CN112195277B

CN112195277B - Primer probe set and kit for detecting human papilloma virus based on real-time fluorescent quantitative PCR

Info

Publication number: CN112195277B
Application number: CN202011180080.5A
Authority: CN
Inventors: 冯艳芳; 柳辉; 郑文果; 毕少辉
Original assignee: Beijing Kangmei Tianhong Biotechnology Co ltd
Current assignee: Beijing Kangmei Tianhong Biotechnology Co ltd
Priority date: 2020-10-29
Filing date: 2020-10-29
Publication date: 2022-07-26
Anticipated expiration: 2040-10-29
Also published as: CN112195277A

Abstract

The invention discloses a primer probe group and a kit for detecting human papilloma virus based on real-time fluorescent quantitative PCR. The invention provides a primer probe combination, which comprises a primer probe shown in a sequence 1 to a sequence 54 of a sequence table. The primer probe combination has the following functions (b1), (b2), (b3), (b4), (b5) and (b 6): (b1) detecting whether the subject is a HPV-infected subject; (b2) screening for HPV infected persons; (b3) typing HPV infected by the HPV infected person; (b4) detecting whether the subject is a high-risk type HPV infected person; (b5) screening high-risk HPV infectors; (b6) typing the HPV infected by the high-risk type HPV infectors. The kit has strong specificity and high detectable rate, is suitable for screening and judging high-risk HPV carriers, and is beneficial to prevention and control of the high-risk HPV.

Description

Primer probe set and kit for detecting human papilloma virus based on real-time fluorescent quantitative PCR

Technical Field

The invention belongs to the technical field of biology, and relates to a primer probe set and a kit for detecting human papilloma virus based on real-time fluorescent quantitative PCR.

Background

Human Papillomavirus (HPV) belongs to the family of papillomaviruses, and is a small-molecule, non-envelope-coated circular double-stranded DNA virus, the genome length of which is about 8000 base pairs (bp). HPV infects humans by direct or indirect contact with contaminated articles or by sexual transmission. The virus not only has host specificity, but also has tissue specificity, and can only infect skin and mucosal epithelial cells of human, causing various papilloma or wart of human skin and reproductive tract epithelial hyperplastic injury.

Persistent high-risk HPV infection is the leading cause of cervical intraepithelial neoplasia and cervical cancer. Results of studies on a global scale show that the presence of high-risk HPV DNA is detected in 99.7% of cervical cancer patients, with 80% of HPV16, 18, 45 and 31 infections. According to research results of WHO International cancer research Institute (IARC) and other international organizations, HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59 and HPV68 are high-risk types, and HPV26, HPV53, HPV66, HPV73 and HPV82 are medium-risk types. Herein, "high risk HPV" refers to HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV68, HPV26, HPV53, HPV66, HPV73 and HPV 82.

Disclosure of Invention

The invention aims to provide a primer probe set and a kit for detecting human papilloma virus based on real-time fluorescent quantitative PCR.

The invention provides a primer probe combination, which comprises the following 18 primer probe groups:

the primer probe group for detecting HPV16 consists of a primer HPV-16-F shown in a sequence 1 of a sequence table, a primer HPV-16-R shown in a sequence 2 of the sequence table and a probe HPV-16-P shown in a sequence 3 of the sequence table;

the primer probe group for detecting the HPV56 consists of a primer HPV-56-F shown in a sequence 4 of a sequence table, a primer HPV-56-R shown in a sequence 5 of the sequence table and a probe HPV-56-P shown in a sequence 6 of the sequence table;

the primer probe group for detecting the HPV31 consists of a primer HPV-31-F shown in a sequence 7 of a sequence table, a primer HPV-31-R shown in a sequence 8 of the sequence table and a probe HPV-31-P shown in a sequence 9 of the sequence table;

the primer probe group for detecting HPV18 consists of a primer HPV-18-F shown in a sequence 10 in a sequence table, a primer HPV-18-R shown in a sequence 11 in the sequence table and a probe HPV-18-P shown in a sequence 12 in the sequence table;

the primer probe group for detecting HPV52 consists of a primer HPV-52-F shown in a sequence 13 of a sequence table, a primer HPV-52-R shown in a sequence 14 of the sequence table and a probe HPV-52-P shown in a sequence 15 of the sequence table;

the primer probe group for detecting the HPV58 consists of a primer HPV-58-F shown in a sequence 16 of a sequence table, a primer HPV-58-R shown in a sequence 17 of the sequence table and a probe HPV-58-P shown in a sequence 18 of the sequence table;

the primer probe group for detecting HPV68 consists of a primer HPV-68-F shown in a sequence 19 of a sequence table, a primer HPV-68-R shown in a sequence 20 of the sequence table and a probe HPV-68-P shown in a sequence 21 of the sequence table;

the primer probe group for detecting the HPV45 consists of a primer HPV-45-F shown in a sequence 22 of a sequence table, a primer HPV-45-R shown in a sequence 23 of the sequence table and a probe HPV-45-P shown in a sequence 24 of the sequence table;

the primer probe group for detecting HPV82 consists of a primer HPV-82-F shown in a sequence 25 of a sequence table, a primer HPV-82-R shown in a sequence 26 of the sequence table and a probe HPV-82-P shown in a sequence 27 of the sequence table;

the primer probe group for detecting the HPV33 consists of a primer HPV-33-F shown in a sequence 28 in a sequence table, a primer HPV-33-R shown in a sequence 29 in the sequence table and a probe HPV-33-P shown in a sequence 30 in the sequence table;

the primer probe group for detecting HPV35 consists of a primer HPV-35-F shown in a sequence 31 of a sequence table, a primer HPV-35-R shown in a sequence 32 of the sequence table and a probe HPV-35-P shown in a sequence 33 of the sequence table;

the primer probe group for detecting HPV39 consists of a primer HPV-39-F shown in a sequence 34 of a sequence table, a primer HPV-39-R shown in a sequence 35 of the sequence table and a probe HPV-39-P shown in a sequence 36 of the sequence table;

the primer probe group for detecting HPV51 consists of a primer HPV-51-F shown in a sequence 37 of a sequence table, a primer HPV-51-R shown in a sequence 38 of the sequence table and a probe HPV-51-P shown in a sequence 39 of the sequence table;

the primer probe group for detecting HPV59 consists of a primer HPV-59-F shown in a sequence 40 of a sequence table, a primer HPV-59-R shown in a sequence 41 of the sequence table and a probe HPV-59-P shown in a sequence 42 of the sequence table;

the primer probe group for detecting HPV66 consists of a primer HPV-66-F shown in a sequence 43 of a sequence table, a primer HPV-66-R shown in a sequence 44 of the sequence table and a probe HPV-66-P shown in a sequence 45 of the sequence table;

the primer probe group for detecting HPV26 consists of a primer HPV-26-F shown in a sequence 46 of a sequence table, a primer HPV-26-R shown in a sequence 47 of the sequence table and a probe HPV-26-P shown in a sequence 48 of the sequence table;

the primer probe group for detecting HPV53 consists of a primer HPV-53-F shown in a sequence 49 in a sequence table, a primer HPV-53-R shown in a sequence 50 in the sequence table and a probe HPV-53-P shown in a sequence 51 in the sequence table;

the primer probe group for detecting HPV73 consists of a primer HPV-73-F shown in a sequence 52 of a sequence table, a primer HPV-73-R shown in a sequence 53 of the sequence table and a probe HPV-73-P shown in a sequence 54 of the sequence table.

The primer probe combination consists of the 18 primer probe groups.

The primer probe combination also comprises a primer probe group for detecting an internal reference gene; the primer probe set for detecting the reference gene consists of a primer GAPDH-F shown in a sequence 55 of a sequence table, a primer GAPDH-R shown in a sequence 56 of the sequence table and a probe GAPDH-P shown in a sequence 57 of the sequence table.

The primer probe combination consists of the 18 primer probe sets and the primer probe set for detecting the reference gene.

The primer probe combination consists of the following 5 combinations:

a combination of a primer probe set for detecting HPV16, a primer probe set for detecting HPV56, a primer probe set for detecting HPV31, and a primer probe set for detecting an internal reference gene;

a combination of a primer probe set for detecting HPV18, a primer probe set for detecting HPV52, a primer probe set for detecting HPV58, and a primer probe set for detecting HPV 68;

a combination of a primer probe set for detecting HPV45, a primer probe set for detecting HPV82, a primer probe set for detecting HPV33, and a primer probe set for detecting HPV 35;

a combination of primer probe sets for detecting HPV39, for detecting HPV51, for detecting HPV59, and for detecting HPV 66;

a combination of primer probe sets for detecting HPV26, HPV53, and HPV 73;

in each combination, different probes employ different fluorophores.

Any one of the primers is a single-stranded DNA molecule.

Any of the probes is a single-stranded DNA molecule.

In any of the probes, one end has a fluorescent reporter group, and the other end has a quencher group.

Any of the probes has a fluorescent reporter group at the 5 'end and a quencher group at the 3' end.

Fluorescent reporter groups include, but are not limited to, any of FAM, ROX, CY5, HEX, JOE, CY3, NED, TAMRA, TAXAS RED, VIC, and TET. Quenching groups include, but are not limited to, any of BHQ1, TAMRA, MGB, and DABCYL.

The 5 'end of the probe HPV-16-P is provided with a fluorescent reporter FAM, and the 3' end is provided with a quenching group BHQ 1.

The 5 'end of the probe HPV-56-P is provided with a fluorescent reporter group HEX, and the 3' end is provided with a quenching group BHQ 1.

The probe HPV-31-P has a fluorescent reporter group ROX at the 5 'end and a quenching group BHQ1 at the 3' end.

The probe GAPDH-P has a fluorescent reporter CY5 at the 5 'end and a quencher BHQ1 at the 3' end.

The 5 'end of the probe HPV-18-P is provided with a fluorescent reporter FAM, and the 3' end is provided with a quenching group BHQ 1.

The 5 'end of the probe HPV-52-P is provided with a fluorescent reporter HEX, and the 3' end is provided with a quenching group BHQ 1.

The 5 'end of the probe HPV-58-P is provided with a fluorescent reporter group ROX, and the 3' end is provided with a quenching group BHQ 1.

The 5 'end of the probe HPV-68-P is provided with a fluorescent reporter group CY5, and the 3' end is provided with a quenching group BHQ 1.

The 5 'end of the probe HPV-45-P is provided with a fluorescent reporter FAM, and the 3' end of the probe HPV-45-P is provided with a quenching group BHQ 1.

The 5 'end of the probe HPV-82-P is provided with a fluorescent reporter HEX, and the 3' end is provided with a quenching group BHQ 1.

The 5 'end of the probe HPV-33-P is provided with a fluorescent reporter group ROX, and the 3' end is provided with a quenching group BHQ 1.

The 5 'end of the probe HPV-35-P is provided with a fluorescent reporter CY5, and the 3' end is provided with a quenching group BHQ 1.

The 5 'end of the probe HPV-39-P is provided with a fluorescent reporter group FAM, and the 3' end is provided with a quenching group BHQ 1.

The 5 'end of the probe HPV-51-P is provided with a fluorescent reporter group HEX, and the 3' end is provided with a quenching group BHQ 1.

The probe HPV-59-P has a fluorescent reporter ROX at the 5 'end and a quencher BHQ1 at the 3' end.

The 5 'end of the probe HPV-66-P is provided with a fluorescent reporter group CY5, and the 3' end is provided with a quenching group BHQ 1.

The 5 'end of the probe HPV-26-P is provided with a fluorescent reporter FAM, and the 3' end is provided with a quenching group BHQ 1.

The 5 'end of the probe HPV-53-P is provided with a fluorescent reporter HEX, and the 3' end is provided with a quenching group BHQ 1.

The probe HPV-73-P has a fluorescent reporter group ROX at the 5 'end and a quencher group BHQ1 at the 3' end.

F represents an upstream primer, and R represents a downstream primer.

The proportion of each upstream primer, each downstream primer and each probe is equal molar proportion.

The invention also protects the application of any primer probe combination in the preparation of the kit; the function of the kit is as follows (b1), (b2), (b3), (b4), (b5) or (b 6):

(b1) detecting whether the subject is an HPV infected subject;

(b2) screening for HPV infected persons;

(b3) typing HPV infected by the HPV infected person;

(b4) detecting whether the subject is a high-risk type HPV infected person;

(b5) screening high-risk HPV infectors;

(b6) typing the HPV infected by the high-risk type HPV infected persons.

The invention also protects the application of any primer probe combination in the preparation of the kit; the function of the kit is as follows (c1), (c2), (c3) or (c 4):

(c1) identifying the HPV;

(c2) typing the HPV;

(c3) identifying high risk types of HPV;

(c4) and (4) typing the high-risk HPV.

The invention also provides a kit comprising any one of the primer probe combinations.

The kit also comprises the following 18 standard plasmids:

inserting a double-stranded DNA molecule shown in a sequence 58 of the sequence table into a pMD18-T vector to obtain a plasmid HPV 16;

inserting a double-stranded DNA molecule shown as a sequence 59 in a sequence table into a pMD18-T vector to obtain a plasmid HPV 56;

inserting a double-stranded DNA molecule shown as a sequence 60 in a sequence table into a pMD18-T vector to obtain a plasmid HPV 31;

inserting a double-stranded DNA molecule shown as a sequence 61 in a sequence table into a pMD18-T vector to obtain a plasmid HPV 18;

inserting a double-stranded DNA molecule shown as a sequence 62 in a sequence table into a pMD18-T vector to obtain a plasmid HPV 52;

inserting a double-stranded DNA molecule shown in a sequence 63 of the sequence table into a pMD18-T vector to obtain a plasmid HPV 58;

inserting a double-stranded DNA molecule shown as a sequence 64 in a sequence table into a pMD18-T vector to obtain a plasmid HPV 68;

inserting a double-stranded DNA molecule shown as a sequence 65 in a sequence table into a pMD18-T vector to obtain a plasmid HPV 45;

inserting a double-stranded DNA molecule shown as a sequence 66 in a sequence table into a pMD18-T vector to obtain a plasmid HPV 82;

inserting a double-stranded DNA molecule shown as a sequence 67 in a sequence table into a pMD18-T vector to obtain a plasmid HPV 33;

inserting a double-stranded DNA molecule shown as a sequence 68 in a sequence table into a pMD18-T vector to obtain a plasmid HPV 35;

inserting a double-stranded DNA molecule shown in a sequence 69 of the sequence table into a pMD18-T vector to obtain a plasmid HPV 39;

inserting a double-stranded DNA molecule shown as a sequence 70 in a sequence table into a pMD18-T vector to obtain a plasmid HPV 51;

inserting a double-stranded DNA molecule shown in a sequence 71 of a sequence table into a pMD18-T vector to obtain a plasmid HPV 59;

inserting a double-stranded DNA molecule shown in a sequence 72 of the sequence table into a pMD18-T vector to obtain a plasmid HPV 66;

inserting a double-stranded DNA molecule shown as a sequence 73 in a sequence table into a pMD18-T vector to obtain a plasmid HPV 26;

inserting a double-stranded DNA molecule shown as a sequence 74 in a sequence table into a pMD18-T vector to obtain a plasmid HPV 53;

inserting the double-stranded DNA molecule shown as the sequence 75 in the sequence table into a pMD18-T vector to obtain the plasmid HPV 73.

The kit also comprises the following standard plasmids: the double-stranded DNA molecule shown in sequence 76 of the sequence table is inserted into a pMD18-T vector to obtain a plasmid GAPDH.

The invention also provides a kit, which comprises PCR reaction liquid A1, PCR reaction liquid A2, PCR reaction liquid A3, PCR reaction liquid A4 and PCR reaction liquid A5;

composition of PCR reaction solution a 1: 10 XPCR Buffer, 25mM MgCl ₂ dNTP/dUTP Mix, bovine serum albumin, a primer HPV-16-F, a primer HPV-16-R, a probe HPV-16-P, a primer HPV-56-F, a primer HPV-56-R, a probe HPV-56-P, a primer HPV-31-F, a primer HPV-31-R, a probe HPV-31-P, a primer GAPDH-F, a primer GAPDH-R and a probe GAPDH-P, and the balance of water;

composition of PCR reaction solution a 2: 10 XPCR Buffer, 25mM MgCl ₂ dNTP/dUTP Mix, bovine serum albumin, a primer HPV-18-F, a primer HPV-18-R, a probe HPV-18-P, a primer HPV-52-F, a primer HPV-52-R, a probe HPV-52-P, a primer HPV-58-F, a primer HPV-58-R, a probe HPV-58-P, a primer HPV-68-F, a primer HPV-68-R, a probe HPV-68-P and the balance of water;

composition of PCR reaction solution a 3: 10 XPCR Buffer, 25mM MgCl ₂ dNTP/dUTP Mix, bovine serum albumin, a primer HPV-45-F, a primer HPV-45-R, a probe HPV-45-P, a primer HPV-82-F, a primer HPV-82-R, a probe HPV-82-P, a primer HPV-33-F, a primer HPV-33-R, a probe HPV-33-P, a primer HPV-35-F, a primer HPV-35-R, a probe HPV-35-P and the balance of water;

composition of PCR reaction a 4: 10 XPCR bufferr、25mM MgCl ₂ dNTP/dUTP Mix, bovine serum albumin, a primer HPV-39-F, a primer HPV-39-R, a probe HPV-39-P, a primer HPV-51-F, a primer HPV-51-R, a probe HPV-51-P, a primer HPV-59-F, a primer HPV-59-R, a probe HPV-59-P, a primer HPV-66-F, a primer HPV-66-R, a probe HPV-66-P and the balance of water;

composition of PCR reaction a 5: 10 XPCR Buffer, 25mM MgCl ₂ dNTP/dUTP Mix, bovine serum albumin, a primer HPV-26-F, a primer HPV-26-R, a probe HPV-26-P, a primer HPV-53-F, a primer HPV-53-R, a probe HPV-53-P, a primer HPV-73-F, a primer HPV-73-R, a probe HPV-73-P and the balance of water.

The kit also comprises a PCR reaction solution B; composition of PCR reaction solution B: taq DNA polymerase and UDG enzyme.

In 0.63. mu.L of PCR reaction solution B, the amount of Taq DNA polymerase was 3U and the amount of UDG enzyme was 0.06U.

When used, 27.37. mu.L of PCR reaction solution A, 0.63. mu.L of PCR reaction solution B and 2. mu.L of the template solution were mixed to obtain 30. mu.L of a reaction system. The PCR reaction solution A is PCR reaction solution A1, PCR reaction solution A2, PCR reaction solution A3, PCR reaction solution A4 or PCR reaction solution A5.

In a 30. mu.L reaction system, the concentrations of the respective components provided by the PCR reaction solution A were: 1 XPCR Buffer, 4mM MgCl ₂ 0.6mM dNTP/dUTP, 4g/100ml BSA, 0.1. mu.M for each forward primer, 0.1. mu.M for each reverse primer, and 0.1. mu.M for each probe. For dNTP/dUTP, 0.6mM means the total concentration, and the concentrations of dATP/dCTP/dGTP in the 30. mu.L reaction system and dUTP in the 30. mu.L reaction system are each 0.12mM and 0.24mM, respectively.

The kit also comprises the following 5 positive control substances:

positive control P1: consists of a plasmid HPV16, a plasmid HPV56, a plasmid HPV31, a plasmid GAPDH and a sample treatment fluid, wherein the concentration of the four plasmids is 10 ⁴ Copies/μL；

Positive control P2: consists of a plasmid HPV18, a plasmid HPV52, a plasmid HPV58, a plasmid HPV68 and sample treatment liquid, wherein the concentration of the four plasmids are all 10 ⁴ Copies/μL；

Positive control P3: consists of a plasmid HPV45, a plasmid HPV82, a plasmid HPV33, a plasmid HPV35 and a sample treatment solution, wherein the concentration of the four plasmids is 10 ⁴ Copies/μL；

Positive control P4: consists of a plasmid HPV39, a plasmid HPV51, a plasmid HPV59, a plasmid HPV66 and a sample treatment solution, wherein the concentration of the four plasmids is 10 ⁴ Copies/μL；

Positive control P5: consists of plasmid HPV26, plasmid HPV53, plasmid HPV73 and sample treatment liquid, wherein the concentration of the three plasmids is 10 ⁴ Copies/μL。

The invention also protects the application of any one of the primer-probe combinations or any one of the kits, which is (b1) or (b2) or (b3) or (b4) or (b5) or (b 6):

(b1) detecting whether the subject is an HPV infected subject;

(b2) screening for HPV infected persons;

(b3) typing HPV infected by the HPV infected person;

(b4) detecting whether the subject is a high-risk type HPV infected person;

(b5) screening high-risk HPV infectors;

(b6) typing the HPV infected by the high-risk type HPV infectors.

The invention also protects the application of any one of the primer-probe combinations or any one of the kits, which is (c1) or (c2) or (c3) or (c 4):

(c1) identifying the HPV;

(c2) typing the HPV;

(c3) identifying high risk types of HPV;

(c4) and (4) typing the high-risk HPV.

The primer probe set or the kit provided by the invention utilizes a nucleic acid detection technology of a PCR-fluorescence probe method, takes a specific high-risk HPV nucleic acid sequence as a detection purpose, and carries out in-vitro qualitative detection on a human cervical sample (such as human cervical exfoliated epithelial cells or secretions and the like) so as to determine whether high-risk HPV viruses exist in the sample to be detected or identify the genotype of infecting HPV at the same time. The kit has strong specificity and high detectable rate, is suitable for screening and judging high-risk HPV carriers, and is beneficial to prevention and control of the high-risk HPV.

Drawings

FIG. 1 is a sequence diagram of double-stranded DNA molecules 1 to 9.

FIG. 2 is a sequence diagram of double-stranded DNA molecules 10 to 18.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, and the examples are given only for illustrating the present invention and not for limiting the scope of the present invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise specified, were carried out in a conventional manner according to the techniques or conditions described in the literature in this field or according to the product instructions. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified. Adopts a Shanghai macrolith SLAN-96P type fluorescence PCR instrument.

Unless otherwise stated, the quantitative tests in the following examples were carried out in triplicate, and the results were averaged.

Sample treatment solution: contains 0.1mol/L Tris-HCl, 100mmol/L EDTA, 2.5mol/L NaCl, 2mL/100mL NP-40, 2g/100mL SDS, and the balance water.

Unless otherwise specified, all DNA molecules in the specification are in the 5'→ 3' direction.

The biological sample for HPV detection is human cervical os exfoliative cells. The sample should be immediately tested, and if the sample can not be tested in the same day, the sample should be stored at 2-8 deg.C for 24 hr or less, at-15 deg.C to-20 deg.C for 3 months, and at-70 deg.C for a long time. Repeated freeze thawing of the sample should be avoided, and the frozen sample should be fully and uniformly mixed after being thawed. The sampling method of human cervical os exfoliative cells comprises the following steps: before sampling, a cotton swab soaked by normal saline is used for gently wiping and cleaning excessive secretion of the cervical orifice; then, sampling at the junction of the squamous epithelium in the cervical canal by using a cervical sampling brush (which is soaked by physiological saline in advance), and taking cervical exfoliated cells by paying attention to slightly rotating for two weeks during sampling; quickly immersing the cervical sampling brush into a sample tube containing 1mL of sterile physiological saline, discarding the cervical sampling brush after full rinsing, and reserving the sample tube containing a liquid phase, namely the sample to be tested.

Examples 1,

Design and preparation of primers and probes

Based on a large number of sequence analyses and primer designs, a large number of candidate primers and corresponding probes are obtained. And carrying out multiple combinations on the candidate primers and the probes and verifying the effect through a preliminary experiment to obtain the primer probe group for detecting the high-risk HPV.

The target sequence of the primer probe set for detecting HPV16 is located in the E6 gene. The primer probe sets used for detection of HPV16 were as follows:

HPV-16-F (SEQ ID NO: 1): AAAGCAAAGACATCTGGACAAA, respectively;

HPV-16-R (SEQ ID NO: 2): TCTACGTGTTCTCGATGATCTG, respectively;

HPV-16-P (SEQ ID NO: 3): FAM-GTGGACCGGTCGATGTATGTCTTGTT-BHQ 1.

The target sequence of the primer probe set for detecting HPV56 is located in the E6 gene. Primer probe sets for detection of HPV56 were as follows:

HPV-56-F (SEQ ID NO: 4): AGCAATTGCATTGTGACAGAAA, respectively;

HPV-56-R (SEQ ID NO: 5): GGTTCTCTAGATGTTTGTCTCCAG, respectively;

HPV-56-P (SEQ ID NO: 6): HEX-TAATAGCACATGGTTGGACCGGGT-BHQ 1.

The target sequence of the primer probe set for detection of HPV31 is located in the E6 gene. The primer probe sets used for detection of HPV31 were as follows:

HPV-31-F (SEQ ID NO: 7): AACCGTTGTGTCCAGAAGAAA, respectively;

HPV-31-R (SEQ ID NO: 8): ACGAGGTCTTCTCCAACATACTA, respectively;

HPV-31-P (SEQ ID NO: 9): ROX-ATAGGAGGAAGGTGGACAGGACGT-BHQ 1.

The reference gene is human GAPDH gene. The primer probe sets for detecting the reference gene are as follows:

GAPDH-F (SEQ ID NO: 55): GGTGTGAACCATGAGAAGTATGA;

GAPDH-R (SEQ ID NO: 56): GAGTCCTTCCACGATACCAAAG, respectively;

GAPDH-P (SEQ ID NO: 57): CY5-AGATCATCAGCAATGCCTCCTGCA-BHQ 1.

The target sequence of the primer probe set for detection of HPV18 is located in the E6 gene. The primer probe sets used for detection of HPV18 were as follows:

HPV-18-F (SEQ ID NO: 10): CACAACATAGCTGGGCACT, respectively;

HPV-18-R (SEQ ID NO: 11): TGTTTCTCTGCGTCGTTGG, respectively;

HPV-18-P (SEQ ID NO: 12): FAM-CAACCGAGCACGACAGGAAAGACT-BHQ 1.

The target sequence of the primer probe set for detecting HPV52 is located in the E6 gene. Primer probe sets for detection of HPV52 were as follows:

HPV-52-F (SEQ ID NO: 13): ACATGTTAATGCAAACAAGCGA;

HPV-52-R (SEQ ID NO: 14): GGGTCTCCAACACTCTGAAC, respectively;

HPV-52-P (SEQ ID NO: 15): HEX-GGGTCGTTGGACAGGGCG-BHQ 1.

The target sequence of the primer probe set for detecting HPV58 is located in the E6 gene. The primer probe sets used for detection of HPV58 were as follows:

HPV-58-F (SEQ ID NO: 16): GGCATGTGGATTTAAACA;

HPV-58-R (SEQ ID NO: 17): CACTTGTGTTTGTCTACGTC, respectively;

HPV-58-P (SEQ ID NO: 18): ROX-GGTCGTTGGACAGGGCGCTGTGCA-BHQ 1.

The target sequence of the primer probe set for detecting HPV68 is located in the E6 gene. Primer probe sets for detection of HPV68 were as follows:

HPV-68-F (SEQ ID NO: 19): AGCAGGAAACTTTACAGGACAG, respectively;

HPV-68-R (SEQ ID NO: 20): TTCTTGACGTATGCGTCTGC, respectively;

HPV-68-P (SEQ ID NO: 21): CY5-CACTGCTGGACCAGTAAGCGAGAG-BHQ 1.

The target sequence of the primer probe set for detection of HPV45 is located in the E7 gene. Primer probe sets for detection of HPV45 were as follows:

HPV-45-F (SEQ ID NO: 22): GGCAACACTGCAAGAAATTGTA;

HPV-45-R (SEQ ID NO: 23): TCCTCCTCTGACTCGCTTAAT, respectively;

HPV-45-P (SEQ ID NO: 24): FAM-TCCTGTTGACCTGTTGTGTTACGAGC-BHQ 1.

The target sequence of the primer probe set for detecting HPV82 is located in the E6 gene. Primer probe sets for detection of HPV82 were as follows:

HPV-82-F (SEQ ID NO: 25): GTGCTACATTAGAGGCCATTACTA;

HPV-82-R (SEQ ID NO: 26): TTTGTCGTCCACCACCTTT;

HPV-82-P (SEQ ID NO: 27): HEX-AGAGACCACTTGGGCCTGAAGAAA-BHQ 1.

The target sequence of the primer probe set for detecting HPV33 is located in the E6 gene. Primer probe sets for detection of HPV33 were as follows:

HPV-33-F (SEQ ID NO: 28): ACGACATGTGGATTTAAACAAACG, respectively;

HPV-33-R (SEQ ID NO: 29): TTTCTCTACGTCGGGACCTC, respectively;

HPV-33-P (SEQ ID NO: 30): ROX-TAATATTTCGGGTCGTTGGGCAGGG-BHQ 1.

The target sequence of the primer probe set for detecting HPV35 is located in the E6 gene. Primer probe sets for detection of HPV35 were as follows:

HPV-35-F (SEQ ID NO: 31): CGATTCCATAACATCGGTGGA, respectively;

HPV-35-R (SEQ ID NO: 32): CTCGGTTTCTCTACGTGTTGG, respectively;

HPV-35-P (SEQ ID NO: 33): CY5-AGGTCGGTGTATGTCCTGTTGGAA-BHQ 1.

The target sequence of the primer probe set for detecting HPV39 is located in the E7 gene. Primer probe sets for detection of HPV39 were as follows:

HPV-39-F (SEQ ID NO: 34): ACCCGACCATGCAGTTAATC, respectively;

HPV-39-R (SEQ ID NO: 35): GTATCCCGTGAGGCTTCTACTA, respectively;

HPV-39-P (SEQ ID NO: 36): FAM-GGGAAGAACCACAGCGTCACACAATA-BHQ 1.

The target sequence of the primer probe set for detection of HPV51 is located in the E6 gene. The primer probe sets used for detection of HPV51 were as follows:

HPV-51-F (SEQ ID NO: 37): CACGAACGCTGCATGAATTA, respectively;

HPV-51-R (SEQ ID NO: 38): TACAATACACACACACTACCTGTAT, respectively;

HPV-51-P (SEQ ID NO: 39): HEX-GTGAAGCTTTGAACGTTTCTATGCACA-BHQ 1.

The target sequence of the primer probe set for detection of HPV59 is located in the E2 gene. Primer probe sets for detection of HPV59 were as follows:

HPV-59-F (SEQ ID NO: 40): GACTACAGACAAGTGGGAAGTG;

HPV-59-R (SEQ ID NO: 41): TTGCTCAGAAGATCCAGAAGTG;

HPV-59-P (SEQ ID NO: 42): ROX-ATGTGCAGTACCAGTGACGAGCAA-BHQ 1.

The target sequence of the primer probe set for detection of HPV66 is located in the E6 gene. The primer probe sets used for detection of HPV66 were as follows:

HPV-66-F (SEQ ID NO: 43): AACAATTGCACTGTGAACAT;

HPV-66-R (SEQ ID NO: 44): GTAGCTTGTCTACTCGTATGT, respectively;

HPV-66-P (SEQ ID NO: 45): CY5-GACGATTTCATTATATAGCATATGCA-BHQ 1.

The target sequence of the primer probe set for detecting HPV26 is located in the E7 gene. Primer probe sets for detection of HPV26 were as follows:

HPV-26-F (SEQ ID NO: 46): GACAGCTCAGATGAGGATGAAA;

HPV-26-R (SEQ ID NO: 47): CACATACAACATTGTGCTTCAATTC, respectively;

HPV-26-P (SEQ ID NO: 48): FAM-AGGCCAGACAAGCTGGACAAGAAG-BHQ 1.

The target sequence of the primer probe set for detecting HPV53 is located in the E6 gene. Primer probe sets for detection of HPV53 were as follows:

HPV-53-F (SEQ ID NO: 49): GAATAAACCATTGCTGGAGCTG, respectively;

HPV-53-R (SEQ ID NO: 50): ACCCGTCTCTATACACTACTCTT, respectively;

HPV-53-P (SEQ ID NO: 51): HEX-GCTGTGTGTTCTGCAAGAAGGCAT-BHQ 1.

The target sequence of the primer probe set for detecting HPV73 is located in the E7 gene. Primer probe sets for detection of HPV73 were as follows:

HPV-73-F (SEQ ID NO: 52): TTACTGACTGCACGAAGTGTC, respectively;

HPV-73-R (SEQ ID NO: 53): CCTAGTGTACCCATAAGCAACTC, respectively;

HPV-73-P (SEQ ID NO: 54): ROX-AGTGCACAGTATGCCTTGCCATTG-BHQ 1.

In each primer probe set, F represents the upstream primer, R represents the downstream primer, and P represents the probe.

Primers and probes were synthesized manually.

Secondly, preparing PCR reaction solution

1. Preparation of PCR reaction solution A

Composition of PCR reaction solution a 1: 10 XPCR Buffer, 25mM MgCl ₂ dNTP/dUTP Mix, Bovine Serum Albumin (BSA), HPV-16-F, HPV-16-R, HPV-16-P, HPV-56-F, HPV-56-R, HPV-56-P, HPV-31-F, HPV-31-R, HPV-31-P, GAPDH-F, GAPDH-R and GAPDH-P, and the balance being water.

Composition of PCR reaction solution a 2: 10 XPCR Buffer, 25mM MgCl ₂ dNTP/dUTP Mix, Bovine Serum Albumin (BSA), HPV-18-F, HPV-18-R, HPV-18-P, HPV-52-F, HPV-52-R, HPV-52-P, HPV-58-F, HPV-58-R, HPV-58-P, HPV-68-F, HPV-68-R, HPV-68-P and the balance of water.

Composition of PCR reaction solution a 3: 10 XPCR Buffer, 25mM MgCl ₂ dNTP/dUTP Mix, Bovine Serum Albumin (BSA), HPV-45-F, HPV-45-R, HPV-45-P, HPV-82-F, HPV-82-R, HPV-82-P, HPV-33-F, HPV-33-R, HPV-33-P, HPV-35-F, HPV-35-R, HPV-35-P, and the balance of water.

Composition of PCR reaction solution a 4: 10 XPCR Buffer, 25mM MgCl ₂ dNTP/dUTP Mix, Bovine Serum Albumin (BSA), HPV-39-F, HPV-39-R, HPV-39-P, HPV-51-F, HPV-51-R, HPV-51-P, HPV-59-F, HPV-59-R, HPV-59-P, HPV-66-F, HPV-66-R, HPV-66-P and the balance of water.

Composition of PCR reaction solution a 5: 10 XPCR Buffer, 25mM MgCl ₂ dNTP/dUTP Mix, Bovine Serum Albumin (BSA), HPV-26-F, HPV-26-R, HPV-26-P, HPV-53-F, HPV-53-R, HPV-53-P, HPV-73-F, HPV-73-R, HPV-73-P and the balance of water.

10 times PCR Buffer is 10 times PCR Buffer (Mg) ²⁺ free), Baori physician's technology (Beijing) Inc., cat # 9151 AM. 25mM MgCl ₂ All are matched products of 10 XPCR Buffer. dNTP/dUTP Mix: biotechnology engineering (Shanghai) Inc., having a product number B300578.

2. Preparation of PCR reaction solution B

Composition of PCR reaction solution B: taq DNA polymerase and UDG enzyme. In 0.63. mu.L of the PCR reaction solution B, the content of Taq DNA polymerase was 3U and the content of UDG enzyme was 0.06U. Taq DNA polymerase (product size 5U/. mu.l): bio-engineering (Shanghai) Inc. under the trade designation B500010. UDG enzyme (product specification 2U/. mu.l): biotechnology engineering (Shanghai) Inc., Cat B110042.

Thirdly, preparing a positive reference substance

Inserting the double-stranded DNA molecule shown in the sequence 58 of the sequence table into a pMD18-T vector to obtain the plasmid HPV 16. Inserting the double-stranded DNA molecule shown in the sequence 59 of the sequence table into a pMD18-T vector to obtain the plasmid HPV 56. Inserting the double-stranded DNA molecule shown in the sequence 60 of the sequence table into a pMD18-T vector to obtain the plasmid HPV 31. The double-stranded DNA molecule shown in the sequence 76 of the sequence table is inserted into a pMD18-T vector to obtain a plasmid GAPDH. Inserting the double-stranded DNA molecule shown in the sequence 61 of the sequence table into a pMD18-T vector to obtain the plasmid HPV 18. Inserting the double-stranded DNA molecule shown in the sequence 62 of the sequence table into a pMD18-T vector to obtain the plasmid HPV 52. Inserting the double-stranded DNA molecule shown in the sequence 63 of the sequence table into a pMD18-T vector to obtain the plasmid HPV 58. Inserting the double-stranded DNA molecule shown as a sequence 64 in the sequence table into a pMD18-T vector to obtain a plasmid HPV 68. Inserting the double-stranded DNA molecule shown in the sequence 65 of the sequence table into a pMD18-T vector to obtain the plasmid HPV 45. Inserting the double-stranded DNA molecule shown in the sequence 66 of the sequence table into a pMD18-T vector to obtain the plasmid HPV 82. Inserting the double-stranded DNA molecule shown in the sequence 67 of the sequence table into a pMD18-T vector to obtain the plasmid HPV 33. Inserting the double-stranded DNA molecule shown as the sequence 68 in the sequence table into a pMD18-T vector to obtain the plasmid HPV 35. Inserting the double-stranded DNA molecule shown in the sequence 69 of the sequence table into a pMD18-T vector to obtain the plasmid HPV 39. Inserting the double-stranded DNA molecule shown in the sequence 70 of the sequence table into a pMD18-T vector to obtain the plasmid HPV 51. Inserting the double-stranded DNA molecule shown in the sequence 71 of the sequence table into a pMD18-T vector to obtain the plasmid HPV 59. Inserting the double-stranded DNA molecule shown in the sequence 72 of the sequence table into a pMD18-T vector to obtain the plasmid HPV 66. Inserting the double-stranded DNA molecule shown in the sequence 73 of the sequence table into a pMD18-T vector to obtain the plasmid HPV 26. Inserting the double-stranded DNA molecule shown in the sequence 74 of the sequence table into a pMD18-T vector to obtain the plasmid HPV 53. Inserting the double-stranded DNA molecule shown as the sequence 75 in the sequence table into a pMD18-T vector to obtain the plasmid HPV 73.

Positive control P1: consists of a plasmid HPV16, a plasmid HPV56, a plasmid HPV31, a plasmid GAPDH and a sample treatment fluid, wherein the concentration of the four plasmids is 10 ⁴ Copies/μL。

Positive control P2: consists of a plasmid HPV18, a plasmid HPV52, a plasmid HPV58, a plasmid HPV68 and sample treatment liquid, wherein the concentration of the four plasmids are all 10 ⁴ Copies/μL。

Positive control P3: consists of a plasmid HPV45, a plasmid HPV82, a plasmid HPV33, a plasmid HPV35 and a sample treatment solution, wherein the concentration of the four plasmids is 10 ⁴ Copies/μL。

Positive control P4: consists of a plasmid HPV39, a plasmid HPV51, a plasmid HPV59, a plasmid HPV66 and sample treatment liquid, wherein the concentration of the four plasmids are all 10 ⁴ Copies/μL。

Positive control P5: consists of a plasmid HPV26, a plasmid HPV53, a plasmid HPV73 and a sample treatment solution, wherein the concentration of the three plasmids is 10 ⁴ Copies/μL。

Fourthly, assembling of the kit

The components of the kit are as follows:

PCR reaction solution a 1;

PCR reaction solution a 2;

PCR reaction solution a 3;

PCR reaction solution a 4;

PCR reaction solution a 5;

PCR reaction solution B;

a positive control P1;

a positive control P2;

a positive control P3;

a positive control P4;

a positive control P5;

negative control: a sample processing liquid.

Fifth, using method of kit

1. Taking 1mL of sample to be tested into a 1.5mL sterile centrifuge tube, centrifuging at 12000rpm for 5min, discarding the supernatant, adding 50 mu L of sample treatment solution into the precipitate, and shaking and mixing uniformly; incubating at 100 ℃ for 10min, centrifuging at 12000rpm for 10min, and collecting supernatant to obtain DNA solution.

2. And performing real-time fluorescent quantitative PCR.

Reaction system (30 μ L): 27.37. mu.L of PCR reaction solution A, 0.63. mu.L of PCR reaction solution B, and 2. mu.L of template solution.

The template solution is the DNA solution obtained in the step 1 or a positive control substance or a negative control substance.

In a 30. mu.L reaction system, the concentrations of the respective components provided by the PCR reaction solution A were: 1 XPCR Buffer, 4mM MgCl ₂ 0.6mM dNTP/dUTP, 4g/100ml BSA, 0.1. mu.M for each forward primer, 0.1. mu.M for each reverse primer, and 0.1. mu.M for each probe. For dNTP/dUTP, 0.6mM means the total concentration, and the concentrations of dATP/dCTP/dGTP in the 30. mu.L reaction system were each 0.12mM, and the concentration of dUTP in the 30. mu.L reaction system was 0.24 mM. The PCR reaction solution A is PCR reaction solution A1, PCR reaction solution A2, PCR reaction solution A3, PCR reaction solution A4 or PCR reaction solution A5.

Reaction procedure: 2min at 50 ℃; pre-denaturation at 95 ℃ for 10 min; denaturation at 95 ℃ for 15sec, annealing at 64 ℃ and extension for 30sec, 45 cycles. Collecting FAM, HEX, ROX, CY5 fluorescence signals upon annealing and extension

3. Making a result judgment

(1) Quality control

The results of the above steps performed on the negative control satisfy table 1 and the results of the above steps performed on the positive control satisfy table 2, and the test is effective.

TABLE 1

	FAM	HEX	ROX	CY5
					The PCR reaction solution A1 was used	Negative of	Negative of	Negative of	Negative of
The PCR reaction solution A2 was used	Negative of	Negative of	Negative of	Negative of
					PCR reaction solution A3 was used	Negative of	Negative of	Negative of	Negative of
The PCR reaction solution A4 was used	Negative of	Negative of	Negative of	Negative of
					The PCR reaction solution A5 was used	Negative of	Negative of	Negative of	Negative of

TABLE 2

(2) Analysis of results

Setting a baseline, and after respectively setting a threshold line under the FAM fluorescence channel, a threshold line under the HEX fluorescence channel, a threshold line under the ROX fluorescence channel and a threshold line under the CY5 fluorescence channel, the instrument can give corresponding Ct values of each sample on the four fluorescence channels, and the result judgment is carried out according to the Ct values. In order to prevent erroneous judgment, the amplification curve of a sample with a Ct value is recommended to be analyzed, if the amplification curve is not in an S shape, the amplification curve is reported as a special case according to a negative result, and the Ct value cannot be used as a basis for judging the result.

On the premise of effective test, the reference gene is judged to be positive (namely Ct is less than 45 and has a typical S-shaped amplification curve), which indicates that the sample is effective.

The test is effective and the sample is effective: the results of negative (carrying no high-risk HPV) and positive (carrying high-risk HPV) are judged by the method shown in Table 3; the typing (18 types) of high risk HPV is shown in Table 4.

TABLE 3

TABLE 4

Example 2 Performance of the kit

18 plasmids: plasmid HPV16, plasmid HPV56, plasmid HPV31, plasmid HPV18, plasmid HPV52, plasmid HPV58, plasmid HPV68, plasmid HPV45, plasmid HPV82, plasmid HPV33, plasmid HPV35, plasmid HPV39, plasmid HPV51, plasmid HPV59, plasmid HPV66, plasmid HPV26, plasmid HPV53, plasmid HPV73 prepared in example 1.

First, detection limit

The 18 plasmids were diluted with TE buffer solutions to give 18 standard solutions at a concentration of 100 Copies/. mu.L.

Each standard solution was used as a template solution, and the kit prepared in example 1 was used and the procedure was followed. Each standard solution was run in 20 replicates.

The results are shown in Table 5. The detection limit of the kit on the template solution is not less than 1.0 multiplied by 10 ² Copies/μL。

TABLE 5

Second, negative rate of coincidence

19 negative reference products are divided into two groups, wherein the first group consists of 11 negative reference products, and the second group consists of 8 negative reference products. 11 negative references were obtained from the Chinese food and drug assay research institute (Cat No. 360003, lot No. 360003-201602). 11 negative reference products are: HPV6, HPV11, HPV61, HPV67, HPV69, HPV71, HPV81, Ureaplasma Urealyticum (UU), Chlamydia Trachomatis (CT), herpes simplex virus type 2 (HSV2), human Cytomegalovirus (CMV). The 8 negative reference products are inactivated samples of clinical samples confirmed by hospitals. 8 negative reference products are: an inactivated HPV40 positive clinical sample, an inactivated HPV42 positive clinical sample, an inactivated HPV43 positive clinical sample, an inactivated HPV44 positive clinical sample, an inactivated HPV54 positive clinical sample, an inactivated HPV70 positive clinical sample, an inactivated HPV72 positive clinical sample, and an inactivated HPV83 positive clinical sample.

The kit prepared in example 1 was used and the procedure was followed for using the kit.

The negative coincidence rate of each primer probe group channel detection is 100%.

Third, degree of precision

The kit prepared in example 1 was used and the procedure was followed for using the kit. Repeating the detection kit for 10 times to obtain a positive control product P1, a positive control product P2, a positive control product P3, a positive control product P4 or a positive control product P5.

The coefficient of variation results for Ct values for each channel are shown in Table 6, all of which are less than 5.0%.

TABLE 6

HPV type	CV value	HPV type	CV value
				16	0.67％	52	1.08％
18	1.26％	53	0.71％
				26	1.00％	56	1.64％
31	0.79％	58	1.93％
				33	2.10％	59	0.89％
35	2.10％	66	2.61％
				39	1.61％	68	0.84％
45	1.92％	73	2.41％
				51	1.54％	82	2.22％

Fourth, positive coincidence rate

18 positive references: an inactivated HPV16 type positive clinical sample, an inactivated HPV56 type positive clinical sample, an inactivated HPV31 type positive clinical sample, an inactivated HPV18 type positive clinical sample, an inactivated HPV52 type positive clinical sample, an inactivated HPV58 type positive clinical sample, an inactivated HPV68 type positive clinical sample, an inactivated HPV45 type positive clinical sample, an inactivated HPV82 type positive clinical sample, an inactivated HPV33 type positive clinical sample, an inactivated HPV35 type positive clinical sample, an inactivated HPV39 type positive clinical sample, an inactivated HPV51 type positive clinical sample, an inactivated HPV59 type positive clinical sample, an inactivated HPV66 type positive clinical sample, an inactivated HPV26 type positive clinical sample, an inactivated HPV53 type positive clinical sample, an inactivated HPV73 type positive clinical sample. The inactivated positive clinical samples are human clinical samples which are classified, confirmed and inactivated in hospitals.

The detection results of all clinical samples are correct, and the coincidence rate is 100%.

Comparative example (c),

Preparation of primers and probes

The target sequence of the primer probe set for detection of HPV16 is located in the L1 gene. The primer probe sets used for detection of HPV16 were as follows:

HPV-16-F'：GGTAGATACTACACGCAGTACA；

HPV-16-R'：CCCATGTCGTAGGTACTCTTT；

HPV-16-P'：FAM-TGTGCTGCCATATCTACTTCAGAACCT-BHQ1。

the target sequence of the primer probe set for detection of HPV56 is located in the L1 gene. The primer probe sets used for detection of HPV56 were as follows:

HPV-56-F'：AACCTACTGGAGGACTGGAATA；

HPV-56-R'：TGACATGTTATAGCTGTGCTTCT；

HPV-56-P'：HEX-CAGTGGCCACCAGCCTAGAAGATAAA-BHQ1。

the target sequence of the primer probe set for detection of HPV31 is located in the L1 gene. The primer probe sets used for detection of HPV31 were as follows:

HPV-31-F'：AATAGATCAGGCACGGTTGG；

HPV-31-R'：CCGCTAGGTGTAGGAAAGTATG；

HPV-31-P'：ROX-AGGCTCCGGTTCAACAGCTACTTT-BHQ1。

the reference gene is human GAPDH gene. The primer probe set used for detecting the reference gene was the same as in example 1.

The target sequence of the primer probe set for detection of HPV18 is located in the L1 gene. The primer probe sets used for detection of HPV18 were as follows:

HPV-18-F'：AGATACTACTCGCAGTACCAATTT；

HPV-18-R'：TCCTCAACATGTCTGCTATACTG；

HPV-18-P'：FAM-TACACAGTCTCCTGTACCTGGGCA-BHQ1。

the target sequence of the primer probe set for detection of HPV52 is located in the L1 gene. Primer probe sets for detection of HPV52 were as follows:

HPV-52-F'：TTATAACCCAGAAACCCAGAGG；

HPV-52-R'：CCCACTAATACCCACACCTAAA；

HPV-52-P'：HEX-TGTACAGGCTTGGAAATCGGTAGGG-BHQ1。

the target sequence of the primer probe set for detection of HPV58 is located in the L1 gene. Primer probe sets for detection of HPV58 were as follows:

HPV-58-F'：GGACTGGCAATTTGGTTTAACA；

HPV-58-R'：ATAGCCTGGGAGGTAACAAATC；

HPV-58-P'：ROX-CCGTCTGCCAGTTTACAGGACACA-BHQ1。

the target sequence of the primer probe set for detection of HPV68 is located in the L1 gene. The primer probe sets used for detection of HPV68 were as follows:

HPV-68-F'：GGTATCCTCAGACTCCCAGTTA；

HPV-68-R'：CGAGTGGTATCCACAACAGTAAG；

HPV-68-P'：CY5-GCACAAGGCACAAGGACACAACAAT-BHQ1。

the target sequence of the primer probe set for detection of HPV45 is located in the L1 gene. Primer probe sets for detection of HPV45 were as follows:

HPV-45-F'：CAGGGCCATAACAATGGTATTT；

HPV-45-R'：GTTAAATTAGTACTGCGGGTAGTG；

HPV-45-P'：FAM-GGCATAATCAGTTGTTTGTTACTGTAGTGG-BHQ1。

the target sequence of the primer probe set for detection of HPV82 is located in the L1 gene. The primer probe sets used for detection of HPV82 were as follows:

HPV-82-F'：GCCACAGGTACCACATGTAA；

HPV-82-R'：CACCATATCGCCATCCTCAA；

HPV-82-P'：HEX-AACGTACCTGTACCTCAGGGTGACT-BHQ1。

the target sequence of the primer probe set for detection of HPV33 is located in the L1 gene. Primer probe sets for detection of HPV33 were as follows:

HPV-33-F'：CCCAGTGGATCAATGGTTACTT；

HPV-33-R'：TGGTACTGCGAGTGGTATCT；

HPV-33-P'：ROX-GGCTACAACGTGCACAAGGTCATA-BHQ1。

the target sequence of the primer probe set for detection of HPV35 is located in the L1 gene. The primer probe sets used for detection of HPV35 were as follows:

HPV-35-F'：CTATCATGCAGGCAGTTCTAGG；

HPV-35-R'：CAGATACCTTGGGTACTGCTATTT；

HPV-35-P'：CY5-GCTGTGGGTCACCCATACTATGCT-BHQ1。

the target sequence of the primer probe set for detection of HPV39 is located in the L1 gene. The primer probe sets used for detection of HPV39 were as follows:

HPV-39-F'：ACTACCCGTAGTACCAACTTTAC；

HPV-39-R'：CTCCACGTGCCTGGTATATT；

HPV-39-P'：FAM-GAGTCTTCCATACCTTCTACATATGATCCT-BHQ1。

the target sequence of the primer probe set for detection of HPV51 is located in the L1 gene. The primer probe sets used for detection of HPV51 were as follows:

HPV-51-F'：GGTAGATACTACCAGAAGTACAAAT；

HPV-51-R'：AGTTACTTGGAGTAAATGTTGGG；

HPV-51-P'：HEX-ACTATTAGCACTGCCACTGCTGCG-BHQ1。

the target sequence of the primer probe set for detection of HPV59 is located in the L1 gene. The primer probe sets used for detection of HPV59 were as follows:

HPV-59-F'：GGGTCTGTGGTTACTTCTGATT；

HPV-59-R'：GATTGGTGCTGCGAGTAGTAT；

HPV-59-P'：ROX-ACCATATTGGCTGCACAAGGCTCA-BHQ1。

the target sequence of the primer probe set for detection of HPV66 is located in the L1 gene. Primer probe sets for detection of HPV66 were as follows:

HPV-66-F'：CTTCGCCATGTGGAGGAATA；

HPV-66-R'：GGGACAATCCAATGTTCCAATC；

HPV-66-P'：CY5-CCTTAACTGCAGAAGTTATGGCATATTTGC-BHQ1。

the target sequence of the primer probe set for detection of HPV26 is located in the L1 gene. Primer probe sets for detection of HPV26 were as follows:

HPV-26-F'：CTCCATATTGGAGGATTGGAATTT；

HPV-26-R'：CTGACAGGTAGTAGCAGAGTTT；

HPV-26-P'：FAM-TCCCACTGCTAGTTTGGAAGATGCC-BHQ1。

the target sequence of the primer probe set for detection of HPV53 is located in the L1 gene. Primer probe sets for detection of HPV53 were as follows:

HPV-53-F'：ACAGTATGTTAGACATGCAGAGG；

HPV-53-R'：CAGGAGGCGACAAACCTATATT；

HPV-53-P'：HEX-ATCCCTGTCTGCTGAGGTTATGGC-BHQ1。

the target sequence of the primer probe set for detection of HPV73 is located in the L1 gene. Primer probe sets for detection of HPV73 were as follows:

HPV-73-F'：CACCACCGTCAGGTACTTTAG；

HPV-73-R'：GGCATATGGGTCCTCTGTTT；

HPV-73-P'：ROX-TGCCAACGTCCTCAACCTCCTAA-BHQ1。

Primers and probes were synthesized manually.

Secondly, preparing PCR reaction solution

1. Preparation of PCR reaction solution C

The PCR reaction solution C1 differed from the PCR reaction solution A1 in example 1 only in that the primers and probes corresponding to those in step one of the comparative example were used instead of the original ones.

The PCR reaction solution C2 was different from the PCR reaction solution A2 in example 1 only in that the corresponding primers and probes in step one of the comparative example were used instead of the original ones.

The PCR reaction solution C3 was different from the PCR reaction solution A3 in example 1 only in that the corresponding primers and probes in step one of the comparative example were used instead of the original ones.

The PCR reaction solution C4 was different from the PCR reaction solution A4 in example 1 only in that the corresponding primers and probes in step one of the comparative example were used instead of the original ones.

The PCR reaction solution C5 was different from the PCR reaction solution A5 in example 1 only in that the corresponding primers and probes in step one of the comparative example were used instead of the original ones.

2. Preparation of PCR reaction solution B

Same as 2 of step two of example 1.

Thirdly, preparing a positive reference substance

Inserting the double-stranded DNA molecule 1 into a pMD18-T vector to obtain a plasmid HPV 16-L1. Inserting the double-stranded DNA molecule 2 into a pMD18-T vector to obtain the plasmid HPV 56-L1. Inserting the double-stranded DNA molecule 3 into a pMD18-T vector to obtain the plasmid HPV 31-L1. Inserting the double-stranded DNA molecule 4 into a pMD18-T vector to obtain the plasmid HPV 18-L1. Inserting the double-stranded DNA molecule 5 into a pMD18-T vector to obtain the plasmid HPV 52-L1. Inserting the double-stranded DNA molecule 6 into a pMD18-T vector to obtain the plasmid HPV 58-L1. Inserting the double-stranded DNA molecule 7 into a pMD18-T vector to obtain the plasmid HPV 68-L1. The double-stranded DNA molecule 8 is inserted into a pMD18-T vector to obtain the plasmid HPV 45-L1. The double-stranded DNA molecule 9 is inserted into a pMD18-T vector to obtain a plasmid HPV 82-L1. The double-stranded DNA molecule 10 is inserted into a pMD18-T vector to obtain a plasmid HPV 33-L1. The double-stranded DNA molecule 11 is inserted into a pMD18-T vector to obtain a plasmid HPV 35-L1. The double-stranded DNA molecule 12 is inserted into a pMD18-T vector to obtain a plasmid HPV 39-L1. Inserting the double-stranded DNA molecule 13 into a pMD18-T vector to obtain the plasmid HPV 51-L1. The double-stranded DNA molecule 14 is inserted into a pMD18-T vector to obtain a plasmid HPV 59-L1. The double-stranded DNA molecule 15 is inserted into pMD18-T vector to obtain plasmid HPV 66-L1. The double-stranded DNA molecule 16 was inserted into the pMD18-T vector to obtain plasmid HPV 26-L1. The double-stranded DNA molecule 17 is inserted into pMD18-T vector to obtain plasmid HPV 53-L1. The double-stranded DNA molecule 18 is inserted into a pMD18-T vector to obtain a plasmid HPV 73-L1. A schematic sequence of the double-stranded DNA molecules 1 to 9 is shown in FIG. 1. A schematic sequence of the double-stranded DNA molecules 10 to 18 is shown in FIG. 2.

Positive control P1-L1: consists of a plasmid HPV16-L1, a plasmid HPV56-L1, a plasmid HPV31-L1, a plasmid GAPDH and a sample treatment fluid, wherein the concentrations of the four plasmids are all 10 ⁴ Copies/μL。

Positive control P2-L1: consists of plasmid HPV18-L1, plasmid HPV52-L1, plasmid HPV58-L1, plasmid HPV68-L1 and sample treatment liquid, wherein the concentration of the four plasmids is 10 ⁴ Copies/μL。

Positive control P3-L1: consists of plasmid HPV45-L1, plasmid HPV82-L1, plasmid HPV33-L1, plasmid HPV35-L1 and sample treatment liquid, wherein the concentration of the four plasmids is 10 ⁴ Copies/μL。

Positive control P4-L1: consists of plasmid HPV39-L1, plasmid HPV51-L1, plasmid HPV59-L1, plasmid HPV66-L1 and sample treatment liquid, wherein the concentration of the four plasmids are all 10 ⁴ Copies/μL。

Positive control P5-L1: consists of plasmid HPV26-L1, plasmid HPV53-L1, plasmid HPV73-L1 and sample treatment liquid, wherein the concentrations of the three plasmids are all 10 ⁴ Copies/μL。

Fourthly, assembling of the kit

The components of the kit are as follows:

PCR reaction solution C1;

PCR reaction solution C2;

PCR reaction solution C3;

PCR reaction solution C4;

PCR reaction solution C5;

PCR reaction solution B;

a positive control P1-L1;

a positive control P2-L1;

a positive control P3-L1;

a positive control P4-L1;

a positive control P5-L1;

negative control: a sample processing liquid.

Fifth, using method of kit

Refer to step five of example 1.

Sixthly, sensitivity of kit

18 plasmids: plasmid HPV16-L1, plasmid HPV56-L1, plasmid HPV31-L1, plasmid HPV18-L1, plasmid HPV52-L1, plasmid HPV58-L1, plasmid HPV68-L1, plasmid HPV45-L1, plasmid HPV82-L1, plasmid HPV33-L1, plasmid HPV35-L1, plasmid HPV39-L1, plasmid HPV51-L1, plasmid HPV59-L1, plasmid HPV66-L1, plasmid HPV26-L1, plasmid HPV53-L1 and plasmid HPV73-L1 prepared in the third step.

The 18 plasmids were diluted with TE buffer solutions, respectively, to give 18 standard solutions at a concentration of 100 Copies/. mu.L.

And (4) respectively taking each standard solution as a template solution, adopting the kit prepared in the step four, and operating according to the using method of the kit. Each standard solution was subjected to 20 replicates.

The results are shown in Table 7.

TABLE 7

HPV type	Detection limit reference product detection rate	HPV type	Detection limit reference product detection rate
				16	95％	52	15％
18	45％	53	60％
				26	65％	56	75％
31	30％	58	50％
				33	85％	59	45％
35	45％	66	15％
				39	40％	68	10％
45	25％	73	70％
				51	20％	82	35％

Seventh, negative rate of coincidence

19 negative reference samples were obtained from the China food and drug testing research institute (Cat No. 360002, lot No. 360002-201602). 19 negative reference products are: HPV6, HPV11, HPV40, HPV42, HPV43, HPV44, HPV54, HPV61, HPV67, HPV69, HPV70, HPV71, HPV72, HPV81, HPV83, Ureaplasma Urealyticum (UU), Chlamydia Trachomatis (CT), herpes simplex virus type 2 (HSV2), human Cytomegalovirus (CMV).

And (5) adopting the kit prepared in the step four and operating according to the using method of the kit. Taking the primer probe set for detecting HPV16 as an example, 19 negative reference products are detected, wherein each reference product is detected 1 time, 19 times are detected, 10 times are negative, 9 times are positive, and therefore the negative coincidence rate is 52.63%.

The results are shown in Table 8.

TABLE 8

HPV type	Negative rate of agreement	HPV type	Negative rate of agreement
				16	52.63％	52	100％
18	73.68％	53	42.11％
				26	68.42％	56	84.21％
31	57.89％	58	100％
				33	100％	59	100％
35	84.21％	66	94.74％
				39	89.47％	68	100％
45	73.68％	73	100％
				51	100％	82	100％

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

SEQUENCE LISTING

<110> Beijing kang Mei Tianhong Biotech Co., Ltd

<120> primer probe set and kit for detecting human papillomavirus based on real-time fluorescent quantitative PCR

<130> GNCYX201952

<160> 76

<170> PatentIn version 3.5

<210> 1

<211> 22

<212> DNA

<213> Artificial sequence

<400> 1

aaagcaaaga catctggaca aa 22

<210> 2

<211> 22

<212> DNA

<213> Artificial sequence

<400> 2

tctacgtgtt ctcgatgatc tg 22

<210> 3

<211> 26

<212> DNA

<213> Artificial sequence

<400> 3

gtggaccggt cgatgtatgt cttgtt 26

<210> 4

<211> 22

<212> DNA

<213> Artificial sequence

<400> 4

agcaattgca ttgtgacaga aa 22

<210> 5

<211> 24

<212> DNA

<213> Artificial sequence

<400> 5

ggttctctag atgtttgtct ccag 24

<210> 6

<211> 24

<212> DNA

<213> Artificial sequence

<400> 6

taatagcaca tggttggacc gggt 24

<210> 7

<211> 21

<212> DNA

<213> Artificial sequence

<400> 7

aaccgttgtg tccagaagaa a 21

<210> 8

<211> 23

<212> DNA

<213> Artificial sequence

<400> 8

acgaggtctt ctccaacata cta 23

<210> 9

<211> 24

<212> DNA

<213> Artificial sequence

<400> 9

ataggaggaa ggtggacagg acgt 24

<210> 10

<211> 19

<212> DNA

<213> Artificial sequence

<400> 10

cacaacatag ctgggcact 19

<210> 11

<211> 19

<212> DNA

<213> Artificial sequence

<400> 11

tgtttctctg cgtcgttgg 19

<210> 12

<211> 24

<212> DNA

<213> Artificial sequence

<400> 12

caaccgagca cgacaggaaa gact 24

<210> 13

<211> 22

<212> DNA

<213> Artificial sequence

<400> 13

acatgttaat gcaaacaagc ga 22

<210> 14

<211> 20

<212> DNA

<213> Artificial sequence

<400> 14

gggtctccaa cactctgaac 20

<210> 15

<211> 18

<212> DNA

<213> Artificial sequence

<400> 15

gggtcgttgg acagggcg 18

<210> 16

<211> 18

<212> DNA

<213> Artificial sequence

<400> 16

ggcatgtgga tttaaaca 18

<210> 17

<211> 20

<212> DNA

<213> Artificial sequence

<400> 17

cacttgtgtt tgtctacgtc 20

<210> 18

<211> 24

<212> DNA

<213> Artificial sequence

<400> 18

ggtcgttgga cagggcgctg tgca 24

<210> 19

<211> 22

<212> DNA

<213> Artificial sequence

<400> 19

agcaggaaac tttacaggac ag 22

<210> 20

<211> 20

<212> DNA

<213> Artificial sequence

<400> 20

ttcttgacgt atgcgtctgc 20

<210> 21

<211> 24

<212> DNA

<213> Artificial sequence

<400> 21

cactgctgga ccagtaagcg agag 24

<210> 22

<211> 22

<212> DNA

<213> Artificial sequence

<400> 22

ggcaacactg caagaaattg ta 22

<210> 23

<211> 21

<212> DNA

<213> Artificial sequence

<400> 23

tcctcctctg actcgcttaa t 21

<210> 24

<211> 26

<212> DNA

<213> Artificial sequence

<400> 24

tcctgttgac ctgttgtgtt acgagc 26

<210> 25

<211> 24

<212> DNA

<213> Artificial sequence

<400> 25

gtgctacatt agaggccatt acta 24

<210> 26

<211> 19

<212> DNA

<213> Artificial sequence

<400> 26

tttgtcgtcc accaccttt 19

<210> 27

<211> 24

<212> DNA

<213> Artificial sequence

<400> 27

agagaccact tgggcctgaa gaaa 24

<210> 28

<211> 24

<212> DNA

<213> Artificial sequence

<400> 28

acgacatgtg gatttaaaca aacg 24

<210> 29

<211> 20

<212> DNA

<213> Artificial sequence

<400> 29

tttctctacg tcgggacctc 20

<210> 30

<211> 25

<212> DNA

<213> Artificial sequence

<400> 30

taatatttcg ggtcgttggg caggg 25

<210> 31

<211> 21

<212> DNA

<213> Artificial sequence

<400> 31

cgattccata acatcggtgg a 21

<210> 32

<211> 21

<212> DNA

<213> Artificial sequence

<400> 32

ctcggtttct ctacgtgttg g 21

<210> 33

<211> 24

<212> DNA

<213> Artificial sequence

<400> 33

aggtcggtgt atgtcctgtt ggaa 24

<210> 34

<211> 20

<212> DNA

<213> Artificial sequence

<400> 34

acccgaccat gcagttaatc 20

<210> 35

<211> 22

<212> DNA

<213> Artificial sequence

<400> 35

gtatcccgtg aggcttctac ta 22

<210> 36

<211> 26

<212> DNA

<213> Artificial sequence

<400> 36

gggaagaacc acagcgtcac acaata 26

<210> 37

<211> 20

<212> DNA

<213> Artificial sequence

<400> 37

cacgaacgct gcatgaatta 20

<210> 38

<211> 25

<212> DNA

<213> Artificial sequence

<400> 38

tacaatacac acacactacc tgtat 25

<210> 39

<211> 27

<212> DNA

<213> Artificial sequence

<400> 39

gtgaagcttt gaacgtttct atgcaca 27

<210> 40

<211> 22

<212> DNA

<213> Artificial sequence

<400> 40

gactacagac aagtgggaag tg 22

<210> 41

<211> 22

<212> DNA

<213> Artificial sequence

<400> 41

ttgctcagaa gatccagaag tg 22

<210> 42

<211> 24

<212> DNA

<213> Artificial sequence

<400> 42

atgtgcagta ccagtgacga gcaa 24

<210> 43

<211> 20

<212> DNA

<213> Artificial sequence

<400> 43

aacaattgca ctgtgaacat 20

<210> 44

<211> 21

<212> DNA

<213> Artificial sequence

<400> 44

gtagcttgtc tactcgtatg t 21

<210> 45

<211> 26

<212> DNA

<213> Artificial sequence

<400> 45

gacgatttca ttatatagca tatgca 26

<210> 46

<211> 22

<212> DNA

<213> Artificial sequence

<400> 46

gacagctcag atgaggatga aa 22

<210> 47

<211> 25

<212> DNA

<213> Artificial sequence

<400> 47

cacatacaac attgtgcttc aattc 25

<210> 48

<211> 24

<212> DNA

<213> Artificial sequence

<400> 48

aggccagaca agctggacaa gaag 24

<210> 49

<211> 22

<212> DNA

<213> Artificial sequence

<400> 49

gaataaacca ttgctggagc tg 22

<210> 50

<211> 23

<212> DNA

<213> Artificial sequence

<400> 50

acccgtctct atacactact ctt 23

<210> 51

<211> 24

<212> DNA

<213> Artificial sequence

<400> 51

gctgtgtgtt ctgcaagaag gcat 24

<210> 52

<211> 21

<212> DNA

<213> Artificial sequence

<400> 52

ttactgactg cacgaagtgt c 21

<210> 53

<211> 23

<212> DNA

<213> Artificial sequence

<400> 53

cctagtgtac ccataagcaa ctc 23

<210> 54

<211> 24

<212> DNA

<213> Artificial sequence

<400> 54

agtgcacagt atgccttgcc attg 24

<210> 55

<211> 23

<212> DNA

<213> Artificial sequence

<400> 55

ggtgtgaacc atgagaagta tga 23

<210> 56

<211> 22

<212> DNA

<213> Artificial sequence

<400> 56

gagtccttcc acgataccaa ag 22

<210> 57

<211> 24

<212> DNA

<213> Artificial sequence

<400> 57

agatcatcag caatgcctcc tgca 24

<210> 58

<211> 120

<212> DNA

<213> Human Papillomavirus

<400> 58

tgtgtcctga agaaaagcaa agacatctgg acaaaaagca aagattccat aatataaggg 60

gtcggtggac cggtcgatgt atgtcttgtt gcagatcatc gagaacacgt agagaaaccc 120

<210> 59

<211> 140

<212> DNA

<213> Human Papillomavirus

<400> 59

tgtcaaagtc cgttaactcc ggaggaaaag caattgcatt gtgacagaaa aagacgattt 60

catctaatag cacatggttg gaccgggtca tgtttggggt gctggagaca aacatctaga 120

gaacctagag aatctacagt 140

<210> 60

<211> 130

<212> DNA

<213> Human Papillomavirus

<400> 60

tgtcaaaaac cgttgtgtcc agaagaaaaa caaagacatt tggataaaaa gagacgattc 60

cacaacatag gaggaaggtg gacaggacgt tgcatagtat gttggagaag acctcgtact 120

gaaacccaag 130

<210> 61

<211> 100

<212> DNA

<213> Human Papillomavirus

<400> 61

aaacgacgat tccacaacat agctgggcac tatagaggcc agtgccattc gtgctgcaac 60

cgagcacgac aggaaagact ccaacgacgc agagaaacac 100

<210> 62

<211> 110

<212> DNA

<213> Human Papillomavirus

<400> 62

tgtcctgaag aaaaagaaag acatgttaat gcaaacaagc gatttcataa tattatgggt 60

cgttggacag ggcgctgttc agagtgttgg agaccccgac ctgtgaccca 110

<210> 63

<211> 120

<212> DNA

<213> Human Papillomavirus

<400> 63

ttgtgtccac aagaaaaaaa aaggcatgtg gatttaaaca aaaggtttca taatatttcg 60

ggtcgttgga cagggcgctg tgcagtgtgt tggagacccc gacgtagaca aacacaagtg 120

<210> 64

<211> 100

<212> DNA

<213> Human Papillomavirus

<400> 64

cgaagattac ataaaatagc aggaaacttt acaggacagt gtcggcactg ctggaccagt 60

aagcgagagg accgcagacg catacgtcaa gaaacacaag 100

<210> 65

<211> 181

<212> DNA

<213> Human Papillomavirus

<400> 65

atgcatggac cccgggcaac actgcaagaa attgtattgc atttggaacc tcagaatgaa 60

ttagatcctg ttgacctgtt gtgttacgag caattaagcg agtcagagga ggaaaacgat 120

gaagcagatg gagttagtca tgcacaacta ccagcccgac gagccgaacc acagcgtcac 180

a 181

<210> 66

<211> 198

<212> DNA

<213> Human Papillomavirus

<400> 66

gcagtatgca aaaaatgctt gatgttttat tctagaatta gagaatacag aaggtatagt 60

aggtctgtgt atggtgctac attagaggcc attactaaca aaagtttata tgaattatta 120

ataaggtgtc atagatgtca gagaccactt gggcctgaag aaaagcaaaa ggtggtggac 180

gacaaaaaaa ggtttcat 198

<210> 67

<211> 120

<212> DNA

<213> Human Papillomavirus

<400> 67

ttgtgtcctc aagaaaaaaa acgacatgtg gatttaaaca aacgttttca taatatttcg 60

ggtcgttggg cagggcgctg tgcggcgtgt tggaggtccc gacgtagaga aactgcactg 120

<210> 68

<211> 120

<212> DNA

<213> Human Papillomavirus

<400> 68

tgtgtccagt tgaaaagcaa agacatttag aagaaaaaaa acgattccat aacatcggtg 60

gacggtggac aggtcggtgt atgtcctgtt ggaaaccaac acgtagagaa accgaggtgt 120

<210> 69

<211> 181

<212> DNA

<213> Human Papillomavirus

<400> 69

aatagatgaa cccgaccatg cagttaatca ccaacatcaa ctactagcca gacgggaaga 60

accacagcgt cacacaatac agtgttcgtg ttgtaagtgt aacaacacac tgcagctggt 120

agtagaagcc tcacgggata ctctgcgaca actacagcag ctgtttatgg actcactagg 180

a 181

<210> 70

<211> 170

<212> DNA

<213> Human Papillomavirus

<400> 70

ccacgaacgc tgcatgaatt atgtgaagct ttgaacgttt ctatgcacaa tatacaggta 60

gtgtgtgtgt attgtaaaaa ggaattatgt agagcagatg tatataatgt agcatttact 120

gaaattaaga ttgtatatag ggataataat ccatatgcag tatgcaaaca 170

<210> 71

<211> 188

<212> DNA

<213> Human Papillomavirus

<400> 71

acttttgggg actatattat aaagtggaag aggaacaggt gtactatgta aaatttatac 60

atgatgccaa aaaatatggg actacagaca agtgggaagt gcattataat ggcaaggtta 120

ttgattgtta tgactctatg tgcagtacca gtgacgagca agtatccact tctggatctt 180

ctgagcaa 188

<210> 72

<211> 120

<212> DNA

<213> Human Papillomavirus

<400> 72

ccggaggaaa aacaattgca ctgtgaacat aaaagacgat ttcattatat agcatatgca 60

tggaccgggt catgtttgca gtgttggaga catacgagta gacaagctac agaatctaca 120

<210> 73

<211> 180

<212> DNA

<213> Human Papillomavirus

<400> 73

tggactatga acaatttgac agctcagatg aggatgaaac agataatatg cgtgaccagc 60

aggccagaca agctggacaa gaagtgtgtt acagaattga agcacaatgt tgtatgtgta 120

atagtatagt gcagctagct gtgcagagca gtcgacagaa cgttcgagtg ctggagcaga 180

<210> 74

<211> 193

<212> DNA

<213> Human Papillomavirus

<400> 74

atgtgaagtt gtgaataaac cattgctgga gctgcaactt ggctgtgtgt tctgcaagaa 60

ggcattaaca gcttcagagg tatataattt tgcatataca gatttaagag tagtgtatag 120

agacgggtat ccgtatggag tgtgcaagtt ctgtttgcta ttttatagta aggtccgaaa 180

attaagatat tac 193

<210> 75

<211> 180

<212> DNA

<213> Human Papillomavirus

<400> 75

atgaggatga aacagacagc catctagaca gacaagctga acgagagtgt tacagaatag 60

ttactgactg cacgaagtgt cagtgcacag tatgccttgc cattgaaagc aacaaagctg 120

atttaagagt gatagaagag ttgcttatgg gtacactagg tattgtgtgc cccaactgtt 180

<210> 76

<211> 197

<212> DNA

<213> Human Papillomavirus

<400> 76

catgttcgtc atgggtgtga accatgagaa gtatgacaac agcctcaaga tcatcagcaa 60

tgcctcctgc accaccaact gcttagcacc cctggccaag gtcatccatg acaactttgg 120

tatcgtggaa ggactcatga ccacagtcca tgccatcact gccacccaga agactgtgga 180

tggcccctcc gggaaac 197

Claims

1. A primer probe combination comprising 18 primer probe sets as follows:

the primer probe group for detecting the HPV52 consists of a primer HPV-52-F shown in a sequence 13 in a sequence table, a primer HPV-52-R shown in a sequence 14 in the sequence table and a probe HPV-52-P shown in a sequence 15 in the sequence table;

the primer probe group for detecting the HPV68 consists of a primer HPV-68-F shown in a sequence 19 in a sequence table, a primer HPV-68-R shown in a sequence 20 in the sequence table and a probe HPV-68-P shown in a sequence 21 in the sequence table;

the primer probe group for detecting the HPV39 consists of a primer HPV-39-F shown in a sequence 34 in a sequence table, a primer HPV-39-R shown in a sequence 35 in the sequence table and a probe HPV-39-P shown in a sequence 36 in the sequence table;

the primer probe group for detecting the HPV73 consists of a primer HPV-73-F shown in a sequence 52 of a sequence table, a primer HPV-73-R shown in a sequence 53 of the sequence table and a probe HPV-73-P shown in a sequence 54 of the sequence table.

2. The primer probe combination of claim 1, wherein: the primer probe combination also comprises a primer probe group for detecting an internal reference gene; the primer probe set for detecting the internal reference gene consists of a primer GAPDH-F shown in a sequence 55 of a sequence table, a primer GAPDH-R shown in a sequence 56 of the sequence table and a probe GAPDH-P shown in a sequence 57 of the sequence table.

3. The primer probe combination of claim 2, wherein:

the primer probe combination consists of the following 5 combinations:

a combination of a primer probe set for detecting HPV26, a primer probe set for detecting HPV53, and a primer probe set for detecting HPV 73;

in each combination, different probes employ different fluorophores.

4. Use of a primer probe combination according to any one of claims 1 to 3 for the preparation of a kit; the function of the kit is as follows (b1), (b2), (b3), (b4), (b5) or (b 6):

(b1) detecting whether the subject is a HPV-infected subject;

(b2) screening for HPV infected persons;

(b3) typing HPV infected by the HPV infected person;

(b4) detecting whether the subject is a high-risk type HPV infected person;

(b5) screening a high-risk HPV infected person;

(b6) typing the HPV infected by the high-risk type HPV infected persons.

5. Use of a primer probe combination according to any one of claims 1 to 3 for the preparation of a kit; the function of the kit is as follows (c1), (c2), (c3) or (c 4):

(c1) identifying the HPV;

(c2) typing the HPV;

(c3) identifying high-risk HPV;

(c4) and (4) typing the high-risk HPV.

6. A kit comprising the primer probe combination of any one of claims 1 to 3.

7. A kit comprises a PCR reaction solution A1, a PCR reaction solution A2, a PCR reaction solution A3, a PCR reaction solution A4 and a PCR reaction solution A5;

composition of PCR reaction a 2: 10 XPCR Buffer, 25mM MgCl ₂ dNTP/dUTP Mix, bovine serum albumin, a primer HPV-18-F, a primer HPV-18-R, a probe HPV-18-P, a primer HPV-52-F, a primer HPV-52-R, a probe HPV-52-P, a primer HPV-58-F, a primer HPV-58-R, a probe HPV-58-P, a primer HPV-68-F, a primer HPV-68-R, a probe HPV-68-P and the balance of water;

composition of PCR reaction solution a 4: 10 XPCR Buffer, 25mM MgCl ₂ dNTP/dUTP Mix, bovine serum albumin, a primer HPV-39-F, a primer HPV-39-R, a probe HPV-39-P, a primer HPV-51-F, a primer HPV-51-R, a probe HPV-51-P, a primer HPV-59-F, a primer HPV-59-R, a probe HPV-59-P, a primer HPV-66-F, a primer HPV-66-R, a probe HPV-66-P and the balance of water;

composition of PCR reaction a 5: 10 XPCR Buffer, 25mM MgCl ₂ dNTP/dUTP Mix, bovine serum albumin, a primer HPV-26-F, a primer HPV-26-R, a probe HPV-26-P, a primer HPV-53-F, a primer HPV-53-R, a probe HPV-53-P, a primer HPV-73-F, a primer HPV-73-R, a probe HPV-73-P and the balance of water;

each of the primers and probes is the primer and probe described in claim 1 or claim 2.

8. The kit of claim 7, wherein: the kit also comprises a PCR reaction solution B;

composition of PCR reaction solution B: taq DNA polymerase and UDG enzyme.