CN112190719A - Application of animal model for controlling mechanism disorder by calcium in retinopathy - Google Patents

Abstract

The invention particularly relates to application of an animal model for controlling mechanism disorder by calcium in retinopathy, belonging to the field of research of medical animal models, wherein the animal model is constructed by inhibiting the activity of an SERCA2 gene expression product in a mouse body through gene mutation to cause the mechanism disorder by calcium regulation and cause the retinopathy of the mouse. The animal model for controlling the mechanism disorder by calcium mainly shows pericyte reduction, acellular capillary vessel increase and blood vessel density reduction in retinopathy, and can be applied to research on pathogenesis of retinopathy caused by type I diabetes, type II diabetes, hypertension or atherosclerosis and screening of drugs for preventing and treating the retinopathy.

Description

Application of animal model for controlling mechanism disorder by calcium in retinopathy

Technical Field

The invention belongs to the field of research of medical animal models, and relates to application of an animal model for controlling mechanism disorder by calcium regulation in retinopathy.

Background

Retinopathy is an important cause of visual impairment and blindness of working people, most commonly diabetic retinopathy and one of microvascular complications of diabetic patients. The international association for blindness has shown that there are approximately 1.45 million diabetic retinopathy patients worldwide in 2015, wherein the number of blind patients reaches 4500 million, which seriously affects the quality of life of the patients. However, there is currently no cure for this ocular complication. In the early stages of diabetic retinopathy, where no other histopathological changes occur, there is a selective loss of retinal cells, mainly manifested by pericyte loss, formation of acellular capillaries, glial degeneration and capillary rarefaction. Diabetic retinopathy is a complex multifactorial disease. Despite extensive and intensive research efforts by researchers in this field, the specific pathogenesis of diabetic retinopathy has not yet been fully elucidated. This is probably because many animal models of diabetic retinopathy are accompanied by sugar metabolism disorder, leading to the complication of their regulatory pathways, which has led to the fact that the truly key mechanism has not been discovered.

The good animal model is helpful to explore the pathogenesis of diabetic retinopathy and develop drug research and development aiming at the pathogenesis. The search of a new diabetic retinopathy animal model for researching the pathogenesis of retinopathy and the drug screening and evaluation by using the animal model is a problem to be solved urgently by scientific researchers in the field. The current diabetic retinopathy animal models include spontaneous diabetic animal models, experimental diabetic models and transgenic animal models, such as Streptozotocin (STZ) -induced diabetic rats, galactose-fed marmosets, transgenic and gene knockout mice and the like. The common diabetic retinopathy animal model mainly increases blood sugar, so that the research on the etiology of the diabetic retinopathy has certain limitations. The transgenic animal model is a man-made animal gene modification or transformation, is very suitable for researching the influence of single factors on morbidity, and is convenient to intervene in a confirmed mechanism. Compared with other animals, the mouse has small volume, strong reproductive capacity, short reproductive cycle, higher homology with human genome and convenient gene editing.

There are a number of reports in the literature that mitochondrial dysfunction, which in turn is associated with an imbalance in intracellular calcium homeostasis, has some relevance to the pathogenesis of diabetic retinopathyClosely related, it is currently unclear whether intracellular calcium disturbances lead to retinopathy. The primary function of sarcoplasmic/endoplasmic reticulum calcium ATPase (SERCA) is to convert the cytoplasmic Ca²⁺Uptake into the sarcoplasmic and endoplasmic reticulum, and maintenance of calcium homeostasis in the cell. In the retina, SERCA2 is its major subtype, including both SERCA2a and SERCA2b genotypes. No calcium disorders resulting from SERCA2 dysfunction have been reported to cause retinopathy.

Disclosure of Invention

In view of the above, an object of the present invention is to provide an application of an animal model for controlling mechanism disorders by calcium in retinopathy, and an object of the present invention is to provide an application of an animal model for controlling mechanism disorders by calcium in screening drugs for preventing and treating retinopathy.

In order to achieve the purpose, the invention provides the following technical scheme:

1. an application of animal model for controlling mechanism disorder by calcium in retinopathy is provided.

As one of the preferred technical solutions, the animal is a mouse.

As one of the preferred technical schemes, the calcium regulation mechanism disorder is specifically that the activity of an SERCA2 gene expression product in a mouse is inhibited through gene mutation.

As one of the preferable technical schemes, the gene mutation is specifically that 14 th exon of SERCA2 gene is mutated, wherein codon TGT is mutated into TCC, the codon TGT codes C674, and the codon TCC codes S674.

As one of the preferred technical schemes, the gene mutation can promote mitochondrion-mediated apoptosis.

As one of the preferred embodiments, the genetic mutation may result in activation of a cytoplasmic calcium-dependent signaling pathway.

As one of the preferred technical solutions, the retinopathy manifests itself as the formation of acellular blood vessels in the retina.

As one of the preferred solutions, the retinopathy manifests as a decrease in retinal capillaries.

As one of the preferred technical solutions, the retinopathy is retinopathy caused by type I diabetes, type II diabetes, hypertension or atherosclerosis.

2. An application of animal model for controlling mechanism disorder by calcium in screening medicine for preventing and treating retinopathy is disclosed.

As one of the preferred technical solutions, the retinopathy is retinopathy caused by type I diabetes, type II diabetes, hypertension or atherosclerosis.

The invention has the beneficial effects that:

the invention proves that the oxidative inactivation of C674 in the SERCA2 gene can induce retinopathy similar to type I diabetes mellitus under the condition of susceptibility of diabetes mellitus for the first time, mainly shows pericyte reduction, acellular capillary vessel increase and blood vessel density reduction, and provides a new molecular mechanism for the occurrence of type I diabetes retinopathy. Inactivation of C674 activates the retinal cell calcium-dependent signaling pathway, leading to apoptosis. The mechanism is not only suitable for type I diabetes, but also suitable for other diseases which can cause oxidative stress, such as type II diabetes, hypertension, atherosclerosis and other diseases which are easy to cause retinopathy clinically. These diseases can all cause oxidative inactivation of C674, resulting in Ca²⁺Regulation is disturbed, causing retinopathy. The animal model for controlling the mechanism disorder by calcium regulation established by the invention is helpful for deep research of intracellular Ca²⁺Regulating and controlling the relation and action mechanism of the disorder and the retinopathy and providing important support for the research and development of medicaments for preventing and treating the retinopathy.

Drawings

FIG. 1 is a schematic diagram of SKI mouse construction;

FIG. 2 shows the result of PCR screening positive embryonic stem cell clone;

FIG. 3 shows the cloning results of Southern blot positive embryonic stem cells;

FIG. 4 shows the results of PCR identification of F1 generation heterozygote SKI mice containing Neo sequence;

FIG. 5 shows the PCR identification result of a hetero-zygote SKI mouse containing FLP sequence and no Neo sequence;

FIG. 6 shows the results of SKI mouse cDNA sequencing;

FIG. 7 shows the identification result of SKI mouse genotype;

FIG. 8 is the irreversible oxidation of C674 (C674-SO) in SERCA2 in the retina of a model mouse with type I diabetes in Wild Type (WT) mice₃H) (A) C674-SO in SERCA2₃H staining results in retinal vascular network, (B) C674-SO in SERCA2₃H, staining statistical chart;

FIG. 9 shows the change in cell-free capillaries and pericytes following inactivation of C674 in SERCA2, (A) staining patterns of the retinal vascular network PAS in control wild-type WT and SKI mice, (B) the ratio of the number of Endothelial Cells (EC) to pericytes (pericytes), (C) the number of cell-free capillaries (AC);

FIG. 10 is a graph of retinal vascular density changes in the presence of C674 inactivation in SERCA2, (A) staining of retinal plaquettes isolectin IB4, (B) staining of frozen sections of the eyeball isolectin IB 4;

FIG. 11 shows the mRNA and SERCA2 protein expression of two gene subtypes of SERCA 2; (A) mRNA expression levels of SERCA2a and SERCA2B in the retina, (B) protein expression level of SERCA2 in the retina;

FIG. 12 is a graph of the results of western blot of calcium dependent signaling pathway-related proteins in retina, (A) of calcium dependent signaling pathway-related protein activity, (B) of retinal calcineurin activity, and (C) of apoptosis-related protein immunoblot with inactivation of C674 in SERCA 2.

Detailed Description

Hereinafter, specific embodiments of the present invention will be described in detail. Through the embodiments, the present invention can be more clearly understood by scientific researchers, and certain changes and modifications can be made on the basis of the embodiments to obtain different research effects of the experimental methods in the following embodiments, which are conventional methods unless otherwise specified. The reagents involved in the experimental process are all conventional reagents, and the use of the reagents is all referred to the product use instruction.

Example 1

In this embodiment, a method for constructing an animal model for controlling a mechanism disorder by calcium regulation provided by the present invention is described with a mouse as a target animal, and the specific steps are as follows:

(1) as shown in fig. 1, a coding sequence containing a mutated SERCA2 gene, exon 14 (substitution of codon encoding C674 to codon S674, i.e., TGT → TCC) and a neomycin (Neo) resistance gene (for embryonic stem cell screening) was inserted into the endogenous SERCA2 locus using DNA homologous recombination techniques.

The method comprises the following specific steps:

construction of 14.4kb gene homologous sequence containing exon 14 of SERCA2 gene (from C57BL/6J mouse genetic background) as targeting vector, which comprises 5 'end arm homologous to mouse SERCA2, exon 14 of SERCA2 gene containing mutation (C674 codon is replaced by S674 codon, i.e. TGT → TCC), expression frame of Neo resistance gene with loxP/FRT sites at both ends and 3' end arm homologous to mouse SERCA 2.

② the targeting vector is linearized by Not I restriction endonuclease and transferred into C57BL/6J mouse embryonic stem cells by electroporation.

And thirdly, screening by using G418 antibiotics, selecting positive monoclone with resistance to carry out amplification culture, and carrying out PCR identification and point mutation sequencing.

PCR primer sequence 1(5 '-3'):

LAN1：CCAGAGGCCACTTGTGTAGC(SEQ ID NO：1)

A3：TACGGAATACAGCTCGGCAGAAGC(SEQ ID NO：2)

PCR primer sequence 2(5 '-3'):

ATP5:CTATCAGTTCTCAATAGCCAATG(SEQ ID NO：3)

UNI：AGCGCATCGCCTTCTATCGCCTTC(SEQ ID NO：4)

the cloning point mutation of the recombinant embryonic stem cell is sequenced by using LA1 primer, the primer sequence and the sequencing result are shown as follows, the bold sequence is the mutation point, and ACA is mutated into GGA.

LA1 primer：LA1:5’-CTAGGTAGCACAGGCTTGCCTCAG(SEQ ID NO：5)

And (3) sequencing results:

GTGCCAGGATTATAGGCACACGTACACTGTTGTGTCGTGTAAGTCTAGCTAAAATCTTACCATAGCTGTGATCTCATCAAAGGACTGAAGGAACTCAACAATCTTAGACTTGTGGGAAGGTTCAACTCGAGCAAAGGAGCGGGCATTTAAGCAGGCATCTCTCTGGGCTGAAGGGCTTAATTCATCAAACTCTCGCCCTGTAAAAGCCTTTGATGTCACATCCTCATCCTGCCCAAAGATGCCAATGCGGCGACAGATGGCCACAGCGGTGCCTTTGTTGTCTCCAGTGATCATGATGACCCGGATGCCTGCTTGCCGGCACAGCTTCACAGAAGAGGCTACTTCAATCCTGGGAGGATCCAGCATGCCCACACAGCCGACGAAAGTCAGGTTGGTCTAAAGTGAGAGAGCCACATGAGCTCAAACAGCTTACCCCTACCCGAGTGTCCTGGCAGCTCACTCTTGCTACAACTGTGAGTTTGTCATTTTCTCTTTCT(SEQ ID NO：6)

the PCR identification results are shown in FIG. 2, and the embryonic stem cell clones 114, 231, 232, 264 and 372, which are all correctly recombined embryonic stem cell clones, are obtained by two PCR identifications and point mutation sequencing.

Fourthly, the positive clone identified by PCR is subjected to Southern blot secondary identification. The DNA was digested with either Avr II or EcoR I restriction enzymes, subjected to nucleic acid electrophoresis on a 0.8% agar gel, and then transferred to an NC membrane for nucleic acid hybridization with a DNA probe.

PB5/6 probe primer (Avr II endonuclease digested DNA):

PB5：5’-TTCGAAGTCTGCCTTCTGTGGAGA-3’(SEQ ID NO：7)

PB6：5’-ATTCAACCTGGGCTAGCCTCAAAC-3’(SEQ ID NO：8)

PB7/8 Probe primer (EcoR I endonuclease digested DNA):

PB7：5’-TTCCGTTACCTGGCTATTGGCTGT-3’(SEQ ID NO：9)

PB8：5’-AGGCAGAGGCCATTCCTCATCAAT-3’(SEQ ID NO：10)

the results are shown in FIG. 3, and a total of 4 correct recombinant embryonic stem cell clones, 114, 231, 264 and 372, which can be used for microinjection, were screened by Southern blot rescreening.

(2) The gene targeting embryonic stem cell positive clone which has undergone homologous recombination is injected into the blastocyst of a wild type Balb/C mouse. The born progeny chimera mouse is bred with a wild C57BL/6J mouse by mating, and the obtained progeny mouse is a F1 generation heterozygote SERCA 2C 674S gene mouse (hereinafter referred to as SKI mouse) containing a Neo sequence. F1 generation mice were identified using PCR technology:

PCR primer sequence 1(5 '-3'):

LAN1：CCAGAGGCCACTTGTGTAGC(SEQ ID NO：1)

A3：TACGGAATACAGCTCGGCAGAAGC(SEQ ID NO：2)

PCR primer sequence 2(5 '-3'):

A3：TACGGAATACAGCTCGGCAGAAGC(SEQ ID NO：2)

F3：GCATAAGCTTGGATCCGTTCTTCG GAC(SEQ ID NO：11)

PCR primer sequence 3(5 '-3'):

SQ1：CTTGTTTGAACCAAGGGCAAGCAG(SEQ ID NO：12)

F7：GGAACTTCGCTAGACTAGTACGCGTG(SEQ ID NO：13)

the results are shown in FIG. 4, where the mice numbered 6791 and 6784 were detected as positive, i.e., F1 generation of mice heterozygous SKI with Neo sequence.

(3) The Flippase (FLP) recombinase can recognize FRT sites at both ends of Neo, and cuts and recombines, so that the Neo sequence between two FRTs with the same sequence direction is cut off, and a FRT sequence is left. FLP transgenic mice with a C57BL/6J genetic background and F1 generation heterozygote SKI mice (containing a Neo sequence) are used for mating and breeding, and a Neo resistance gene expression frame is removed to obtain SKI mice (containing the FLP sequence) without the Neo sequence. And (3) mating and breeding the heterozygote SKI mice containing the FLP sequence and no Neo sequence with C57BL/6J mice, and removing the FLP recombinase to obtain the heterozygote SKI mice containing no FLP sequence and no Neo sequence.

As shown in FIG. 5, 6784 was bred by mating with FLP transgenic mice, and mice numbered 3751, 3752, 3753, 3754 and 3755 were obtained. Mice numbered 3753 and 3755 were heterozygous SKI mice containing the FLP sequence without the Neo sequence identified by PCR.

(4) Heterozygote SKI mice between heterozygotes are bred to obtain homozygote SKI mice. Mice are embryonic lethality due to homozygous SKI. The mice used in the present invention were all from the mating breeding of heterozygous SKI mice (50% C674 and 50% S674) and C57BL/6J mice, resulting in heterozygous SKI mice and their littermate control WT mice (100% C674). Heterozygote SKI mice were successfully knocked in with C674S as determined by cardiac tissue cDNA sequencing.

The cDNA sequencing results are shown below, the bold sequence is the mutant sequence, and TNN is the mutant point sequence.

ATTGGCATCTTTGGGCAGGATGAGGATGTGACATCAAAGGCTTTTACAGGGCGAG AGTTTGATGAATTAAGCCCTTCAGCCCAGAGAGATGCCTGCTTAAATGCCCGCTNN(TG T/TCC)TTTGCTCGAGTTGAACCTTCCCACAAG

Combining the sequencing map result of FIG. 6, it can be concluded that, through cDNA sequencing, codon TGT coding for cysteine (C) and codon TCC coding for serine (S) exist at position 674 in the constructed exon 14 nucleotide sequence of SKI mouse genome at the same time, and the kurtosis of the two codons is consistent, which indicates that half of codon TGT coding for C674 is mutated into codon TCC coding for S674, and the obtained mouse is determined to be a heterozygous SKI mouse.

Example 2

The heterozygote SKI mice obtained in example 1 were genotyped, and the method steps were as follows:

(1) the rat tail of a 20-day-old young mouse is taken and placed in a 1.5mL centrifuge tube.

(2) 200 μ l of 50mM NaOH was added to the centrifuge tube and heated in a metal bath at 98 ℃ for 1 h.

(3) After cooling at room temperature for 30min, 20. mu.l of 1M Tris-HCl buffer (pH 8.0) was added thereto, and the mixture was centrifuged at 12000g for 5min, and a small amount of the supernatant was used as a template for PCR amplification.

(4) PCR amplification reaction System:

SKI mouse identification primer sequences (5 '-3') are as follows:

Forward primer：CCACAAATGGCTCTCAGGTT(SEQ ID NO：14)

Reverse primer：CAGCTCTAGGCAGAGGGACT(SEQ ID NO：15)

and (3) PCR reaction conditions: pre-denaturation at 94 ℃ for 5 min; denaturation at 98 ℃ for 30s, annealing at 62 ℃ for 30s, and extension at 72 ℃ for 60s for 35 cycles; extending for 10min at 72 ℃, and storing at 4 ℃.

(5) Agarose gel electrophoresis

0.37g of agarose was weighed and dissolved in TBE buffer, and after thawing by microwave heating, 2.5. mu.l of GoldView nucleic acid dye was added to prepare 1.5% agarose gel. 10. mu.l of the PCR product was subjected to agarose electrophoresis at a constant voltage of 120V.

The results are shown in FIG. 7, and lanes 2-4 have a band between 100bp and 250bp, which is a WT mouse; two bands in lanes 1 and 5 are SKI mice.

Example 3

Construction of type I diabetic mouse model

WT mice and SKI mice of 10 weeks old were taken and set as a normal control group (citric acid solution) and a type I diabetes group (STZ solution), respectively, and SKI mice were set as a normal control group (citric acid solution) only. Each group of mice was injected with an equal volume of citric acid solution or STZ solution (50 mg/kg) intraperitoneally 1 time a day for 5 consecutive days. After one week and two weeks, when the blood sugar concentration is more than 250mg/dL, the diabetes mouse model is successfully established, and the materials are obtained after 14 weeks.

Example 4

All mice in example 3 were euthanized and the following assays were performed.

1. Retina digestion, the method steps are as follows:

(1) taking out the eyeball and placing the eyeball in 10% neutral formalin solution for fixation for 48 h; the eyeball was placed under a stereomicroscope, the cornea was cut off, the sclera was torn with forceps, and the retina was isolated for use.

(2) The retina is placed in a 3% trypsin solution, digested for 3h at 37 ℃, and gently blown to the retina until the inner limiting membrane is separated from the retina.

(3) The digestion was stopped by rinsing 2 times with PBS for 10min, replacing with a new 3% trypsin solution, digesting 1-2h at 37 ℃ until an intact retinal vascular network appeared.

(4) The retinal vascular network was transferred to a clean glass slide and dried overnight at room temperature for use.

The method for immunohistochemistry of the retinal vascular network comprises the following steps:

(1) infiltrating retinal vascular network with double distilled water and spreading for 1 min. Adding citric acid antigen repairing solution, and keeping the temperature at 98 ℃ for 40 min. Taking out after heat preservation, and standing at room temperature for 20 min.

(2) The double-distilled water is washed for 2 times, 5min each time, and rinsed for 5min by PBS. Incubate with 3% hydrogen peroxide solution for 10min and rinse again with PBS for 5 min.

(3) Sealing goat serum at room temperature for 1 h. SERCA 2C 674-SO was added₃H specific antibody, 4 degrees C overnight incubation.

(4) PBS rinse 3 times, 5min each time. Adding horseradish peroxidase-labeled secondary antibody, incubating for 30min, and rinsing with PBS for 3 times, 5min each time.

(5) DAB color development, hematoxylin nucleus staining, ethanol dehydration, xylene transparency, neutral resin sealing, and microscope observation and photographing.

Results as shown in a and B in fig. 8, irreversible oxidation of C674 in SERCA2 was significantly increased in type I diabetic mice compared to the control group, and it was presumed that the irreversible oxidation of C674 was involved in the progression of type I diabetic retinopathy.

2. The method comprises the following steps of PAS staining of a retinal blood vessel network:

(1) the retinal vascular network was plated and oxidized for 8min by immersing in periodic acid solution.

(2) Rinsing with distilled water for 5min for 2 times. The sections were immersed in Schiff's solution for 15min and rinsed several times with distilled water.

(3) Hematoxylin staining for 2min, and tap water returning to blue for 5 min.

(4) Dehydrating with 95% ethanol for 2min, dehydrating with anhydrous ethanol for 2min, removing xylene, and sealing with neutral resin.

(5) The sample is observed and photographed by a microscope, 10 areas are randomly selected, and the number of acellular capillaries, endothelial cells and pericytes is counted.

Results as shown by A, B, C in fig. 9, C674 inactivation increased the formation of acellular vessels in the retina and decreased the number of pericytes, similar to the results for type I diabetic mice, indicating that C674 inactivation induces retinopathy similar to type I diabetes.

3. The immunofluorescence staining method for the retina slide comprises the following steps:

(1) the eyeballs of WT mice and SKI mice were placed in 4% paraformaldehyde, fixed at room temperature for 1 hour, and then stored in methanol at-20 ℃.

(2) The retinas were separated, rinsed 3 times with PBS for 5min each, added with blocking solution (containing 1% BSA and 0.5% Triton X-100), and incubated overnight at 4 ℃.

(3) The vessel was labeled with isolectin IB4-FITC and incubated overnight at 4 ℃ with shaking.

(4) PBS rinse 3 times, 5min each time. The retinas were dissected under a microscope and transferred to glass slides, 75% glycerol mounted, and photographed under fluorescent upright microscope observation.

The results are shown in fig. 10, a, and indicate that inactivation of C674 results in a decrease in retinal capillaries, as compared to WT mice, with a decrease in retinal deep vascular network density in SKI mice.

4. Frozen section immunofluorescence, the concrete steps are as follows:

(1) fresh WT mice and SKI mice eyeballs are placed into 4% paraformaldehyde for fixation at room temperature for 2 hours, and then are placed into 30% sucrose solution for soaking for 2 hours. OCT embedding is carried out, and the obtained product is frozen in a refrigerator at the temperature of 80 ℃ below zero. The sections were taken in a cryomicrotome and were 10 μm thick.

(2) Selecting high-quality frozen slices, and placing in an oven for heat preservation at 37 ℃ for 30 min. Excess OCT was washed off with PBS and blocked in blocking solution (containing 1% BSA and 0.5% Triton X-100) for 1h at room temperature.

(3) Isonectin IB4-FITC fluorescent dye was added and incubated overnight at 4 ℃ with shaking.

(4) PBS rinse 3 times, 5min each time. DAPI was added and incubated at room temperature for 10 min. And sealing the 75% glycerol, and observing and photographing by a fluorescence upright microscope.

Results as shown in B in fig. 10, the number of retinal blood vessels in the frozen sections of SKI mice was significantly reduced compared to WT mice, further demonstrating that inactivation of C674 can promote retinal cell death.

5. Real-time quantitative PCR, the method comprises the following steps:

(1) the retinas of WT mice and SKI mice were rinsed several times with PBS, and 800. mu.l of Trizol reagent was added, homogenized under ice-bath conditions, transferred to another 1.5mL EP tube, and left at room temperature for 5 min.

(2) Add 200. mu.l chloroform, mix vigorously for 15s, and let stand at room temperature for 15 min.

(3) Sucking the upper water phase, adding equal volume of isopropanol, mixing by turning upside down, and storing at-20 ℃ overnight.

(4) Centrifuge at 12000g for 15min at 4 ℃ and discard the supernatant.

(5) Adding 1mL of 75% ethanol solution, reversing and mixing uniformly, washing the precipitate, centrifuging at 4 ℃ and 12000g for 15min, and removing the supernatant. Adding 1mL of absolute ethyl alcohol, mixing the mixture up and down, washing the precipitate, centrifuging the precipitate for 15min at 4 ℃ at 12000g, and removing the supernatant.

(6) Drying at room temperature for 5min, adding appropriate amount of DEPC water to dissolve precipitate to obtain total RNA.

(7) And (3) performing reverse transcription by adopting the total RNA as a template and adopting PCR to synthesize cDNA.

(8) Real-time quantitative PCR is carried out by adopting a Syber Green method, beta-actin is taken as an internal reference, and data are carried out 2^-ΔΔCtAnd (5) carrying out statistical analysis.

The primer sequences (5 '-3') are as follows:

SERCA2a

Forward primer：GATCCTCTACGTGGAACCTTTG(SEQ ID NO：16)

Reverse primer：GGTAGATGTGTTGCTAACAACG(SEQ ID NO：17)

SERCA2b

Forward primer：GATCCTCTACGTGGAACCTTTG(SEQ ID NO：16)

Reverse primer：CCACAGGGAGCAGGAAGAT(SEQ ID NO：18)

β-actin

Forward primer：AGAGGGAAATCGTGCGTGAC(SEQ ID NO：19)

Reverse primer：CAATAGTGATGACCTGGCCGT(SEQ ID NO：20)

the results are shown in fig. 11, a, where the major subtype of SERCA2 in the retina is SERCA2b, which is expressed in relative amounts of about 200 times that of SERCA2 a. At the mRNA level, SERCA2a and SERCA2b were not significantly different in the retinas of WT and SKI mice.

6. Immunoblotting, the method steps are as follows:

(1) the retinal tissues of WT mice and SKI mice were separated, placed in a 1.5mL centrifuge tube, and 100. mu.l of protein lysate RIPA was added thereto, and after the retinal tissues were disrupted by ultrasonication, they were lysed on ice for 30 min.

(2) Centrifuging at 12000g for 15min at 4 deg.C, transferring the supernatant to another centrifuge tube, adding 20 μ l 5X protein sample solution, mixing, and keeping the temperature at 60 deg.C for 30 min.

(3) Mu.l of each sample was subjected to SDS-PAGE at constant pressure of 80V and 120V.

(4) PVDF membrane was activated with methanol and placed in transfer membrane buffer. Peeling off the glue from the glass plate, sequentially placing the sponge, the filter paper, the glue, the PVDF membrane, the filter paper and the sponge from top to bottom, carefully discharging air bubbles, placing the materials into a membrane rotating groove, and rotating the membrane by adopting a constant current of 300mA for 2 hours.

(5) After a light TBST rinse, 5% skim milk was blocked for 1h at room temperature.

(6) Add primary antibody, incubate overnight at 4 deg.C, wash membrane 3 times with TBST, 10min each time.

(7) Adding corresponding secondary antibodies, incubating at room temperature for 1h, washing the membrane with TBST for 3 times, each time for 10 min.

(8) ECL chemiluminescence detection, protein detection using Bio-Rad chemiluminescence imaging system or X-ray film.

Detection of SERCA2, a calcium-dependent signaling pathway molecule, according to the immunoblotting method described above: calpain-1, VDAC1-T/D/M, and apoptotic pathways: expression of Bcl-2, Bcl-xL, Bad, Bax, Cl-Cas 3.

The results of SERCA2 expression are shown in fig. 11B, where there was no significant difference in protein expression of SERCA2 between WT and SKI mouse groups, indicating that inactivation of C674 did not affect SERCA2 protein expression.

The results of calcium-dependent signaling pathway molecule expression are shown in A and C in FIG. 12, and calceiurin protein expression in the retinas of SKI mice was not different from that of WT mice. VDAC1 is a hydrophilic voltage-gated channel mainly present on the outer membrane of mitochondria, which not only regulates Ca²⁺The entry and exit channels are also involved in the regulation of mitochondrial-mediated apoptosis. The up-regulation of calcium-dependent VDAC1 expression can promote the conversion of VDAC1 monomer into dimer, trimer and oligomer, its polyThe multimeric form may modulate the release of Bcl-2 family apoptotic proteins. Prolonged activation of VDAC1 can result in mitochondrial calcium overload, causing mitochondrial damage. Calpain-1 is a cytoplasmic calcium sensitive sensor, which is sensitive to intracellular Ca²⁺When the concentration is increased, the expression level is also up-regulated. If calpain-1 is activated for a long period of time, it triggers mitochondrial apoptotic pathways, leading to apoptosis. The protein expression levels of Calpain-1 and VDAC1 (monomer, dimer and trimer) are higher than that of WT mice, which shows that cytoplasmic Ca of retinal cells of SKI mice²⁺The concentration increased (a in fig. 12). In an apoptosis pathway, the expression of anti-apoptotic protein Bcl-xL is reduced in the retina of an SKI mouse, while the expression of pro-apoptotic proteins Bad, Bax and clear-caspase 3 is increased in the retina of the SKI mouse (C in figure 12), which indicates that C674 is inactivated to promote mitochondrion-mediated apoptosis, thereby causing retinopathy in the SKI mouse.

7. The method for detecting the activity of calcineurin (calceinin) is operated according to the instruction of a detection kit (A068-1-1) provided by Nanjing construction, and comprises the following steps:

(1) the retinas of WT mice and SKI mice were separated and placed in a 1.5mL EP tube, and then subjected to ultrasonic pulverization with addition of physiological saline. Centrifuging at 2500rpm for 10min, and collecting supernatant.

(2) Two 1.5mL EP tubes were taken, labeled as control and assay tubes, respectively. Adding 60 mul buffer solution, 25 mul substrate solution and 3 mul application solution into a control tube in turn; in the assay tube, 60. mu.l buffer solution, 25. mu.l substrate solution, 3. mu.l application solution and 25. mu.l sample to be tested were added in this order. Mixing, and water bathing at 37 deg.C for 20 min.

(3) Adding 12 mul of stop solution and 25 mul of sample to be detected into a control tube; to the measuring tube, 12. mu.l of a stop solution was added. Mixing, 3500rpm, centrifuging for 10min, and collecting the supernatant.

(4) Blank tubes, standard tubes, assay tubes and control tubes were prepared separately. In a blank tube, 50 mul of double distilled water and 500 mul of color developing agent are added in turn; adding 50 mul of 0.1M standard application liquid and 500 mul of color developing agent into a standard tube in turn; adding 50 mul of supernatant of the measuring tube and 500 mul of color developing agent into the measuring tube in turn; in the control tube, 50. mu.l of the control tube supernatant and 500. mu.l of the color developer were added in this order. Mixing, and standing at room temperature for 5 min.

(5) And (3) adjusting the wavelength to zero by using double distilled water at 636nm and an optical path of 0.5cm, detecting the absorbance OD value of each tube, and calculating the vitality unit of calceiurin.

The results are shown in FIG. 12B, which shows that although the calceinin protein expression was unchanged in the retinas of SKI mice, the activity was significantly higher than that of WT mice. Calcineurin is also a calcium sensitive sensor, the activity of which is affected by Ca²⁺And (4) adjusting the concentration. When intracellular Ca²⁺At increasing concentrations, calceinin activity increased, further demonstrating cytoplasmic Ca in SKI mouse retinal cells²⁺The concentration increases.

Finally, the above embodiments are only intended to illustrate the technical solutions of the present invention and not to limit the present invention, and although the present invention has been described in detail with reference to the preferred embodiments, it will be understood by those skilled in the art that modifications or equivalent substitutions may be made on the technical solutions of the present invention without departing from the spirit and scope of the technical solutions, and all of them should be covered by the claims of the present invention.

Sequence listing

<110> university of Chongqing

<120> application of animal model for controlling mechanism disorder by calcium regulation in retinopathy

<160> 20

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ccagaggcca cttgtgtagc 20

<210> 2

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tacggaatac agctcggcag aagc 24

<210> 3

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ctatcagttc tcaatagcca atg 23

<210> 4

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

agcgcatcgc cttctatcgc cttc 24

<210> 5

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ctaggtagca caggcttgcc tcag 24

<210> 6

<211> 497

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gtgccaggat tataggcaca cgtacactgt tgtgtcgtgt aagtctagct aaaatcttac 60

catagctgtg atctcatcaa aggactgaag gaactcaaca atcttagact tgtgggaagg 120

ttcaactcga gcaaaggagc gggcatttaa gcaggcatct ctctgggctg aagggcttaa 180

ttcatcaaac tctcgccctg taaaagcctt tgatgtcaca tcctcatcct gcccaaagat 240

gccaatgcgg cgacagatgg ccacagcggt gcctttgttg tctccagtga tcatgatgac 300

ccggatgcct gcttgccggc acagcttcac agaagaggct acttcaatcc tgggaggatc 360

cagcatgccc acacagccga cgaaagtcag gttggtctaa agtgagagag ccacatgagc 420

tcaaacagct tacccctacc cgagtgtcct ggcagctcac tcttgctaca actgtgagtt 480

tgtcattttc tctttct 497

<210> 7

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ttcgaagtct gccttctgtg gaga 24

<210> 8

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

attcaacctg ggctagcctc aaac 24

<210> 9

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ttccgttacc tggctattgg ctgt 24

<210> 10

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

aggcagaggc cattcctcat caat 24

<210> 11

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gcataagctt ggatccgttc ttcggac 27

<210> 12

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

cttgtttgaa ccaagggcaa gcag 24

<210> 13

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

ggaacttcgc tagactagta cgcgtg 26

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

ccacaaatgg ctctcaggtt 20

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

cagctctagg cagagggact 20

<210> 16

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

gatcctctac gtggaacctt tg 22

<210> 17

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

ggtagatgtg ttgctaacaa cg 22

<210> 18

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

ccacagggag caggaagat 19

<210> 19

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

agagggaaat cgtgcgtgac 20

<210> 20

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

caatagtgat gacctggccg t 21

Claims (10)

1. An application of animal model for controlling mechanism disorder by calcium in retinopathy is provided.

2. The use of claim 1, wherein the animal is a mouse.

3. Use according to claim 2, characterized in that the disorder of the calcium regulation mechanism is in particular the inhibition of the activity of the SERCA2 gene expression product in mice by gene mutation.

4. Use according to claim 3, wherein the genetic mutation is in particular a mutation in exon 14 of the SERCA2 gene, wherein the codon TGT is mutated to TCC, wherein said codon TGT codes for C674 and wherein said codon TCC codes for S674.

5. The use of claim 3 or 4, wherein the genetic mutation promotes mitochondrial-mediated apoptosis.

6. The use according to claim 3 or 4, wherein the genetic mutation results in activation of a cytoplasmic calcium dependent signalling pathway.

7. The use of claim 3 or 4, wherein the retinopathy is manifested by the formation of acellular blood vessels in the retina.

8. The use of claim 3 or 4, wherein the retinopathy is manifested by a reduction in retinal capillaries.

9. The use of any one of claims 1 to 8, wherein the retinopathy is retinopathy of prematurity caused by type I diabetes, type II diabetes, hypertension or atherosclerosis.

10. An application of animal model for controlling mechanism disorder by calcium in screening medicine for preventing and treating retinopathy is disclosed.

Images