymphoblastic leukemia. Part of Ph-like acute lymphoblastic leukemia patients carry fusion genes TPR-PDGFRB which can be used as patient-specific molecular markers and applied to clinical diagnosis and periodic monitoring of tiny residual lesions of the patients.

In order to realize the third purpose, the invention provides a kit for detecting a Ph-like acute lymphoblastic leukemia fusion gene, which comprises an upstream primer, a downstream primer, a Taqman probe, an internal reference, a PCR reaction buffer solution, a positive control and a negative control;

the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 2;

the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 3;

the nucleotide sequence of the Taqman probe is shown in SEQ ID NO. 4.

Preferably, the 5 'end of the Taqman probe is labeled with FAM group, and the 3' end of the probe is labeled with BHQ group. When the target DNA molecule does not exist in the sample to be detected, the fluorescence of the FAM is quenched by BHQ and does not emit fluorescence; when the target DNA molecule exists in the sample to be detected, the probe is combined with the target DNA molecule, and then the probe is degraded by the 5'→ 3' double-strand exonuclease activity of Taq enzyme to release the fluorescent group FAM, so that fluorescence is emitted.

As a preferred scheme, the internal reference comprises an internal reference upstream primer, an internal reference downstream primer and an internal reference probe;

the nucleotide sequence of the internal reference upstream primer is shown as SEQ ID NO. 5;

the nucleotide sequence of the internal reference downstream primer is shown as SEQ ID NO. 6;

the nucleotide sequence of the internal reference probe is shown as SEQ ID NO. 7.

The 5 'end of the probe of the internal reference gene ABL can be marked with FAM group, the 3' end of the probe can be marked with TAMRA group, the FAM group is a report group, and the TAMRA group is a quenching group.

The PCR reaction buffer is a common buffer in the art, and generally comprises a cDNA first strand synthesis reagent (ReverTra Ace qPCR RT Kit, TOYOBO) and a real-time fluorescent PCR mixture (THUNDERBIRD qPCR MIX, TOYOBO, QPS-101), and the main components of the PCR reaction buffer comprise DNA polymerase, Mg2+, dNTP, reverse transcriptase and DTT.

The positive control contains a plasmid standard with TPR-PDGFRB fusion gene and a plasmid with ABL gene. The negative control contained deionized water and cDNA from 10 healthy bone marrow donors.

In order to achieve the fourth object, the present invention provides a method for detecting a TPR-PDGFRB fusion gene for non-disease diagnosis purposes, comprising the steps of:

(1) extracting total RNA in a human blood sample, and inverting the RNA into cDNA serving as a sample to be detected;

(2) preparing PCR reaction liquid, and then respectively adding a sample to be detected, a positive control and a negative control;

(3) detecting on a real-time fluorescent PCR instrument, wherein the reaction conditions are as follows: pre-denaturation at 95 ℃ for 1 min; reacting at 95 ℃ for 15s and 58 ℃ for 35s for 40 cycles, and collecting fluorescence signals at 56 ℃ for 35 s;

the PCR reaction solution comprises an upstream primer, a downstream primer, a Taqman probe, an internal reference, a PCR reaction buffer solution, a positive control and a negative control, wherein the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 2;

the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 3;

the nucleotide sequence of the Taqman probe is shown in SEQ ID NO. 4.

The conditions for detecting the establishment of the experimental result are as follows: if no target gene amplification signal curve exists, the result is negative when the internal reference, the positive control and the negative control are detected normally; if the target gene amplification signal curve and the internal reference, positive control and negative control detection are normal, the result is positive. If the internal reference, the positive control and the negative control are abnormal, the reason needs to be found out, and the detection is carried out again after adjustment.

The invention discovers and verifies that part of Ph-like ALL patients carry new fusion genes TPR-PDGFRB, and then develops a fusion gene detection and quantification kit combining real-time fluorescence PCR and Taqman probe technology. The real-time fluorescence PCR result is expressed by Ct value, has the advantages of good specificity, high sensitivity, simple operation, more visual result and the like, and is the preferred method for detecting trace fusion genes at present, so the kit adopts Taqman probe real-time fluorescence PCR to detect TPR-PDGFRB fusion genes and monitors MRD of a patient.

The invention has the advantages that (1) the fusion gene TPR-PDGFRB carried by the Ph-like ALL patient is screened and identified by applying bioinformatics technology, so that the fusion gene TPR-PDGFRB is proved to be a novel fusion gene which is not reported so far, and can be used as a molecular marker of the patient to be applied to clinical diagnosis, selection of a proper treatment scheme and periodic monitoring of MRD of the patient.

(2) The TPR-PDGFRB fusion gene detection kit has the following advantages: the accuracy is high: and meanwhile, the probe and the primer are used for dual control, so that the specificity is good, and the false positive is low. ② the specificity is strong: the fusion gene sequence was recognized using a specific probe. ③ monitoring in the whole process: and monitoring the whole-course amplification signal in real time. Fourthly, safety, convenience and convenience are achieved: the operation is simple and safe, the automation degree is high, and the pollution is prevented. Fast: the detection time is 100 min.

(3) The invention adopts the real-time fluorescence PCR technology and the Taqman probe to detect the expression conditions of the TPR-PDGFRB fusion gene and the internal reference gene ABL in a tested person, can distinguish low-abundance gene signals from a complex background, and has great application potential in the monitoring of patient diagnosis, treatment scheme adjustment, treatment effect evaluation, prognosis prediction and clinical relapse prevention.

Drawings

FIG. 1 shows FISH and PCR verification of TPR-PDGFRB fusion gene. A: the translocation of the 1q31.1 region and the 5q3 region resulted in the graphical display of the TPR-PDGFRB fusion gene; b: PCR validation of the fusion gene in patient initial, recurrent and control samples; c: a sanger sequencing result chart of a PCR verification product of a patient carrying the fusion gene confirms the fusion of the TPR exon 46 and the PDGFRB exon 11; d: fluorescence In Situ Hybridization (FISH) experiments were performed on metaphase blast cells of patients using the PDGFRB Break Apart probe, and the appearance of fused chromosomes is indicated by red arrows.

FIG. 2 shows the construction result of the plasmid standard of TPR-PDGFRB fusion gene. A: fusing gene standard quality particle maps; b: and (3) detecting a sequencing result of a standard plasmid sanger by the fusion gene.

FIG. 3 is a graphical representation of the results of TPR-PDGFRB detection using the kit of the invention. A-B: TPR-PDGFRB standard curve, positive sample and negative control; c: 10 independent controls of ALL (blue for internal control, red for TPR-PDGFRB); d: TPR-PDGFRB positive patients are treated for changes in the level of mRNA.

Detailed Description

Hereinafter, the technique of the present invention will be described in detail with reference to specific embodiments. It should be understood that the following detailed description is only for the purpose of assisting those skilled in the art in understanding the present invention, and is not intended to limit the present invention.

Example 1 Ph-like ALL patients carry a TPR-PDGFRB New fusion Gene

(1) The bioinformatics technology is applied to screening fusion genes of 50 ALL patients, and new TPR-PDGFRB fusion genes which are not reported in 3 authoritative fusion gene resource libraries and literatures are discovered.

(2) The TPR-PDGFRB new fusion gene is formed by splicing the 1 st to 46 th exons of the TPR gene and the 10 th to 23 th exons of PDGFRB, and the specific CDS sequence is shown as SEQ ID NO. 1.

(3) Fluorescence In Situ Hybridization (FISH) and PCR are respectively applied, sanger sequencing is carried out on PCR products, Western blot experiment is carried out, the Ph-like ALL patient in the example is confirmed to carry TPR-PDGFRB new fusion genes, and the verification result is shown in figure 1.

(4) Selecting a proper plasmid, cloning a section of sequence containing the fusion breakpoint into the plasmid, selecting a positive clone from the plasmids, carrying out PCR amplification and sanger sequencing, and verifying the correctness of the sequence transferred into the plasmid, thereby obtaining a standard substance (figure 2).

(5) Primers and probes for detecting the internal reference/target gene are designed, and the real-time fluorescence PCR technology is adopted to detect the expression condition of the fusion gene of the internal reference gene ABL1 and TPR-PDGFRB. The kit can ensure that the amplification efficiency and the amplification rate are both optimal by adjusting the primer probe ratio of the internal reference/target gene and the PCR reaction conditions.

Example 2 preparation of the kit

1. Design of specific primers and probes

Specific probes and primers were designed based on the Gene sequences (ABL1 Gene sequence, TPR Gene sequence, PDGFRB Gene sequence all from the nucleic acid database of the national center for Biotechnology information, ABL1 Gene Entrez Gene ID, Gene reference sequence NM-005157.5, TPR Gene Entrez Gene ID 7175, Gene reference sequence NM-003292.3, PDGFRB Gene Entrez Gene ID 5159, Gene reference sequence NM-002609.4).

2. Reagent kit component dispensing system

First strand cDNA Synthesis reagents: ReverTra Ace qPCR RT Kit (TOYOBO Co.), detection System PCR reaction solution: THUNDERBIRD qPCR MIX (TOYOBO, QPS-101), whose main components comprise DNA polymerase, Mg2+, dNTP, reverse transcriptase, DTT.

Primers and probes: the method comprises the following steps of detecting TPR-PDGFRB fusion genes, internal reference ABL primers and probes corresponding to the primers:

TPR-PDGFRB-F:CAAATACCAGTGGGAAT(SEQ ID NO.2)

TPR-PDGFRB-R:TCACCTTCCATCGGATCTCGTAA(SEQ ID NO.3)

TPR-PDGFRB-Probe:

FAM-TGCCAAAGCATGATGAGGATGATAAGGGAG-BHQ(SEQ ID NO.4)

ABL1-F:CTAAAGGTGAAAAGCTCCG(SEQ ID NO.5)

ABL1-R:GACTGTTGACTGGCGTGAT(SEQ ID NO.6)

ABL1-Probe:FAM-CCATTTTTGGTTTGGGCTTCACACCATT-TAMRA(SEQ ID NO.7)。

positive control: comprises a plasmid standard substance with TPR-PDGFRB fusion gene and a plasmid with ABL gene; negative control: deionized water and cDNA from 10 healthy bone marrow donors.

Example 3 protocol for testing ALL patient samples with the kit

1. Taking the anticoagulated blood sample of the ALL patient to be detected, extracting total RNA in blood: 1ml of erythrocyte lysate is added into a clean centrifugal tube with 1.5ml, and 0.5ml of anticoagulation blood is taken and mixed evenly. Standing at room temperature for 10 min; centrifuging at 5000rpm for 5min, discarding supernatant, and collecting cells at bottom; adding 0.5ml of erythrocyte lysate again, centrifuging at 5000rpm for 5min, discarding the supernatant, and collecting the cells at the bottom; adding 1ml of TRIzol into the cells, repeatedly blowing and beating until the precipitate is completely dissolved, and standing for 5min at room temperature; adding 0.2ml of chloroform, and shaking uniformly; centrifuging at 14000rpm and 4 ℃ for 10min, sucking the supernatant and transferring to another new centrifuge tube; adding isopropanol with the same volume, mixing thoroughly, standing at room temperature for 10 min; centrifuging at 14000rpm and 4 ℃ for 10min, removing the supernatant, adding 1ml of 75% ethanol, and slightly reversing the upper part and the lower part to wash the tube wall; centrifuging at 14000rpm and 4 ℃ for 5min, and removing ethanol; drying at room temperature for 10-15min, adding 20 μ l RNase-free water to dissolve the precipitate.

2. RNA was inverted to cDNA by referring to the Rever Tra Ace qPCR RT Kit instructions from TOYOBO.

3. Reagent preparation: preparing each X mu l of PCR reaction liquid of a detection system according to the parts of detected people, and subpackaging 23 mu l of reaction liquid X (n parts of specimen, 1 part of positive control, 1 part of negative control and 1 part of blank control) each part of 23 mu l, wherein each 23 mu l comprises the following components:

4. sample adding: adding 2 mul cDNA into PCR reaction liquid of a detection system; directly adding 2 mul of positive control substance and negative control substance into the positive control substance and the negative control substance; blank control was supplemented with 2. mu.l of physiological saline or nothing.

5. And (3) detection: the detection was performed on a real-time fluorescent PCR instrument, and available instruments include ABI7300, 7500 (Applied Biosystems, USA), and the like. Reaction conditions are as follows: pre-denaturation at 95 ℃ for 1 min; the reaction was carried out at 95 ℃ for 15s and at 58 ℃ for 35s for 40 cycles, and the fluorescence signal was collected at 56 ℃ for 35 s.

6. And (5) judging a result: if no target gene amplification signal curve exists, the result is negative when the internal reference, the positive control and the negative control are detected normally; if the target gene amplification signal curve and the internal reference, positive control and negative control detection are normal, the result is positive. If the internal reference, the positive control and the negative control are abnormal, the reason needs to be found out, and the detection is carried out again after adjustment. FIGS. 3A-B show a standard curve, positive sample and negative control for TPR-PDGFRB detection; FIG. 3C shows an unrelated control of 10 ALLs (blue for internal control, red for TPR-PDGFRB);

7. TPR-PDGFRB can be used as a molecular marker specific to Ph-like ALL patients: we performed MRD monitoring on 8 time node samples of a clinical treatment of one example of TPR-PDGFRB positive patient using the detection kit constructed above (fig. 3D). We found that (1) the patient had a high level of TPR-PDGFRB expression at the initial onset (20.02), and that the TPR-PDGFRB expression decreased as the clinical administration induced the chemotherapeutic disease into remission (20.03); (2) soon, the patient has relapse (20.04), the expression level of the TPR-PDGFRB is obviously increased, and at the moment, the induced chemotherapy + Tyrosine Kinase Inhibitor (TKI) dasatinib is given again for treatment, the reduction of the expression level of the TPR-PDGFRB is monitored (20.05), and the expression level is continuously maintained at a low level (20.05-20.09) within 4 months, so that the disease of the patient gradually reaches molecular remission, the chance of bone marrow transplantation can be obtained again, and the risk of relapse still needs to be monitored in real time. The results show that TRP-PDGFRB can be used as a novel molecular marker of a patient to monitor MRD, and the accuracy and reliability of the kit are proved.

The results show that the kit can detect samples quickly and accurately with high flux, has good specificity and repeatability, and can effectively avoid false positive and false negative results. The foregoing is only a preferred embodiment of the present invention, and it should be noted that modifications can be made by those skilled in the art without departing from the principle of the present invention, and these modifications should also be construed as the protection scope of the present invention.

SEQUENCE LISTING

<110> university of Dalian medical university affiliated second Hospital

<120> Ph-like acute lymphoblastic leukemia fusion gene and application and detection kit thereof

<130> /

<160> 7

<170> PatentIn version 3.5

<210> 1

<211> 8310

<212> DNA

<213> Artificial sequence

<400> 1

atggcggcgg tgttgcagca agtcctggag cgcacggagc tgaacaagct gcccaagtct 60

gtccagaaca aacttgaaaa gttccttgct gatcagcaat ccgagatcga tggcctgaag 120

gggcggcatg agaaatttaa ggtggagagc gaacaacagt attttgaaat agaaaagagg 180

ttgtcccaca gtcaggagag acttgtgaat gaaacccgag agtgtcaaag cttgcggctt 240

gagctagaga aactcaacaa tcaactgaag gcactaactg agaaaaacaa agaacttgaa 300

attgctcagg atcgcaatat tgccattcag agccaattta caagaacaaa ggaagaatta 360

gaagctgaga aaagagactt aattagaacc aatgagagac tatctcaaga acttgaatac 420

ttaacagagg atgttaaacg tctgaatgaa aaacttaaag aaagcaatac aacaaagggt 480

gaacttcagt taaaattgga tgaacttcaa gcttctgatg tttctgttaa gtatcgagaa 540

aaacgcttgg agcaagaaaa ggaattgcta catagtcaga atacatggct gaatacagag 600

ttgaaaacca aaactgatga acttctggct cttggaagag aaaaagggaa tgagattcta 660

gagcttaaat gtaatcttga aaataaaaaa gaagaggttt ctagactgga agaacaaatg 720

aatggcttaa aaacatcaaa tgaacatctt caaaagcatg tggaggatct gttgaccaaa 780

ttaaaagagg ccaaggaaca acaggccagt atggaagaga aattccacaa tgaattaaat 840

gcccacataa aactttctaa tttgtacaag agtgccgctg atgactcaga agcaaagagc 900

aatgaactaa cccgggcagt agaggaacta cacaaacttt tgaaagaagc tggtgaagcc 960

aacaaagcaa tacaagatca tcttctagag gtggagcaat ccaaagatca aatggaaaaa 1020

gaaatgcttg agaaaatagg gagattggag aaggaattag agaatgcaaa tgaccttctt 1080

tctgccacaa aacgtaaagg agccatattg tctgaagaag agcttgccgc catgtctcct 1140

actgcagcag ctgtagctaa gatagtgaaa cctgggatga aactaactga gctctataat 1200

gcttatgtgg aaactcagga tcagttgctt ttggagaaac tagagaacaa aagaattaat 1260

aagtacctag atgaaatagt gaaagaagtg gaagccaaag caccaatttt gaaacgccag 1320

cgtgaggaat atgaacgtgc acagaaagct gtagcaagtt tatctgttaa gcttgaacaa 1380

gctatgaagg agattcagcg attgcaggag gacactgata aagccaacaa gcaatcatct 1440

gtacttgaga gagataatcg aagaatggaa atacaagtaa aagatctttc acaacagatt 1500

agagtgcttt tgatggaact tgaagaagca aggggtaacc acgtaattcg tgatgaggaa 1560

gtaagctctg ctgatataag tagttcatct gaggtaatat cacagcatct agtatcttac 1620

agaaatattg aagagcttca acaacaaaat caacgtctct tagtggccct tagagagctt 1680

ggggaaacca gagaaagaga agaacaagaa acaacttcat ccaaaatcac tgagcttcag 1740

ctcaaacttg agagtgccct tactgaacta gaacaactcc gcaaatcacg acagcatcaa 1800

atgcagcttg ttgattccat agttcgtcag cgtgatatgt accgtatttt attgtcacaa 1860

acaacaggag ttgccattcc attacatgct tcaagcttag atgatgtttc tcttgcatca 1920

actccaaaac gtccaagtac atcacagact gtttccactc ctgctccagt acctgttatt 1980

gaatcaacag aggctataga ggctaaggct gcccttaaac agttgcagga aatttttgag 2040

aactacaaaa aagaaaaagc agaaaatgaa aaaatacaaa atgagcagct tgagaaactt 2100

caagaacaag ttacagattt gcgatcacaa aataccaaaa tttctaccca gctagatttt 2160

gcttctaaac gttatgaaat gctgcaagat aatgttgaag gatatcgtcg agaaataaca 2220

tcacttcatg agagaaatca gaaactcact gccacaactc aaaagcaaga acagattatc 2280

aatacgatga ctcaagattt gagaggagca aatgagaagc tagctgtcgc agaagtaaga 2340

gcagaaaatt tgaagaagga aaaggaaatg cttaaattgt ctgaagttcg tctttctcag 2400

caaagagagt ctttgttagc tgaacaaagg gggcaaaact tactgctaac taatctgcaa 2460

acaattcagg gaatactgga gcgatctgaa acagaaacca aacaaaggct tagtagccag 2520

atagaaaaac tggaacatga gatctctcat ctaaagaaga agttggaaaa tgaggtggaa 2580

caaaggcata cacttactag aaatctagat gttcaacttt tagatacaaa gagacaactg 2640

gatacagaga caaatcttca tcttaacaca aaagaactat taaaaaatgc tcaaaaagaa 2700

attgccacat tgaaacagca cctcagtaat atggaagtcc aagttgcttc tcagtcttca 2760

cagagaactg gtaaaggtca gcctagcaac aaagaagatg tggatgatct tgtgagtcag 2820

ctaagacaga cagaagagca ggtgaatgac ttaaaggaga gactcaaaac aagtacgagc 2880

aatgtggaac aatatcaagc aatggttact agtttagaag aatccctgaa caaggaaaaa 2940

caggtgacag aagaagtgcg taagaatatt gaagttcgtt taaaagagtc agctgaattt 3000

cagacacagt tggaaaagaa gttgatggaa gtagagaagg aaaaacaaga acttcaggat 3060

gataaaagaa gagccataga gagcatggaa caacagttat ctgaattgaa gaaaacactt 3120

tctagtgttc agaatgaagt acaagaagct cttcagagag caagcacagc tttaagtaat 3180

gagcagcaag ccagacgtga ctgtcaggaa caagctaaaa tagctgtgga agctcagaat 3240

aagtatgaga gagaattgat gctgcatgct gctgatgttg aagctctaca agctgcgaag 3300

gagcaggttt caaaaatggc atcagtccgt cagcatttgg aagaaacaac acagaaagca 3360

gaatcacagt tgttggagtg taaagcatct tgggaggaaa gagagagaat gttaaaggat 3420

gaagtttcca aatgtgtatg tcgctgtgaa gatctggaga aacaaaacag attacttcat 3480

gatcagatcg aaaaattaag tgacaaggtc gttgcctctg tgaaggaagg tgtacaaggt 3540

ccactgaatg tatctctcag tgaagaagga aaatctcaag aacaaatttt ggaaattctc 3600

agatttatac gacgagaaaa agaaattgct gaaactaggt ttgaggtggc tcaggttgag 3660

agtctgcgtt atcgacaaag ggttgaactt ttagaaagag agctgcagga actgcaagat 3720

agtctaaatg ctgaaaggga gaaagtccag gtaactgcaa aaacaatggc tcagcatgaa 3780

gaactgatga agaaaactga aacaatgaat gtagttatgg agaccaataa aatgctaaga 3840

gaagagaagg agagactaga acaggatcta cagcaaatgc aagcaaaggt gaggaaactg 3900

gagttagata ttttaccctt acaagaagca aatgctgagc tgagtgagaa aagcggtatg 3960

ttgcaggcag agaagaagct cttagaagag gatgtcaaac gttggaaagc acgtaaccag 4020

catctagtaa gtcaacagaa agatccagat acagaagaat atcggaagct cctttctgaa 4080

aaggaagttc atactaagcg tattcaacaa ttgacagaag aaattggtag acttaaagct 4140

gaaattgcaa gatcaaatgc atctttgact aacaaccaga acttaattca gagtctgaag 4200

gaagatctaa ataaagtaag aactgaaaag gaaaccatcc agaaggactt agatgccaaa 4260

ataattgata tccaagaaaa agtcaaaact attactcaag ttaagaaaat tggacgtagg 4320

tacaagactc aatatgaaga acttaaagca caacaggata aggttatgga gacatcggct 4380

cagtcctctg gagaccatca ggagcagcat gtttcagtcc aggaaatgca ggaactcaaa 4440

gaaacgctca accaagctga aacaaaatca aaatcacttg aaagtcaagt agagaatctg 4500

cagaagacat tatctgaaaa agagacagaa gcaagaaatc tccaggaaca gactgtgcaa 4560

cttcagtctg aactttcacg acttcgtcag gatcttcaag atagaaccac acaggaggag 4620

cagctccgac aacagataac tgaaaaggaa gaaaaaacca gaaaggctat tgtagcagca 4680

aagtcaaaaa ttgcacactt agctggtgta aaagatcagc taactaaaga aaatgaggag 4740

cttaaacaaa ggaatggagc cttagatcag cagaaagatg aattggatgt tcgcattact 4800

gcgctaaagt cccaatatga aggtcgaatt agtcgcttgg aaagagaact cagggagcat 4860

caagagagac accttgagca gagagatgag cctcaagaac cttctaataa ggtccctgaa 4920

cagcagagac agatcacatt gaaaacaact ccagcttctg gtgaaagagg aattgccagc 4980

acatcagacc caccaacagc caatatcaag ccaactcctg ttgtgtctac tccaagtaaa 5040

gtgacagctg cagctatggc tggaaataag tcaacaccca gggctagtat ccgcccaatg 5100

gttacacctg caactgttac aaatcccact actaccccaa cagctacagt gatgcccact 5160

acacaagtgg aatcacagga agctatgcag tcagaagggc ctgtggaaca tgttccagtt 5220

tttggaagca caagtggatc cgttcgttct actagtccta atgtccagcc ttctatctct 5280

caacctattt taactgttca gcaacaaaca caggctacag cttttgtgca acccactcaa 5340

cagagtcatc ctcagattga gcctgccaat caagagttat cttcaaacat agtagaggtt 5400

gttcagagtt caccagttga gcggccttct acttccacag cagtatttgg cacagtttcg 5460

gctaccccca gttcttcttt gccaaagcgt acacgtgaag aggaagagga tagcaccata 5520

gaagcatcag accaagtctc tgatgataca gtggaaatgc ctcttccaaa gaagttgaaa 5580

agtgtcacac ctgtaggaac tgaggaagaa gttatggcag aagaaagtac tgatggagag 5640

gtagagactc aggtatacaa ccaggattct caagattcca ttggagaagg agttacccag 5700

ggagattata cacctatgga agacagtgaa gaaacctctc agtctctaca aatagatctt 5760

gggccacttc aatcagatca gcagacgaca acttcatccc aggatggtca aggcaaagga 5820

gatgatgtca ttgtaattga cagtgatgat gaagaagagg atgatgatga aaatgatgga 5880

gaacatgagg attatgaaga ggatgaggaa gatgatgatg atgatgaaga tgacacaggg 5940

atgggagatg agggtgaaga tagtaatgaa ggaactggta gtgccgatgg caatgatggt 6000

tatgaagctg atgatgctga gggtggtgat gggactgatc caggtacaga aacagaagaa 6060

agtatgggtg gaggtgaagg taatcacaga gctgctgatt ctcaaaacag tggtgaagga 6120

aatacaggtg ctgcagaatc ttctttttct caggaggttt ctagagaaca acagccatca 6180

tcagcatctg aaagacaggc ccctcgagca cctcagtcac cgagacgccc accacatcca 6240

cttcccccaa gactgaccat tcatgcccca cctcaggagt tgggaccacc agttcagaga 6300

attcagatga cccgaaggca gtctgtagga cgtggccttc agttgactcc aggaataggt 6360

ggcatgcaac agcatttttt tgatgatgaa gacagaacag ttccaagtac tccaactctt 6420

gtggtgccac atcgtactga tggatttgct gaagcaattc attcgccgca ggttgctggt 6480

gtccctagat tccggtttgg gccacctgaa gatatgccac aaacaagttc tagtcactct 6540

gatcttggcc agcttgcttc tcaaggagcc ttgcccttta aggtggtggt gatctcagcc 6600

atcctggccc tggtggtgct caccatcatc tcccttatca tcctcatcat gctttggcag 6660

aagaagccac gttacgagat ccgatggaag gtgattgagt ctgtgagctc tgacggccat 6720

gagtacatct acgtggaccc catgcagctg ccctatgact ccacgtggga gctgccgcgg 6780

gaccagcttg tgctgggacg caccctcggc tctggggcct ttgggcaggt ggtggaggcc 6840

acggctcatg gcctgagcca ttctcaggcc acgatgaaag tggccgtcaa gatgcttaaa 6900

tccacagccc gcagcagtga gaagcaagcc cttatgtcgg agctgaagat catgagtcac 6960

cttgggcccc acctgaacgt ggtcaacctg ttgggggcct gcaccaaagg aggacccatc 7020

tatatcatca ctgagtactg ccgctacgga gacctggtgg actacctgca ccgcaacaaa 7080

cacaccttcc tgcagcacca ctccgacaag cgccgcccgc ccagcgcgga gctctacagc 7140

aatgctctgc ccgttgggct ccccctgccc agccatgtgt ccttgaccgg ggagagcgac 7200

ggtggctaca tggacatgag caaggacgag tcggtggact atgtgcccat gctggacatg 7260

aaaggagacg tcaaatatgc agacatcgag tcctccaact acatggcccc ttacgataac 7320

tacgttccct ctgcccctga gaggacctgc cgagcaactt tgatcaacga gtctccagtg 7380

ctaagctaca tggacctcgt gggcttcagc taccaggtgg ccaatggcat ggagtttctg 7440

gcctccaaga actgcgtcca cagagacctg gcggctagga acgtgctcat ctgtgaaggc 7500

aagctggtca agatctgtga ctttggcctg gctcgagaca tcatgcggga ctcgaattac 7560

atctccaaag gcagcacctt tttgccttta aagtggatgg ctccggagag catcttcaac 7620

agcctctaca ccaccctgag cgacgtgtgg tccttcggga tcctgctctg ggagatcttc 7680

accttgggtg gcacccctta cccagagctg cccatgaacg agcagttcta caatgccatc 7740

aaacggggtt accgcatggc ccagcctgcc catgcctccg acgagatcta tgagatcatg 7800

cagaagtgct gggaagagaa gtttgagatt cggcccccct tctcccagct ggtgctgctt 7860

ctcgagagac tgttgggcga aggttacaaa aagaagtacc agcaggtgga tgaggagttt 7920

ctgaggagtg accacccagc catccttcgg tcccaggccc gcttgcctgg gttccatggc 7980

ctccgatctc ccctggacac cagctccgtc ctctatactg ccgtgcagcc caatgagggt 8040

gacaacgact atatcatccc cctgcctgac cccaaacccg aggttgctga cgagggccca 8100

ctggagggtt cccccagcct agccagctcc accctgaatg aagtcaacac ctcctcaacc 8160

atctcctgtg acagccccct ggagccccag gacgaaccag agccagagcc ccagcttgag 8220

ctccaggtgg agccggagcc agagctggaa cagttgccgg attcggggtg ccctgcgcct 8280

cgggcggaag cagaggatag cttcctgtag 8310

<210> 2

<211> 17

<212> DNA

<213> Artificial sequence

<400> 2

caaataccag tgggaat 17

<210> 3

<211> 23

<212> DNA

<213> Artificial sequence

<400> 3

tcaccttcca tcggatctcg taa 23

<210> 4

<211> 30

<212> DNA

<213> Artificial sequence

<400> 4

tgccaaagca tgatgaggat gataagggag 30

<210> 5

<211> 19

<212> DNA

<213> Artificial sequence

<400> 5

ctaaaggtga aaagctccg 19

<210> 6

<211> 19

<212> DNA

<213> Artificial sequence

<400> 6

gactgttgac tggcgtgat 19

<210> 7

<211> 28

<212> DNA

<213> Artificial sequence

<400> 7

ccatttttgg tttgggcttc acaccatt 28

Claims (7)

1. A Ph-like acute lymphoblastic leukemia fusion gene, wherein the fusion gene is TPR-PDGFRB.

2. The Ph-like acute lymphoblastic leukemia fusion gene according to claim 1, wherein the fusion gene sequence is shown as SEQ ID No. 1.

3. Use of the fusion gene according to claim 1 or 2 in the preparation of a kit for the diagnosis or monitoring of Ph-like acute lymphoblastic leukemia.

4. A kit for detecting the Ph-like acute lymphoblastic leukemia fusion gene according to claim 1 or 2, wherein the kit comprises an upstream primer, a downstream primer, a Taqman probe, an internal reference, a PCR reaction buffer, a positive control and a negative control;

the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 2;

the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 3;

the nucleotide sequence of the Taqman probe is shown in SEQ ID NO. 4.

5. The kit for detecting the Ph-like acute lymphoblastic leukemia fusion gene according to claim 4, wherein the 5 'end of the Taqman probe is marked with FAM group, and the 3' end of the probe is marked with BHQ group.

6. The kit for detecting the Ph-like acute lymphoblastic leukemia fusion gene according to claim 4, wherein the internal reference comprises an internal reference upstream primer, an internal reference downstream primer and an internal reference probe;

the nucleotide sequence of the internal reference upstream primer is shown as SEQ ID NO. 5;

the nucleotide sequence of the internal reference downstream primer is shown as SEQ ID NO. 6;

the nucleotide sequence of the internal reference probe is shown as SEQ ID NO. 7.

7. A method for detecting a TPR-PDGFRB fusion gene for non-disease diagnostic purposes comprising the steps of:

(1) extracting total RNA in a human blood sample, and inverting the RNA into cDNA serving as a sample to be detected;

(2) preparing PCR reaction liquid, and then respectively adding a sample to be detected, a positive control and a negative control;

(3) detecting on a real-time fluorescent PCR instrument, wherein the reaction conditions are as follows: pre-denaturation at 95 ℃ for 1 min; reacting at 95 ℃ for 15s and 58 ℃ for 35s for 40 cycles, and collecting fluorescence signals at 56 ℃ for 35 s;

the PCR reaction solution comprises an upstream primer, a downstream primer, a Taqman probe, an internal reference, a PCR reaction buffer solution, a positive control and a negative control, wherein the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 2;

the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 3;

the nucleotide sequence of the Taqman probe is shown in SEQ ID NO. 4.

Images