CN112195230A - Gene detection reagent, kit, detection method and application for clozapine personalized medication guidance - Google Patents
Gene detection reagent, kit, detection method and application for clozapine personalized medication guidance Download PDFInfo
- Publication number
- CN112195230A CN112195230A CN202010981604.4A CN202010981604A CN112195230A CN 112195230 A CN112195230 A CN 112195230A CN 202010981604 A CN202010981604 A CN 202010981604A CN 112195230 A CN112195230 A CN 112195230A
- Authority
- CN
- China
- Prior art keywords
- seq
- detecting
- nucleotide sequence
- sequence shown
- clozapine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Pathology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a gene detection reagent, a kit, a detection method and application for clozapine personalized medication guidance, wherein the gene detection reagent comprises specific primers and probes for detecting rs377360, rs4773794, rs10512698, rs116982346, rs73482673, rs9808117, rs373695, rs7501702 and rs8024434 gene polymorphism detection sites. The gene detection reagent, the kit, the detection method and the application for the individual administration guidance of clozapine can quickly, accurately and specifically detect the polymorphism of the related gene of the individual administration of the clozapine medicine, realize the individual administration guidance of the clozapine, reduce the adverse reaction of common clinical clozapine medicine administration, reduce the medical cost and save social resources.
Description
Technical Field
The invention belongs to the technical field of gene detection, and particularly relates to a gene detection reagent, a kit, a detection method and application for clozapine personalized medication guidance.
Background
Schizophrenia is a group of serious psychosis with unknown etiology, which is usually caused slowly or subacute in young and strong years, and is clinically manifested as syndromes with different symptoms, and involves various disorders such as sensory perception, thinking, emotion and behavior, and uncoordinated mental activities. The patient is generally aware of the clear and normal intelligence, but some patients suffer from impairment of cognitive function during the course of the disease. The course of the disease generally extends, and the disease is repeatedly attacked, aggravated or worsened, and some patients finally suffer from decline and mental disability, but some patients can keep a healing or basically healing state after treatment.
Clozapine acts on the central nervous system, has a strong antipsychotic effect and also has a sedative effect, and is a novel broad-spectrum psychotropic drug. Clozapine has been found to be an effective treatment for individuals with schizophrenia who are resistant to treatment with other anti-psychotic drugs. However, clozapine has unique side effects, including life-threatening agranulocytosis (despite low incidence), induction of myocarditis, increased risk of pulmonary embolism, and dose-dependent seizures, and so forth, and thus many considerations are required in using, detecting, and managing the side effects of the drug.
The market is currently lacking in products for testing resistance to the anti-schizophrenia drug clozapine. The baseline predictor for anti-schizophrenic resistance, considered by the investigators as predictive of anti-schizophrenic resistance, was examined but not significantly effective. In the united states, the FDA requires regular monitoring and registration of reported neutrophil counts for all patients who use clozapine. The method can safely use the clozapine and simultaneously avoid death caused by lack of granulocytes caused by the clozapine. However, this method requires frequent testing of patients by professional clinicians, and consumes a lot of manpower and material resources due to long-term attention.
Disclosure of Invention
The invention solves the technical problem of providing a gene detection reagent, a kit, a detection method and application for clozapine personalized medication guidance, which can quickly, accurately and specifically determine the polymorphism of related genes of clozapine personalized medication, realize clozapine personalized medication guidance, reduce the adverse reaction of common clinical clozapine medication administration, reduce medical cost and save social resources.
In order to solve the problems, one aspect of the invention provides a gene detection reagent for clozapine personalized medication guidance, which comprises specific primers and probes for detecting rs377360, rs4773794, rs10512698, rs116982346, rs73482673, rs9808117, rs373695, rs7501702 and rs8024434 gene polymorphism detection sites.
Further, the gene detection reagent is used for predicting the risk of adverse reactions of leucopenia and/or granulocytopenia caused by clozapine administration.
Preferably, the specific forward primer for detecting rs377360 has the sequence as shown in SEQ ID NO: 1, and the specific reverse primer for detecting rs377360 has the nucleotide sequence shown in SEQ ID NO: 2;
the nucleotide sequence of SEQ ID NO: 1 has the following sequence structure:
TTTCCTTTGAGCATCATGTTGGCA。
the nucleotide sequence of SEQ ID NO: 2 has the following sequence structure:
TCCTACCCGACATTTCGTAAGTGG。
the specific forward primer for detecting rs4773794 has the sequence shown in SEQ ID NO: 3, and the specific reverse primer for detecting rs4773794 has the nucleotide sequence shown in SEQ ID NO: 4;
the nucleotide sequence of SEQ ID NO: 3 has the following sequence structure:
AAGGAAGGGGGTTTATGT。
the nucleotide sequence of SEQ ID NO: 4 has the following sequence structure:
TCTTTGCTGGGAATGTGT。
the specific forward primer for detecting rs10512698 has the sequence shown in SEQ ID NO: 5, and the specific reverse primer for detecting rs10512698 has a nucleotide sequence shown in SEQ ID NO: 6;
the nucleotide sequence of SEQ ID NO: 5 has the following sequence structure:
TGCGTGTTAGCAGTGCGAT。
the nucleotide sequence of SEQ ID NO: 6 has the following sequence structure:
CCAATGCCCCAGGTCAAAG。
the specific forward primer for detecting rs116982346 has the sequence shown in SEQ ID NO: 7, and a specific reverse primer for detecting rs116982346 has a nucleotide sequence shown as SEQ ID NO: 8;
the nucleotide sequence of SEQ ID NO: 7 has the following sequence structure:
TTTACAGAACTACAAAGAGAAACCAT。
the nucleotide sequence of SEQ ID NO: the sequence structure of 8 is as follows:
CTTCTAACCCTTTTACAGTATAACAG。
the specific forward primer for detecting rs73482673 has the sequence shown in SEQ ID NO: 9, and the specific reverse primer for detecting rs73482673 has the nucleotide sequence shown as SEQ ID NO: 10;
the nucleotide sequence of SEQ ID NO: the sequence structure of 9 is as follows:
CATTTTAAGAACTACCTATCAAC。
the nucleotide sequence of SEQ ID NO: 10 has the following sequence structure:
CACCTCCTAATACTATCACCCTG。
the specific forward primer for detecting rs9808117 has the sequence shown in SEQ ID NO: 11, and a specific reverse primer for detecting rs9808117 has a nucleotide sequence shown in SEQ ID NO: 12;
the nucleotide sequence of SEQ ID NO: 11 has the following sequence structure:
TACAACTGTCCAGATGATTCC。
the nucleotide sequence of SEQ ID NO: 12 the sequence structure is as follows:
ATGGAGATAATGTTCCTTCGT。
the specific forward primer for detecting rs373695 has the sequence shown in SEQ ID NO: 13, and the specific reverse primer for detecting rs373695 has the nucleotide sequence shown as SEQ ID NO: 14;
the nucleotide sequence of SEQ ID NO: 13 has the following sequence structure:
AGCCAACATTTGTTGCATACC。
the nucleotide sequence of SEQ ID NO: 14 has the following sequence structure:
GGTGCCCTCATCCATAATACG。
the specific forward primer for detecting rs7501702 has the sequence shown in SEQ ID NO: 15, and the specific reverse primer for detecting rs7501702 has the nucleotide sequence shown in SEQ ID NO: 16;
the nucleotide sequence of SEQ ID NO: 15 has the following sequence structure:
TTGAGAAGCAGAAGCAGGAAGAA。
the nucleotide sequence of SEQ ID NO: 16 has the following sequence structure:
CCAACCACCCAGAGAAACTAGGA。
the specific forward primer for detecting rs8024434 has the sequence shown in SEQ ID NO: 17, and a specific reverse primer for detecting rs8024434 has a nucleotide sequence shown as SEQ ID NO: 18;
the nucleotide sequence of SEQ ID NO: 17 has the following sequence structure:
GCAACAGAATAAGTGGCA。
the nucleotide sequence of SEQ ID NO: 18 has the following sequence structure: .
TGAGGAAGACGGGAGGAT。
Preferably, the wild type probe used for detecting rs377360 has the sequence as set forth in SEQ ID NO: 19 for detecting rs377360 mutant type probe has the nucleotide sequence shown in SEQ ID NO: 20(T-a) or SEQ ID NO: 21 (T-G);
the nucleotide sequence of SEQ ID NO: 19 has the following sequence structure:
TGGAGCATTTCCAATTTCAGAT。
the nucleotide sequence of SEQ ID NO: 20 has the following sequence structure:
TGGAGCATTACCAATTTCAGAT。
the nucleotide sequence of SEQ ID NO: 21 has the following sequence structure:
TGGAGCATTGCCAATTTCAGAT。
the wild-type probe used for detecting rs4773794 has the nucleotide sequence as shown in SEQ ID NO: 22 for detecting rs4773794 mutant probe having the nucleotide sequence shown in SEQ ID NO: 23;
the nucleotide sequence of SEQ ID NO: 22 has the following sequence structure:
ACTAGAGGGTTTCCTAGACACATTCCCA。
the nucleotide sequence of SEQ ID NO: 23 has the following sequence structure:
AGCACTAGAGAGTTTCCTAGACACATT。
the wild-type probe for detecting rs10512698 has the sequence as shown in SEQ ID NO: 24, and the mutant probe for detecting rs10512698 has the nucleotide sequence shown in SEQ ID NO: 25;
the nucleotide sequence of SEQ ID NO: the sequence structure of 24 is as follows:
TCACCATTTATTCCACTTTGCTCACT。
the nucleotide sequence of SEQ ID NO: 25 has the following sequence structure:
TCACCATTTAGTCCACTTTGCTCACT。
the wild-type probe for detecting rs116982346 has the nucleotide sequence as shown in SEQ ID NO: 26 for detecting rs116982346 mutant probe having the nucleotide sequence shown in SEQ ID NO: 27;
the nucleotide sequence of SEQ ID NO: 26 has the following sequence structure:
AGTTGCTGTGCTGGGCTCTGGC。
the nucleotide sequence of SEQ ID NO: 27 has the following sequence structure:
AGTTGCTCTGCTGGGCTCTGGC。
the wild-type probe for detecting rs73482673 has the sequence as shown in SEQ ID NO: 28 for detecting rs73482673 has the nucleotide sequence shown in SEQ ID NO: 29;
the nucleotide sequence of SEQ ID NO: 28 the sequence structure is as follows:
TCAACATGGTATAAATATACCATAAT。
the nucleotide sequence of SEQ ID NO: 29 has the following sequence structure:
TCAACATAGTATAAATATACCATAAT。
the wild-type probe for detecting rs9808117 has the sequence as set forth in SEQ ID NO: 30 for detecting rs9808117 mutant probe having the nucleotide sequence shown in SEQ ID NO: 31;
the nucleotide sequence of SEQ ID NO: 30 has the following sequence structure:
ATTTGCAACACGAAGGAACAT。
the nucleotide sequence of SEQ ID NO: 31 is as follows:
ATTTGTAACACGAAGGAACAT。
the wild-type probe for detecting rs373695 has the nucleotide sequence as set forth in SEQ ID NO: 32, and the mutant probe for detecting rs373695 has the nucleotide sequence shown in SEQ ID NO: 33;
the nucleotide sequence of SEQ ID NO: 32 has the following sequence structure:
TGCATACCTACAATGTTTCAGGGACAT。
the nucleotide sequence of SEQ ID NO: 33 has the following sequence structure:
TGCATACCTACAGTGTTTCAGGGACAT。
the wild-type probe for detecting rs7501702 has the sequence as shown in SEQ ID NO: 34, and the mutant probe for detecting rs7501702 has the nucleotide sequence shown as SEQ ID NO: 35;
the nucleotide sequence of SEQ ID NO: 34 is as follows:
TGGGGCGATGGTGACCCCAGT。
the nucleotide sequence of SEQ ID NO: 35 is as follows:
TGGAGCGATGGTGACCCCAGT。
the wild-type probe for detecting rs8024434 has the nucleotide sequence as shown in SEQ ID NO: 36 for detecting rs8024434 has a mutant probe with a nucleotide sequence shown in SEQ ID NO: 37(a-G) or SEQ ID NO: 38(a-T) or SEQ ID NO: 39 (A-C);
the nucleotide sequence of SEQ ID NO: 36 has the following sequence structure:
AAATGGATCCACATGTGTATCTAAT。
the nucleotide sequence of SEQ ID NO: 37 has the following sequence structure:
AAGTGGATCCACATGTGTATCTAAT。
the nucleotide sequence of SEQ ID NO: 38 has the following sequence structure:
AATTGGATCCACATGTGTATCTAAT。
the nucleotide sequence of SEQ ID NO: 39 has the following sequence structure:
AACTGGATCCACATGTGTATCTAAT。
in another aspect of the invention, the invention provides a gene detection kit for clozapine personalized medicine guidance, which comprises the gene detection reagent for clozapine personalized medicine guidance.
Preferably, the gene detection kit is used for predicting the risk of adverse reactions of clozapine induced leukopenia and/or granulocytopenia.
Preferably, the kit further comprises PCR reagents, wherein the PCR reagents comprise:
PCR reaction buffer, dNTP and UNG enzyme.
Preferably, every 25uL of the PCR reagent contains: 2.5uL 10 XPCR reaction buffer, 2uL dNTPs, 0.25uL UNG enzyme.
In still another aspect, the invention provides an application of a detection reagent for detecting at least one of the polymorphic detection sites of the rs377360, rs4773794, rs10512698, rs116982346, rs73482673, rs9808117, rs373695, rs7501702 and rs8024434 genes in preparation of a gene detection kit for clozapine personalized medication guidance.
Preferably, the use is in the manufacture of a gene detection kit for predicting the risk of an adverse reaction of leukopenia and/or granulocytopenia with clozapine.
In a further aspect of the present invention, there is provided a method for detecting a polymorphism of a gene related to the personalized medication of clozapine for non-diagnostic purposes, using the above gene detection kit for the personalized medication guidance of clozapine, comprising: and carrying out PCR amplification on the extracted DNA by using the primers, the probe and the PCR reagent, and obtaining a corresponding genotyping result according to an amplification product.
Preferably, the method specifically comprises the following steps:
s1, extracting DNA of a sample to be detected;
s2, performing PCR amplification on the extracted DNA by using the primers, the probes and the PCR reagent;
s3, detecting an amplification product of the sample to be detected by using a real-time fluorescence quantitative PCR instrument, and judging the genotype of the locus; if the fluorescence of the wild probe has the logarithmic increase of fluorescence and the Ct value is less than or equal to 30.0, the site has no mutation; if the fluorescence of the mutant probe has logarithmic increase and Ct value is less than or equal to 30.0, the site has the mutation.
Preferably, the amplification conditions of the PCR amplification are:
firstly, pre-denaturation is carried out for 10min at 95 ℃; then denaturation is carried out for 10s at 95 ℃; then renaturation is carried out for 60s at the temperature of 60 ℃; for a total of 45 cycles.
Compared with the prior art, the invention has the following beneficial effects:
the invention discovers for the first time that the polymorphism of the gene loci rs377360, rs4773794, rs10512698, rs116982346, rs73482673, rs9808117, rs373695, rs7501702 and rs8024434 is closely related to the individual administration of clozapine, and the gene loci of the patient are determined to be genotypic, so that the clinical schizophrenia administration can be guided through analysis, and the adverse drug reactions such as granulocyte deficiency and the like caused by clozapine can be avoided while the patient uses the clozapine safely. The invention also designs corresponding PCR primers and probes aiming at the gene loci, establishes corresponding amplification conditions, and can determine the genotypes of the corresponding gene loci by utilizing the corresponding primers and probes through a real-time fluorescence PCR technology.
Detailed Description
The technical solutions of the present invention will be described clearly and completely with reference to the following embodiments of the present invention, and it should be understood that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
Examples 1 correlation of rs377360, rs4773794, rs10512698, rs116982346, rs73482673, rs9808117, rs373695, rs7501702, rs8024434 with the individualized administration of clozapine drug
Selection of polymorphic sites of genes related to adverse reaction of leucopenia and/or granulocytopenia caused by clozapine
The invention firstly utilizes a whole genome scanning method to carry out whole genome genotyping on schizophrenia patients (an experimental group has adverse reactions such as leucopenia and/or granulocytopenia during 225 cases of medication and a control group has no related adverse reactions during 1654 cases of medication) treated by clozapine drugs, utilizes main components to analyze the population stratification condition of samples and groups the population stratification condition, determines that the population genetic backgrounds of the analyzed experimental group and the control group samples are mutually matched, and eliminates the influence of the inherent population stratification on the result. Meanwhile, in order to improve the statistical efficiency, different statistical models are adopted for frequent and rare variation. For common variations (minor allele frequency [ MAF ] > 1%), we used a fixed effect model. For rare variations, we used the Cochran-Mantel-Haenszel assay. 9 polymorphic loci which are related to the global positive (P <5E-08) of the leucopenia and/or granulocytopenia caused by clozapine are screened, 9 gene loci are rs377360, DCT rs4773794, EEFSEC rs10512698, rs116982346, rs73482673, HECW2 rs9808117, F13A 1rs 373695, rs7501702 and NEO 1rs 8024434, and the basic information is shown in the following table 1. Table 2 shows the results of analysis of 9 SNPs in individual clozapine medication, and the influence of carrying the relevant allele on the incidence of clozapine-induced leukopenia and/OR granulocytopenia was determined by calculating the ratio of the alleles (OR).
TABLE 19 basic information on polymorphic sites
| SNP | Chromosome and location information | Alleles |
| rs377360 | 14:22553337 | T>A |
| DCT rs4773794 | 13:94469234 | G>A |
| EEFSEC rs10512698 | 3:128246727 | T>G |
| rs116982346 | 3:108867260 | G>C |
| rs73482673 | 9:24121613 | G>A |
| HECW2 rs9808117 | 2:196246131 | C>T |
| F13A1 rs373695 | 6:6184119 | A>G |
| rs7501702 | 17:19390414 | G>A |
| NEO1 rs8024434 | 15:73255386 | A>C |
TABLE 2 analysis results of 9 SNPs in clozapine personalized medicine
| SNP | OR(95％) | P-value |
| rs377360 | 2.19[1.66-2.89] | 2.58E-08 |
| DCT(rs4773794) | 12.79[4.56-35.87] | 3.01E-10 |
| EEFSEC(rs10512698) | 4.79[2.64-8.67] | 1.09E-08 |
| rs116982346 | 19.96[7.00-56.90] | 2.15E-08 |
| rs73482673 | 12.05[4.98-29.15] | 3.30E-08 |
| HECW2(rs9808117) | 9.10[3.58-23.15] | 9.82E-09 |
| F13A1(rs373695) | 74.83[6.15-910.70] | 1.36E-08 |
| rs7501702 | 14.95[3.89-57.41] | 1.76E-08 |
| NEO1(rs8024434) | 19.39[4.76-78.94] | 4.83E-08 |
Design of primer and probe
For each of the above gene loci, Primer design was performed using Primer software. By iterative comparative analysis, according to, but not limited to, the following principles: primer-1) length 17-25 base; 2) GC content is 40-60%; 3) the Tm values of the two primers are as close as possible; 4) individual fractions avoid GC rich or AT rich (especially 3' end), avoid T/C continuous, A/G continuous; 5) the terminal base of the 3' end is prevented from being T as much as possible; 6) determining primer specificity by using UCSC In-silica PCR retrieval; probe-1) length 20-25 bp; 2) the Tm value is 8-10 ℃ higher than that of the primer; 3) selecting regions of the target sequence with relatively high GC content, avoiding GC rich or AT rich (especially 3' end) in individual parts, avoiding T/C continuity and A/C continuity; 4) the first base at the 5' end of the probe cannot be G. Primers and probes specific to the PCR reaction were finally designed as shown in Table 3 below.
TABLE 3 primers and probes for each Gene site
Third, verification of correlation
1. Study object
Experimental groups: and 225 cases.
The 225 schizophrenic patients presented WBCs during clozapine treatment<4,000mm-3Or ANC<1,500mm-3And the other malignant diseases (such as lung cancer, gastric cancer, intestinal cancer, lymphoma, leukemia, breast cancer, cervical cancer and the like) are not caused.
Control group: 1654 example(s).
No WBC were present in 1654 cases of schizophrenia during the treatment with clozapine<4,000mm-3Or ANC<1,500mm-3And the other malignant diseases (such as lung cancer, gastric cancer, intestinal cancer, lymphoma, leukemia, breast cancer, cervical cancer and the like) are not caused.
TABLE 4 study object information
| Experimental group | Control group | |
| Number of samples | 225 | 1654 |
| Average age (year of age) | 39.3±12.7 | 36.2±12.7 |
| Proportion of women (%) | 58.7 | 38.5 |
2. Association analysis
Peripheral venous blood of the study subjects of the experimental group and the control group was extracted by 5ml, respectively, and placed in an EDTANA2 anticoagulation tube to obtain blood samples. And extracting the genomic DNA of the blood sample by using a Flexi Gene DNA extraction kit, detecting the quality of the obtained genomic DNA by using a standard agarose gel electrophoresis technology, and detecting the concentration of the genomic DNA by using NanoDrop.
(1) Genotyping
The primers and the probes are used for genotyping detection by adopting a real-time fluorescent PCR technology.
The method comprises the following specific steps:
the method comprises the following steps: taking DNA extracted from a sample to be detected as a PCR template;
step two: providing the kit, taking out a proper amount of PCR reaction solution, wherein the composition of the PCR reaction solution is shown in table 5, and uniformly mixing the PCR reaction solution and a proper amount of PCR template;
step three: carrying out PCR amplification reaction under the following conditions: firstly, pre-denaturation is carried out for 10min at 95 ℃; then denaturation is carried out for 10s at 95 ℃; then renaturation is carried out for 60s at the temperature of 60 ℃; for a total of 45 cycles.
Analyzing and judging the amplification result: in a real-time fluorescence PCR reaction system of a sample, the fluorescence of a wild probe has the logarithmic increase of fluorescence, and when the Ct value is less than or equal to 30.0, the site has no mutation; if the fluorescence of the mutant probe in the real-time fluorescence PCR reaction system of the sample has the fluorescence logarithmic increase and the Ct value is less than or equal to 30.0, the site is mutated.
TABLE 5 real-time fluorescent PCR reaction System
(2) Correlation analysis
Quality control of blood samples and SNP levels was performed prior to association analysis. And finally, performing Principal Component Analysis (PCA) of the population, and checking the matching degree of the experimental group and the control group. The study, after quality control, finally contained 225 experimental and 1654 control groups, with a total of 9 SNPs finally included for statistics.
TABLE 69 genotype frequencies of SNPs in the Experimental group and the control group (%)
Hardy-Weinberg genetic equilibrium test statistics were performed on the 9-site genotype frequencies, and the genotype frequencies were calculated using the mutant/heterozygous/wild-type to whole-genotype ratios for the experimental and control groups, respectively. Table 6 shows the genotype frequencies of 9 SNPs in the experimental group and the control group, and from the results in table 6, it can be seen that, among the three genotypes of rs377360, the proportion of heterozygous individuals in the experimental group is higher than that in the control group, the proportion of mutant individuals in the experimental group is higher than that in the control group, and the proportion of wild individuals in the experimental group is lower than that in the control group; rs4773794, the heterozygous individuals in the experimental group have higher proportion than the control group, the mutant individuals in the experimental group have higher proportion than the control group, and the wild individuals in the experimental group have lower proportion than the control group; of the three genotypes of rs10512698, the proportion of heterozygous individuals in the experimental group is higher than that in the control group, and the proportion of wild individuals in the experimental group is lower than that in the control group; of the three genotypes of rs116982346, the proportion of heterozygous individuals in the experimental group is higher than that of the control group, and the proportion of wild individuals in the experimental group is lower than that of the control group; of the three genotypes of rs73482673, the proportion of heterozygous individuals in the experimental group is higher than that of the control group, and the proportion of wild individuals in the experimental group is lower than that of the control group; of the three genotypes of rs9808117, the heterozygous individual has a higher proportion in the experimental group than in the control group, and the wild type individual has a lower proportion in the experimental group than in the control group; of the three genotypes of rs373695, the proportion of heterozygous individuals in the experimental group is higher than that of the control group, and the proportion of wild individuals in the experimental group is lower than that of the control group; of the three genotypes of rs7501702, the proportion of heterozygous individuals in the experimental group is higher than that of the control group, and the proportion of wild individuals in the experimental group is lower than that of the control group; of the three genotypes of rs8024434, the heterozygous individual has a higher proportion in the experimental group than in the control group, and the wild type individual has a lower proportion in the experimental group than in the control group. The 9 SNP sites are all SNP sites related to clozapine administration.
TABLE 79 allele frequencies of SNPs in case group and control group (%)
Table 7 shows the allele frequencies of 9 SNPs in the case group and the control group, which were calculated by obtaining the wild-type gene frequency by genotyping, obtaining the mutant gene frequency from (1-wild-type gene frequency), and the variation was the difference between the two wild-type/mutant gene frequencies. From the results in table 7, it can be seen that the ratio of the mutant gene frequency of rs377360 in the experimental group is 9.81% higher than the frequency of the genotype in the control group, indicating that the risk genotype of rs377360 is mutant; the ratio of the frequency of the mutant gene of rs4773794 in the experimental group is 2.4% higher than the frequency of the genotype in the control group, which indicates that the risk genotype of rs4773794 is mutant; the ratio of the frequency of the mutant gene of rs10512698 in the experimental group is 3.41% higher than the frequency of the genotype in the control group, which indicates that the risk genotype of rs10512698 is mutant; the proportion of the frequency of the mutant gene of rs116982346 in the experimental group is 12.41 percent higher than the frequency of the genotype in the control group, which indicates that the risk genotype of rs116982346 is mutant; the ratio of the mutant gene frequency of rs73482673 in the experimental group is 8.01% higher than the frequency of the genotype in the control group, which indicates that the risk genotype of rs73482673 is mutant; the ratio of the frequency of the mutant gene of rs9808117 in the experimental group is 7.85 percent higher than the frequency of the genotype in the control group, which indicates that the risk genotype of rs9808117 is mutant; the ratio of the frequency of the mutant gene of rs373695 in the experimental group is 2.71 percent higher than the frequency of the genotype in the control group, which indicates that the risk genotype of rs373695 is mutant; the ratio of the mutant gene frequency of rs7501702 in the experimental group is 7.96% higher than the frequency of the genotype in the control group, which indicates that the risk genotype of rs7501702 is mutant; the ratio of the frequency of the mutant gene of rs8024434 in the experimental group is 5.12% higher than the frequency of the genotype in the control group, indicating that the risk genotype of rs8024434 is mutant.
The experiments prove that the individual administration of the clozapine medicine can be guided by rs377360, rs4773794, rs10512698, rs116982346, rs73482673, rs9808117, rs373695, rs7501702 and rs 8024434.
It should be understood that the above examples are only for clarity of illustration and are not intended to limit the embodiments. Other variations and modifications will be apparent to persons skilled in the art in light of the above description. And are neither required nor exhaustive of all embodiments. And obvious variations or modifications therefrom are within the scope of the invention.
SEQUENCE LISTING
<110> affiliated Hospital of Qingdao university
Shanghai Mental Health Center, (Shanghai Psychological Counseling Training Center)
<120> gene detection reagent, kit, detection method and application for clozapine personalized medication guidance
<130> 2020
<160> 39
<170> PatentIn version 3.3
<210> 1
<211> 24
<212> DNA
<213> Artificial sequence
<400> 1
tttcctttga gcatcatgtt ggca 24
<210> 2
<211> 24
<212> DNA
<213> Artificial sequence
<400> 2
tcctacccga catttcgtaa gtgg 24
<210> 3
<211> 18
<212> DNA
<213> Artificial sequence
<400> 3
aaggaagggg gtttatgt 18
<210> 4
<211> 18
<212> DNA
<213> Artificial sequence
<400> 4
tctttgctgg gaatgtgt 18
<210> 5
<211> 19
<212> DNA
<213> Artificial sequence
<400> 5
tgcgtgttag cagtgcgat 19
<210> 6
<211> 19
<212> DNA
<213> Artificial sequence
<400> 6
ccaatgcccc aggtcaaag 19
<210> 7
<211> 26
<212> DNA
<213> Artificial sequence
<400> 7
tttacagaac tacaaagaga aaccat 26
<210> 8
<211> 26
<212> DNA
<213> Artificial sequence
<400> 8
cttctaaccc ttttacagta taacag 26
<210> 9
<211> 23
<212> DNA
<213> Artificial sequence
<400> 9
cattttaaga actacctatc aac 23
<210> 10
<211> 23
<212> DNA
<213> Artificial sequence
<400> 10
cacctcctaa tactatcacc ctg 23
<210> 11
<211> 21
<212> DNA
<213> Artificial sequence
<400> 11
tacaactgtc cagatgattc c 21
<210> 12
<211> 21
<212> DNA
<213> Artificial sequence
<400> 12
atggagataa tgttccttcg t 21
<210> 13
<211> 21
<212> DNA
<213> Artificial sequence
<400> 13
agccaacatt tgttgcatac c 21
<210> 14
<211> 21
<212> DNA
<213> Artificial sequence
<400> 14
ggtgccctca tccataatac g 21
<210> 15
<211> 23
<212> DNA
<213> Artificial sequence
<400> 15
ttgagaagca gaagcaggaa gaa 23
<210> 16
<211> 23
<212> DNA
<213> Artificial sequence
<400> 16
ccaaccaccc agagaaacta gga 23
<210> 17
<211> 18
<212> DNA
<213> Artificial sequence
<400> 17
gcaacagaat aagtggca 18
<210> 18
<211> 18
<212> DNA
<213> Artificial sequence
<400> 18
tgaggaagac gggaggat 18
<210> 19
<211> 22
<212> DNA
<213> Artificial sequence
<400> 19
tggagcattt ccaatttcag at 22
<210> 20
<211> 22
<212> DNA
<213> Artificial sequence
<400> 20
tggagcatta ccaatttcag at 22
<210> 21
<211> 22
<212> DNA
<213> Artificial sequence
<400> 21
tggagcattg ccaatttcag at 22
<210> 22
<211> 28
<212> DNA
<213> Artificial sequence
<400> 22
actagagggt ttcctagaca cattccca 28
<210> 23
<211> 27
<212> DNA
<213> Artificial sequence
<400> 23
agcactagag agtttcctag acacatt 27
<210> 24
<211> 26
<212> DNA
<213> Artificial sequence
<400> 24
tcaccattta ttccactttg ctcact 26
<210> 25
<211> 26
<212> DNA
<213> Artificial sequence
<400> 25
tcaccattta gtccactttg ctcact 26
<210> 26
<211> 22
<212> DNA
<213> Artificial sequence
<400> 26
agttgctgtg ctgggctctg gc 22
<210> 27
<211> 22
<212> DNA
<213> Artificial sequence
<400> 27
agttgctctg ctgggctctg gc 22
<210> 28
<211> 26
<212> DNA
<213> Artificial sequence
<400> 28
tcaacatggt ataaatatac cataat 26
<210> 29
<211> 26
<212> DNA
<213> Artificial sequence
<400> 29
tcaacatagt ataaatatac cataat 26
<210> 30
<211> 21
<212> DNA
<213> Artificial sequence
<400> 30
atttgcaaca cgaaggaaca t 21
<210> 31
<211> 21
<212> DNA
<213> Artificial sequence
<400> 31
atttgtaaca cgaaggaaca t 21
<210> 32
<211> 27
<212> DNA
<213> Artificial sequence
<400> 32
tgcataccta caatgtttca gggacat 27
<210> 33
<211> 27
<212> DNA
<213> Artificial sequence
<400> 33
tgcataccta cagtgtttca gggacat 27
<210> 34
<211> 21
<212> DNA
<213> Artificial sequence
<400> 34
tggggcgatg gtgaccccag t 21
<210> 35
<211> 21
<212> DNA
<213> Artificial sequence
<400> 35
tggagcgatg gtgaccccag t 21
<210> 36
<211> 25
<212> DNA
<213> Artificial sequence
<400> 36
aaatggatcc acatgtgtat ctaat 25
<210> 37
<211> 25
<212> DNA
<213> Artificial sequence
<400> 37
aagtggatcc acatgtgtat ctaat 25
<210> 38
<211> 25
<212> DNA
<213> Artificial sequence
<400> 38
aattggatcc acatgtgtat ctaat 25
<210> 39
<211> 25
<212> DNA
<213> Artificial sequence
<400> 39
aactggatcc acatgtgtat ctaat 25
Claims (10)
1. A gene detection reagent for clozapine personalized medication guidance is characterized by comprising specific primers and probes for detecting rs377360, rs4773794, rs10512698, rs116982346, rs73482673, rs9808117, rs373695, rs7501702 and rs8024434 gene polymorphism detection sites.
2. The gene assaying reagent for clozapine personalized medication guidance according to claim 1, wherein:
the specific forward primer for detecting rs377360 has the sequence shown in SEQ ID NO: 1, and the specific reverse primer for detecting rs377360 has the nucleotide sequence shown in SEQ ID NO: 2;
the specific forward primer for detecting rs4773794 has the sequence shown in SEQ ID NO: 3, and the specific reverse primer for detecting rs4773794 has the nucleotide sequence shown in SEQ ID NO: 4;
the specific forward primer for detecting rs10512698 has the sequence shown in SEQ ID NO: 5, and the specific reverse primer for detecting rs10512698 has a nucleotide sequence shown in SEQ ID NO: 6;
the specific forward primer for detecting rs116982346 has the sequence shown in SEQ ID NO: 7, and a specific reverse primer for detecting rs116982346 has a nucleotide sequence shown as SEQ ID NO: 8;
the specific forward primer for detecting rs73482673 has the sequence shown in SEQ ID NO: 9, and the specific reverse primer for detecting rs73482673 has the nucleotide sequence shown as SEQ ID NO: 10;
the specific forward primer for detecting rs9808117 has the sequence shown in SEQ ID NO: 11, and a specific reverse primer for detecting rs9808117 has a nucleotide sequence shown in SEQ ID NO: 12;
the specific forward primer for detecting rs373695 has the sequence shown in SEQ ID NO: 13, and the specific reverse primer for detecting rs373695 has the nucleotide sequence shown as SEQ ID NO: 14;
the specific forward primer for detecting rs7501702 has the sequence shown in SEQ ID NO: 15, and the specific reverse primer for detecting rs7501702 has the nucleotide sequence shown in SEQ ID NO: 16;
the specific forward primer for detecting rs8024434 has the sequence shown in SEQ ID NO: 17, and a specific reverse primer for detecting rs8024434 has a nucleotide sequence shown as SEQ ID NO: 18, or a nucleotide sequence shown in the specification.
3. The gene assaying reagent for clozapine personalized medication guidance according to claim 2, which is characterized in that:
the wild-type probe for detecting rs377360 has the sequence as shown in SEQ ID NO: 19 for detecting rs377360 mutant type probe has the nucleotide sequence shown in SEQ ID NO: 20 or SEQ ID NO: 21;
the wild-type probe used for detecting rs4773794 has the nucleotide sequence as shown in SEQ ID NO: 22 for detecting rs4773794 mutant probe having the nucleotide sequence shown in SEQ ID NO: 23;
the wild-type probe for detecting rs10512698 has the sequence as shown in SEQ ID NO: 24, and the mutant probe for detecting rs10512698 has the nucleotide sequence shown in SEQ ID NO: 25;
the wild-type probe for detecting rs116982346 has the nucleotide sequence as shown in SEQ ID NO: 26 for detecting rs116982346 mutant probe having the nucleotide sequence shown in SEQ ID NO: 27;
the wild-type probe for detecting rs73482673 has the sequence as shown in SEQ ID NO: 28 for detecting rs73482673 has the nucleotide sequence shown in SEQ ID NO: 29;
the wild-type probe for detecting rs9808117 has the sequence as set forth in SEQ ID NO: 30 for detecting rs9808117 mutant probe having the nucleotide sequence shown in SEQ ID NO: 31;
the wild-type probe for detecting rs373695 has the nucleotide sequence as set forth in SEQ ID NO: 32, and the mutant probe for detecting rs373695 has the nucleotide sequence shown in SEQ ID NO: 33;
the wild-type probe for detecting rs7501702 has the sequence as shown in SEQ ID NO: 34, and the mutant probe for detecting rs7501702 has the nucleotide sequence shown as SEQ ID NO: 35;
the wild-type probe for detecting rs8024434 has the nucleotide sequence as shown in SEQ ID NO: 36 for detecting rs8024434 has a mutant probe with a nucleotide sequence shown in SEQ ID NO: 37 or SEQ ID NO: 38 or SEQ ID NO: 39.
4. A gene detection kit for clozapine personalized medicine guidance, which comprises the gene detection reagent for clozapine personalized medicine guidance as described in any one of claims 1 to 3.
5. The gene detection kit for clozapine personalized medication guidance according to claim 4, further comprising PCR reagents comprising:
PCR reaction buffer, dNTP and UNG enzyme.
6. The gene detection kit for clozapine personalized medication guidance as claimed in claim 5, characterized in that:
every 25uL of the PCR reagent contains: 2.5uL 10 XPCR reaction buffer, 2uL dNTPs, 0.25uL UNG enzyme.
7. The application of the detection reagent for detecting at least one of the polymorphic detection sites of the rs377360, rs4773794, rs10512698, rs116982346, rs73482673, rs9808117, rs373695, rs7501702 and rs8024434 genes in preparing the gene detection kit for the personalized medication guidance of clozapine.
8. A method for detecting clozapine personalized medicine related gene polymorphism for non-diagnostic purpose, which is performed by using the gene detection kit for clozapine personalized medicine guidance according to any one of claims 4 to 6, comprising: and carrying out PCR amplification on the extracted DNA by using the primers, the probe and the PCR reagent, and obtaining a corresponding genotyping result according to an amplification product.
9. The method for detecting the polymorphism of the gene related to the personalized medication of clozapine as claimed in claim 8, which comprises the following steps:
s1, extracting DNA of a sample to be detected;
s2, performing PCR amplification on the extracted DNA by using the primers, the probes and the PCR reagent;
s3, detecting an amplification product of the sample to be detected by using a real-time fluorescence quantitative PCR instrument, and judging the genotype of the locus; if the fluorescence of the wild probe has the logarithmic increase of fluorescence and the Ct value is less than or equal to 30.0, the site has no mutation; if the fluorescence of the mutant probe has logarithmic increase and Ct value is less than or equal to 30.0, the site has the mutation.
10. The method for detecting the polymorphism of the gene related to the individualized medication of clozapine according to claim 8, wherein the amplification conditions of the PCR amplification are as follows:
firstly, pre-denaturation is carried out for 10min at 95 ℃; then denaturation is carried out for 10s at 95 ℃; then renaturation is carried out for 60s at the temperature of 60 ℃; for a total of 45 cycles.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010981604.4A CN112195230B (en) | 2020-09-17 | 2020-09-17 | Gene detection reagent, kit, detection method and application for clozapine personalized medication guidance |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010981604.4A CN112195230B (en) | 2020-09-17 | 2020-09-17 | Gene detection reagent, kit, detection method and application for clozapine personalized medication guidance |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112195230A true CN112195230A (en) | 2021-01-08 |
| CN112195230B CN112195230B (en) | 2022-08-23 |
Family
ID=74015325
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010981604.4A Active CN112195230B (en) | 2020-09-17 | 2020-09-17 | Gene detection reagent, kit, detection method and application for clozapine personalized medication guidance |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112195230B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005118848A1 (en) * | 2004-06-04 | 2005-12-15 | Novartis Ag | Biomarkers for the prediction of responsiveness to clozapine treatment |
| CN105861686A (en) * | 2016-05-06 | 2016-08-17 | 上海交通大学 | Kit for testing clozapine application effect based on rs2032582 and application method of kit |
| CN105925679A (en) * | 2016-05-06 | 2016-09-07 | 上海交通大学 | Kit for detecting medication effects of clozapine and risperidone by virtue of rs4680 polymorphism |
-
2020
- 2020-09-17 CN CN202010981604.4A patent/CN112195230B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005118848A1 (en) * | 2004-06-04 | 2005-12-15 | Novartis Ag | Biomarkers for the prediction of responsiveness to clozapine treatment |
| CN105861686A (en) * | 2016-05-06 | 2016-08-17 | 上海交通大学 | Kit for testing clozapine application effect based on rs2032582 and application method of kit |
| CN105925679A (en) * | 2016-05-06 | 2016-09-07 | 上海交通大学 | Kit for detecting medication effects of clozapine and risperidone by virtue of rs4680 polymorphism |
Non-Patent Citations (1)
| Title |
|---|
| 俞飞: "基因组调控区遗传变异与胃癌易感性的关联研究", 《中国优秀博硕士学位论文全文数据库(硕士) 医药卫生科技辑》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112195230B (en) | 2022-08-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Booij et al. | A gene expression pattern in blood for the early detection of Alzheimer's disease | |
| US20130079612A1 (en) | Methods for Creating Recommended Dietary Regime | |
| Bos et al. | A genome-wide linkage scan reveals CD53 as an important regulator of innate TNF-α levels | |
| EP2510115B1 (en) | Single nucleotide polymorphisms associated with dietary weight loss | |
| Reed et al. | Genome-wide scan for a healthy aging phenotype provides support for a locus near D4S1564 promoting healthy aging | |
| CN115948532A (en) | SMA detection kit based on digital PCR technology | |
| Liu et al. | Prenatal diagnosis of Chinese families with phenylketonuria | |
| Meguro et al. | Common variants in the COL4A4 gene confer susceptibility to lattice degeneration of the retina | |
| JP5828407B2 (en) | Test method for mental illness and test kit for mental illness | |
| CN112195230B (en) | Gene detection reagent, kit, detection method and application for clozapine personalized medication guidance | |
| Tanaka et al. | JAK2 46/1 haplotype is associated with JAK2 V617F-positive myeloproliferative neoplasms in Japanese patients | |
| Rębała et al. | Simple and rapid screening for HLA‐Cw* 06 in Polish patients with psoriasis | |
| Guan et al. | High‐resolution melting analysis for the rapid detection of an intronic single nucleotide polymorphism in SLC22A12 in male patients with primary gout in China | |
| KR101979633B1 (en) | SNP markers for metabolic syndrome and use thereof | |
| CN113584156B (en) | HCN4 mutant gene, mutant and Brugada syndrome detection kit | |
| CN113136387B (en) | Early-onset coronary heart disease related gene and detection reagent and application thereof | |
| EP2285981A1 (en) | Single nucleotide polymorphisms associated with dietary weight loss | |
| CN113621696A (en) | SNP marker and kit for detecting plateau adaptability | |
| CN108676871B (en) | Diagnostic marker for type II diabetes | |
| Kruse et al. | Frequency of thrombophilia-related genetic variations in patients with idiopathic pulmonary embolism in an urban emergency department | |
| Ding et al. | Identification of linkage disequilibrium SNPs from a Kidney-yang deficiency syndrome pedigree | |
| Mourtzi et al. | Association between 9p21–23 Locus and Frailty in a Community-Dwelling Greek Population: Results from the Hellenic Longitudinal Investigation of Ageing and Diet | |
| KR102018830B1 (en) | Genetic biomarker for the diagnosis of, and prediction for symptom severity of, fibromyalgia | |
| KR102346185B1 (en) | Biomarker for predicting skin pigmentation risk and use thereof | |
| Qiang et al. | Development of a mutation hotspot detection kit for the phenylalanine hydroxylase gene by ARMS-PCR combined with fluorescent probe technology |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |