CN112175917B - Tea tree anthocyanin reductase protein antigen polypeptide, antibody, detection kit and application thereof - Google Patents
Tea tree anthocyanin reductase protein antigen polypeptide, antibody, detection kit and application thereof Download PDFInfo
- Publication number
- CN112175917B CN112175917B CN202010921512.7A CN202010921512A CN112175917B CN 112175917 B CN112175917 B CN 112175917B CN 202010921512 A CN202010921512 A CN 202010921512A CN 112175917 B CN112175917 B CN 112175917B
- Authority
- CN
- China
- Prior art keywords
- protein
- antigen
- anr1
- antibody
- anr2
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/001—Oxidoreductases (1.) acting on the CH-CH group of donors (1.3)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/06—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies from serum
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/40—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y103/00—Oxidoreductases acting on the CH-CH group of donors (1.3)
- C12Y103/01—Oxidoreductases acting on the CH-CH group of donors (1.3) with NAD+ or NADP+ as acceptor (1.3.1)
- C12Y103/01077—Anthocyanidin reductase (1.3.1.77)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/573—Immunoassay; Biospecific binding assay; Materials therefor for enzymes or isoenzymes
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/577—Immunoassay; Biospecific binding assay; Materials therefor involving monoclonal antibodies binding reaction mechanisms characterised by the use of monoclonal antibodies; monoclonal antibodies per se are classified with their corresponding antigens
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/31—Fusion polypeptide fusions, other than Fc, for prolonged plasma life, e.g. albumin
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/90—Enzymes; Proenzymes
- G01N2333/902—Oxidoreductases (1.)
- G01N2333/90206—Oxidoreductases (1.) acting on the CH-CH group of donors (1.3)
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Biomedical Technology (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Biophysics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Food Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention belongs to the technical field of protein detection, and particularly relates to tea anthocyanin reductase protein antigen polypeptide, an antibody, a detection kit and application thereof. The tea tree anthocyanin reductase protein antigen polypeptide is at least one of tea tree anthocyanin reductase 1 antigen polypeptide and anthocyanin reductase 2 protein antigen polypeptide, wherein the amino acid sequence of the tea tree anthocyanin reductase 1 antigen polypeptide is shown as SEQ ID No.1, and the amino acid sequence of the tea tree anthocyanin reductase 2 antigen polypeptide is shown as SEQ ID No. 2. The invention also provides an immune antigen and a detection antigen of the tea anthocyanin reductase protein and an antibody for resisting the tea anthocyanin reductase protein antigen. The antibody not only lays a foundation for the functional research of the protein, but also has positive reference significance for the subsequent research on metabolism of flavonoid and other substances in tea trees.
Description
Technical Field
The invention belongs to the technical field of protein detection, and particularly relates to tea anthocyanin reductase protein antigen polypeptide, an antibody, a detection kit and application thereof.
Background
Anthocyanidin reductase 1 (Anthocynidine reductase 1, ANR1) and Anthocyanidin reductase 2 (Anthocynidine reductase 2, ANR2), ANR1 and ANR2 are among the structural enzymes of the flavonoid biosynthetic metabolic pathway. ANR1 and ANR2 both catalyze cyanidin to form catechin (C) and Epicatechin (EC), delphinidin to form Gallocatechin (GC) and Epigallocatechin (EGC), and thus ANR1 and ANR2 both have epimerase activity. ANR1 and ANR2 are not only key enzymes in anthocyanin metabolism in plants, but also play a key regulatory role in the synthesis and accumulation of catechins in plants. The content of flavonoid substances such as anthocyanin and catechin in tea trees varies according to growth conditions, varieties and tissue parts, which may be caused by the difference of the expression of the ANR1 and ANR2 enzyme genes or the difference of the expression of the ANR1 and ANR2 proteins.
The protein expression level has important value for subsequent research and explanation of different tea plant varieties or content difference of anthocyanin, catechin and the like of different tissues and parts of the tea plant. However, currently, research on protein levels of ANR1 and ANR2 is still limited, no commercial antibodies against ANR1 and ANR2 are sold, and expression of ANR1 and ANR2 at protein levels cannot be detected, so that the regulation effect of ANR1 and ANR2 on synthesis of substances such as anthocyanins and catechins in different varieties, tissues and parts of tea trees cannot be revealed at protein expression levels.
Disclosure of Invention
In order to overcome the defects and shortcomings of the prior art, the invention mainly aims to provide the tea plant anthocyanin reductase protein antigen polypeptide.
The invention also aims to provide an immune antigen and a detection antigen of the anthocyanin reductase protein of tea tree.
Still another object of the present invention is to provide an antibody against tea anthocyanin reductase protein.
The fourth purpose of the invention is to provide the application of the tea tree anthocyanin reductase protein antigen polypeptide, the immune antigen, the detection antigen and the antibody.
The fifth purpose of the invention is to provide a detection kit for tea anthocyanin reductase, which can realize the purpose of rapid commercial detection.
The purpose of the invention is realized by the following technical scheme:
a tea tree anthocyanin reductase protein antigen polypeptide is at least one of tea tree anthocyanin reductase 1(ANR1) antigen polypeptide and anthocyanin reductase 2(ANR2) protein antigen polypeptide, wherein the amino acid sequence of the tea tree anthocyanin reductase 1 antigen polypeptide is shown as SEQ ID No.1, and the amino acid sequence of the tea tree anthocyanin reductase 2 antigen polypeptide is shown as SEQ ID No. 2;
an immune antigen of tea tree anthocyanin reductase protein is obtained by coupling the tea tree anthocyanin reductase protein antigen polypeptide with carrier protein through amido bond;
the carrier protein package is preferably ovalbumin or hemocyanin;
the coupling is preferably a SMCC method;
a detection antigen of tea tree anthocyanin reductase protein is obtained by coupling the tea tree anthocyanin reductase protein antigen polypeptide with carrier protein through amido bond;
the carrier protein is preferably bovine serum albumin;
the coupling is preferably a glutaraldehyde process;
an antibody against tea tree anthocyanin reductase protein antigen is produced by immunizing animals with the above immune antigen of tea tree anthocyanin reductase protein;
the antibody is preferably at least one of a monoclonal antibody and a polyclonal antibody;
in a specific embodiment, the antibody against tea tree anthocyanin reductase protein antigen is prepared by the following method:
(1) emulsifying the diluted immune antigen of the tea tree anthocyanin reductase protein by using a Freund complete adjuvant according to the volume ratio of 1:1, and performing multipoint injection immunization on the neck and back subcutaneous parts of two New Zealand white rabbits at an interval of two weeks after immunization;
(2) after two weeks of first immunization, emulsifying the diluted immune antigen by using Freund's incomplete adjuvant according to the volume ratio of 1:1, and then performing multipoint injection immunization on the neck and back subcutaneous tissues of the two New Zealand white rabbits immunized in the step (1); immunizing for 3 times, and each time is 2 weeks;
(3) collecting blood, obtaining serum, and purifying to obtain an antibody of the tea plant anthocyanin reductase protein antigen;
a hybridoma cell secreting the antibody against tea anthocyanin reductase protein antigen, which is obtained by fusing a cell having the antibody against tea anthocyanin reductase protein antigen with a myeloma cell;
the tea tree anthocyanin reductase protein antigen polypeptide, the detection antigen and the antibody for resisting the tea tree anthocyanin reductase protein antigen are applied to the tea tree anthocyanin reductase detection field;
a tea tree anthocyanin reductase detection kit based on an immunoreaction technology comprises a detection antigen of the tea tree anthocyanin reductase protein and/or an antibody of the anti-tea tree anthocyanin reductase protein antigen;
the immunoreaction technology is preferably immunochromatography, ELISA, western-blot, immunofluorescence in situ hybridization or immunohistochemistry;
compared with the prior art, the invention has the following advantages and effects:
(1) the invention provides protein antigen polypeptides of anthocyanin reductase 1 and anthocyanin reductase 2 of tea trees, and the amino acid sequences of the protein antigen polypeptides are shown as SEQ ID No.1 and SEQ ID No. 2. According to the invention, based on the analysis of conserved domains of ANR1 and ANR2 protein sequences among different tea trees, the consistent amino acid sequences of ANR1 among different tea trees and the consistent amino acid sequences of ANR2 among different tea trees are found, the different amino acid sequences of ANR1 and ANR2 are compared, the immunogenicity, the hydrophilicity and the hydrophobicity, the surface accessibility and the like of the consistent amino acid sequences are analyzed, and the amino acid sequence of a proper section of intracellular polypeptide is determined to be an antigen. The immune antigen polypeptide is verified to be capable of immunizing animals to generate specific antibodies, and the antibody titer is ideal, so that the antigen polypeptide provided by the invention has stronger immunogenicity, and effective detection substances are provided for detecting tea anthocyanin reductase 1 and anthocyanin reductase 2 on the protein expression level.
(2) The invention provides an immune antigen of tea tree anthocyanin reductase 1 and anthocyanin reductase 2 proteins, wherein the immune antigen is obtained by coupling an antigen polypeptide and a carrier protein through an amido bond; the carrier protein comprises ovalbumin or hemocyanin. In a specific embodiment, the antigen polypeptide is artificially synthesized and then coupled with a maleimide activated carrier KLH, and the coupling product is subjected to desalting column purification, so that immune New Zealand white rabbits can generate antibodies with ideal potency and specificity for recognizing ANR1 and ANR2 proteins.
(3) The antibody for resisting protein antigens of anthocyanin reductase 1 and anthocyanin reductase 2 of tea trees, which is provided by the invention, is an antibody generated by immunizing animals by the immune antigen. In a specific embodiment, after a new zealand white rabbit is immunized by the immunizing antigen for multiple times, the obtained rabbit-derived serum is used for detecting the antibody titer by an ELISA method, the immune rabbit-derived serum is collected after the titer reaches an ideal value, and the antibody is purified by a Protein G Protein purification column; and (3) carrying out specific reaction identification on the purified antibody, wherein the identification result shows that the generated antibody can specifically recognize ANR1 and ANR2 proteins.
(4) The method for preparing the ANR1 and ANR2 antibodies is very significant, not only can lay a foundation for the function research of the protein, but also has positive reference significance for the subsequent research on metabolism of flavonoids and other substances in tea plants.
Drawings
FIG. 1 is a Western-blot analysis chart of ANR1 and ANR2 proteins; wherein A is an ANR1 protein Western-blot analysis result, M represents a standard prestained protein, and lanes 1-8 represent ANR1 protein; b is a Western-blot analysis result of total protein of tea tree Actin (used for internal reference and detected by an Actin antibody), wherein M represents standard pre-dyed protein, and lanes 1-7 represent total protein of Actin; c is an ANR2 protein Western-blot analysis result, M represents a standard pre-stained protein, and lanes 1-8 represent ANR2 protein; d is a Western-blot analysis result of tea tree Actin total protein (for internal reference and detected by an Actin antibody), M represents standard pre-dyed protein, and lanes 1-8 represent tea tree Actin total protein.
FIG. 2 is a flowchart of a method for preparing ANR1 and ANR2 protein antigen polypeptides provided by an embodiment of the invention.
Detailed Description
The present invention will be described in further detail with reference to examples and drawings, but the present invention is not limited thereto.
The invention provides tea tree anthocyanin reductase 1 and anthocyanin reductase 2 protein antigen polypeptides, wherein the amino acid sequence of the anthocyanin reductase 1 polypeptide is shown as SEQ ID No.1 (C-NQKKTSHLL-ALKGS-NH)2) The amino acid sequence of the anthocyanin reductase 2 polypeptide is shown as SEQ ID No.2 (C-NFASEDPENDMIKPA-NH)2). The source of the polypeptide is not particularly limited in the present invention, and any source of the polypeptide known in the art may be used. In the present example, the polypeptide is synthesized by a polypeptide synthesis company.
In the invention, the screening method of the ANR1 and ANR2 protein antigen polypeptides is shown in figure 2, and comprises the following steps:
s101: and performing Blast search on GenBank to obtain ANR1 and ANR2 genes in different tea tree resources according to ANR1 and ANR2 gene sequences (SEQ ID Nos. 3-4) cloned in Yinghong Jiu and Nankunshan Mao tea trees.
S102: the conserved domain of the ANR1 protein sequence and the conserved domain of the ANR2 protein sequence among different tea trees are obtained by comparing and analyzing MEGA7 and Genedoc software.
S103: and respectively finding out all consistent amino acid sequences of the conserved domains of the ANR1 and the ANR2 proteins among different tea trees by using DNAstar software. Comparison finds out the difference amino acid sequence between the conserved domains of the ANR1 and the ANR2 protein.
S104: ANR1 and ANR2 protein antigen polypeptide screening determines that: the obtained amino acid sequences are combined with the analysis of requirements on high antigenicity, hydrophilicity and surface accessibility, and the positions 43-58 aa of the conserved domain of the ANR1 protein are screened and determinedSetting a 14-amino acid length peptide segment as antigen polypeptide with C-NQKKTSHLLALKGS-NH sequence2。
Screening and determining a 15-amino-acid-length peptide segment at positions 102-116aa of the conserved domain of the ANR2 protein as an antigen polypeptide, wherein the polypeptide sequence is C-NFASEDPENDMIKPA-NH2。
The invention provides an immunizing antigen of tea tree anthocyanin reductase 1 and anthocyanin reductase 2 proteins, which is obtained by coupling the antigen polypeptide and carrier protein through amido bond by applying an SMCC method (leaf health, luxuriant, touch, Yanyubao, thania schlegeli, Jujuan, Liaodan, Zhongying river, xylol, Chipengbo, Caocao, Pionggang, Jifeng, Lixing Yu, Linyi, Panmeng, Weiheng, Dazhuo, Enramycin artificial antigen synthesis and identification [ J ]. Hubei agrscience, 2019,58(07):92-95+ 156.); the carrier protein comprises ovalbumin or hemocyanin. The invention also provides a detection antigen of tea plant anthocyanin reductase 1 and anthocyanin reductase 2 proteins, wherein the detection antigen is obtained by coupling the polypeptide and a carrier protein through an amido bond by applying a glutaraldehyde method (Tan Xingmei preparation of cyclic guanylic acid (cGMP) rabbit monoclonal antibody and establishment of a competitive ELISA determination method [ D ]. Zhejiang university, 2016 ]); the carrier protein comprises bovine serum albumin.
In the present invention, since the chemically synthesized polypeptide antigen is a small molecule belonging to a hapten, it hardly has good antigenicity itself, and can induce only weak immune reaction in animals, it is important to crosslink with a carrier protein. The carrier protein contains many epitopes and is capable of stimulating T helper cells and thereby inducing B cell responses. There are many carrier proteins for cross-linking with polypeptides, the most commonly used carriers being Keyhole Limpet Hemocyanin (KLH), Bovine Serum Albumin (BSA), Ovalbumin (OVA) and bovine Thyroglobulin (THY). Experiments prove that KLH has higher antigenicity and has the strongest immunogenicity after being crosslinked with the ANR1 and ANR2 antigen polypeptides, so that KLH is used as a coupling carrier protein to prepare the immune antigen. BSA is used as a polypeptide carrier protein, and because BSA is often used as a blocking agent for detection tests, the antibody produced by the method has certain application limitation, and therefore, BSA is used as the carrier protein for preparing detection antigens.
The invention provides an antibody for resisting protein antigens of anthocyanin reductase 1 and anthocyanin reductase 2 of tea trees, and the antibody is generated by immunizing animals by the immune antigens. The antibodies preferably include monoclonal antibodies and polyclonal antibodies. The method for producing the polyclonal antibody preferably comprises the steps of: diluting the immune antigen to 1mg/mL, emulsifying the immune antigen by using a Freund's complete adjuvant according to a volume ratio of 1:1, performing multipoint injection (1 mL for each injection) immunization under the skin of the back of the neck of two New Zealand white rabbits for 4 times, and performing blood sampling to detect the antibody titer by using an ELISA method, wherein the interval between every two injections is 2 weeks; and (3) when the antibody titer reaches 1:80000, collecting serum, and performing purification, ELISA and western blot identification to obtain polyclonal antibodies against ANR1 and ANR 2. When the antibody is a monoclonal antibody, the invention provides a hybridoma cell that secretes the antibody. The antibody can identify ANR1 and ANR2 proteins through ELISA, Western bot, immunofluorescence staining and other experiments of ANR1 and ANR 2. The polyclonal antibodies of the ANR1 and the ANR2 proteins lay a foundation for further researching the functions of the ANR1 and the ANR2 proteins.
The invention provides tea anthocyanin reductase protein antigen polypeptide, a detection antigen and application of an antibody in the field of tea anthocyanin reductase detection.
The invention provides a tea tree anthocyanin reductase 1 and anthocyanin reductase 2 detection kit based on an immunoreaction technology, which comprises a detection antigen and/or an antibody. The immunoreaction technology is not particularly limited, and all detection methods utilizing the combination of antigen and antibody to form a compound are applicable, and comprise an immunochromatography technology, an ELISA technology, a western-blot, immunofluorescence in situ hybridization or immunohistochemistry. The method for preparing the kit is not particularly limited, and the preparation method known in the art can be adopted. The method of using the kit is not particularly limited in the present invention, and a method of using a kit known in the art may be used.
The tea plant anthocyanin reductase 1 and anthocyanin reductase 2 protein antigen polypeptides provided by the invention and the antibodies, detection kits and applications thereof are described in detail below with reference to the examples, but the polypeptides and the antibodies, the detection kits and the applications thereof are not to be construed as limiting the protection scope of the invention.
Example 1 design and Synthesis of ANR1 and ANR2 protein Polypeptides
(1) And performing Blast search on GenBank to obtain ANR1 and ANR2 genes in different tea tree resources according to ANR1 and ANR2 gene sequences (SEQ ID Nos. 3-4) cloned in Yinghong Jiu and Nankunshan Mao tea trees.
ANR1 gene sequence (SEQ ID No. 3):
ATGGAAGCCCAACCGACAGCTCCGAAGGCCGCATGTGTTGTTGGTGGCACCGGCTTCGTGGCGGCGACGCTCATCAAGTTGTTGCTTGAGAAAGGCTATGCGGTCAACACCACTGTCCGAGACCCAGGCAATCAGAAAAAGACCTCTCACCTTCTAGCACTAAAGGGTTCAGGCAACCTAAAAATCTTCCGAGCAGACCTCACCGATGAACAGAGCTTTGACGCCCCTGTAGCGGGTTGTGACCTGGTCTTCCATGTCGCTACACCAGTCAACTTTGCTTCCGAGGATCCAGAGAATGACATGATAAAACCAGCAATTCAAGGAGTAGTCAATGTTCTAAAAGCTTGTGCAAAAGCAGGAACGGTTAAACGTGTCATTTTAACATCATCAGCAGCTGCTGTATCGATCAATAAGCTCAATGGGACCGGCCTGGTCATGGATGAGAGTCACTGGACTGACACCGAGTTTTTGAATTCTGCGAAGCCGCCCACTTGGGGGTACCCTTTATCGAAAACACTAGCTGAGAAAGCTGCTTGGAAGTTTGCCGAAGAAAATAACATTAATCTTATCACTGTCATCCCAACTCTCATGGCCGGTCCGTCACTTACTGCAGATGTCCCTAGCAGTATTGGTCTTGCCATGTCCTTGATCACAGGGAATGAATTTCTCATAAATGGGTTGAAAGGTATGCAAATGCTGTCAGGCCCAATCTCCATCTCCCACGTGGAGGACGTTTGTCGTGCCCACGTGTTTGTGGCAGAGAAAGAATCGGCCTCTGGTCGATACATTTGTTGCGCTGTCAATACCAGTGTTCCCGAGCTAGCCAAGTTCCTCAACAAAAGATATCCAGAGTACAATGTCCCTACTGATTTTGGAGATTTTCCATCAAAAGCGAAGTTGATCCTCTCGTCTGAGAAGCTTACCAAAGAGGGATTTAGTTTCAAGTATGGGATCGAAGAAATTTACGATCAATCTGTGGAGTACTTCAAGGCTAAGGGGATTTTGAAGAATTGA；
ANR2 gene sequence (SEQ ID No. 4):
ATGGCAATGGCAATGGCAACAACAACAACAACAACAACAACCAAACCGATGATCGGAGCGAAGGCGGCGTGTGTGGTTGGCGGCACCGGCTTCGTGGCTGCCACCCTTGTGAAGATGTTGCTAGAGAGAGGATATTCCGTCAACACCACTGTCAGGGACCCCGATAATAAGAAAAACTTCTCTCACCTCGTAGCACTGGAGGGTATGGGAAACTTAAAAATCTTCCGAGCAGACCTAACTGATGAACAGAGCTTTGATGCCCCCGTAGCCGGTTGTGACCTTGTTTTTGATGTTGCAACCCCAGTTAATTTTGCTTCTGAAGATCCAGAGAATGACATGATAAAGCCGGCAATCCAAGGAGTGCTTAATGTTTTAAAAGCCTGCGCGAAAGCAGGAACGGTTAAACGTGTCATTTTAACATCATCAGCAGCCTCTGTAACGATTAATCAGCTTGATGGAACGGGGCTTGTCATGGATGAGAGTCACTGGTCAGATGTCGAGTTTTTGACTTCTGTGAAGCCACCCACTTGGGGGTATCCTGTATCAAAGACACTAGCAGAGAAAGCAGCGTGGAAATTTGCTGAAGAAAATAACCTTAACCTCATAACTGTCGTCCCTACTCTTACAGCTGGTCCTTCTCTTACATCGGAAGTTCCTAATAGTATTGAACTTGCCATGTCCTTGATCACAGGGAATGAATTCCTCATAGATGGACTGAAAGGTATGCAGATACTGTCAGGTTCGATCTCAATTACCCACGTAGAGGATGTTTGTGGTGCGCACATATTTGTGGCGGAGAAAGAATCAGCTTGTGGTCGATACATTTGTTGTGGTGTCAATTCCAGTGTTCCAGAGCTTGCAAGGTTCTTGAACAAAAGATACCCCCAGTACAATGTTCCTACCAATTTTGGAGATTTGCCGTCCAAAGCCAAGTTGATCATCTCATCTGAAAAGCTTATCAAAGAAGGATTTAGTTTCAAGTATGGGATTGAAGAAATTTTTGACCACTCAGTGGCCTATTTGAAGACTAAGGGGCTTTTGCAGAACTGA；
(2) the conserved domain of the ANR1 protein sequence and the conserved domain of the ANR2 protein sequence among different tea trees are obtained by comparing and analyzing MEGA7 and Genedoc software.
(3) And respectively finding out all consistent amino acid sequences of the conserved domains of the ANR1 and the ANR2 proteins among different tea trees by using DNAstar software. Comparison finds out the difference amino acid sequence between the conserved domains of the ANR1 and the ANR2 protein.
(4) ANR1 and ANR2 protein antigen polypeptide screening determines that: the obtained amino acid sequences are analyzed in combination with requirements of strong antigenicity, hydrophilicity and surface accessibility, a 14-amino acid length peptide segment at the 43-58 aa position of the conserved domain of the ANR1 protein is screened and determined to be the antigen polypeptide, and the polypeptide sequence is C-NQKKTSHLLALKGS-NH2. Screening and determining a 15-amino acid-length peptide segment at the 102-116aa position of the conserved domain of the ANR2 protein as an antigen polypeptide, wherein the polypeptide sequence of the antigen polypeptide is C-NFASEDPENDMIKPA-NH2。
Example 2
Preparation and immunization method of ANR1 and ANR2 protein antigen polypeptides
ANR1 protein antigen polypeptide (NQKKTSHLLALKGS) and ANR2 antigen polypeptide (NFASEDPENDMIKPA) were synthesized by qiao bio.
ANR1 and ANR2 antigen polypeptides are coupled with KLH and BSA to prepare immune antigen and detect antigen
(1) An SMCC kit (purchased from Thermo Fisher Scientific) is adopted to couple ANR1 and ANR2 antigen polypeptides with KLH (coupling agent is Sulfo-SMCC) respectively to prepare immune antigens, and the specific method comprises the following steps: weighing 4mg of ANR1 and ANR2 antigen polypeptide, respectively dissolving in 0.4mL of PBS (pH 7.2, the same below), respectively adding 4mg of Sulfo-SMCC, incubating at 4 ℃ for 2h, respectively adding 25mg of KLH solution (with the concentration of 20mg/mL) in ANR1-SMCC and ANR2-SMCC, reacting at 4 ℃ for 2h, dialyzing in PBS buffer solution for 24h to obtain ANR1-KLH and ANR2-KLH immune antigens, and storing at-20 ℃.
The concentrations of ANR1-KLH and ANR2-KLH were determined using a BCA kit (purchased from Thermo Fisher Scientific) and Solution B and Solution A were formulated at a volume ratio of 1: 50. BSA standard protein concentrations were 0, 25, 125, 250, 500, 750 and 1000. mu.g/mL diluted with 1 XPBD. The absorbance was measured on a microplate reader at 562nm and a standard curve was drawn. And (3) adding 25 mu L of diluted proper-fold ANR1-KLH and ANR2-KLH antigens into 200 mu L of BCA working solution, measuring the absorbance value at 562nm, and calculating the concentration of the corresponding diluted antigens according to a standard curve.
(2) ANR1 and ANR2 antigen polypeptides are coupled with BSA (the coupling agent is glutaraldehyde) to be used as detection antigens
Weighing 4mg of ANR1, ANR2 antigen polypeptide and 4mg of BSA protein, dissolving in 10mL of 0.2mol/L PBS buffer solution, adding 10mL of 1, 4-dioxane, and uniformly mixing; and (3) placing the beaker containing the mixture into a water bath stirrer at 25 ℃, stirring for 5min, dropwise adding 5mL of glutaraldehyde solution with the volume fraction of 0.25%, and continuously stirring for reacting for 4 h. And dialyzing at 4 ℃ for 72h after the reaction is finished, and freeze-drying at-20 ℃ for 2d to obtain ANR1-KLH and ANR2-KLH detection antigens, and storing in a refrigerator at-20 ℃.
3. The immune antigens are respectively diluted to 1mg/mL by PBS buffer solution, and are subpackaged and frozen in a refrigerator with the temperature of-20 ℃.
4. On day 1, 1mL of ANR1-KLH and 1mL of ANR2-KLH immune antigens with the concentration of 1mg/mL are taken and added with 1mL of Freund's complete adjuvant respectively, emulsification is carried out (the emulsification degree is checked, one drop of emulsified antigen liquid is dropped into physiological saline, and if the emulsified antigen liquid is not dispersed, the requirement is met), 1mL of emulsified ANR1-KLH immune antigen is injected into 2 New Zealand white rabbits (noted as rabbit A and rabbit B and purchased from Qiaozhimoto limited), 1mL of emulsified ANR2-KLH immune antigen is injected into another 2 New Zealand white rabbits (noted as rabbit C and rabbit D), and multiple injections (at least 8 injections) are carried out subcutaneously on the back of the neck.
5. On day 15, 1mL of ANR1-KLH and 1mL of ANR2-KLH immune antigens with the concentration of 1mg/mL are taken and added with 1mL of Freund's incomplete adjuvant respectively, emulsification is carried out (the emulsification degree is checked, one drop of emulsified antigen liquid is dropped into physiological saline, and if the emulsified antigen liquid is not dispersed, the requirement is met), 1mL of emulsified ANR1-KLH immune antigen is injected into each of 2 New Zealand white rabbits (marked as rabbit A and rabbit B) in the step 4, 1mL of emulsified ANR2-KLH immune antigen is injected into each of the other 2 New Zealand white rabbits (marked as rabbit C and rabbit D) in the step 4, and multiple injections (at least 8 injections) are carried out subcutaneously on the back of the neck.
6. On the 29 th day, 1mL of each of ANR1-KLH and ANR2-KLH immunizing antigens with a concentration of 1mg/mL was taken, 1mL of incomplete freund's adjuvant was added, and emulsification was performed (degree of emulsification was checked: one drop of emulsified antigen solution was dropped into physiological saline, and if it did not disperse, it was found that the requirement was met)), 1mL of emulsified ANR1-KLH immunizing antigen was injected into each of 2 new zealand white rabbits (denoted as rabbit a and rabbit B) in step 5, and 1mL of emulsified ANR2-KLH immunizing antigen was injected into each of the other 2 new zealand white rabbits (denoted as rabbit C and rabbit D) in step 5, and injections were performed subcutaneously at multiple times (at least 8 times) on the back of the neck.
7. On day 43, 1mL of each of ANR1-KLH and ANR2-KLH immunizing antigens with a concentration of 1mg/mL was taken and added with 1mL of incomplete freund's adjuvant, and emulsified (degree of emulsification was checked: one drop of emulsified antigen solution was dropped into physiological saline, and if it did not disperse, it was found to be satisfactory), 1mL of emulsified ANR1-KLH immunizing antigen was injected into each of 2 new zealand white rabbits (denoted as rabbit a and rabbit B) in step 6, and 1mL of emulsified ANR2-KLH immunizing antigen was injected into each of the other 2 new zealand white rabbits (denoted as rabbit C and rabbit D) in step 6, and all of them were injected subcutaneously at multiple times (at least 8 times) at the back of the neck.
8. On day 53, carotid blood was taken and the rabbits in step 7 were sacrificed.
9. The rabbit blood was left overnight at 4 ℃ and centrifuged (4 ℃, 10000rpm) for 30 minutes to collect the supernatant.
Second, polyclonal antibody purification scheme against ANR1 and ANR 2:
1. antigen affinity columns were prepared by attaching ANR1 and ANR2 protein antigen polypeptides to activated Sulfolink Resin, respectively, according to the conventional method, and 1mL Sulfolink Resin was conjugated to 1mg of polypeptide.
2. Balancing the antigen affinity column with PBS (phosphate buffer solution) with 10 times of column volume, and draining the solution; the rabbit serum was filtered through a 0.45 μm filter.
3. The filtered rabbit serum passes through an antigen affinity column, the solution is drained, and the flow-through is collected.
4.10 column volumes of PBS were equilibrated and the solution was drained.
5. 5mL of antibody eluent was added, and the eluates were collected in separate tubes, 1mL each.
6. Detecting absorbance at 280nm by using the collected eluent, combining the components with the absorbance greater than 1.0, and dialyzing by using PBS (phosphate buffer solution) to obtain purified polyclonal antibodies against ANR1 and ANR 2;
7. and (3) identifying the purified polyclonal antibodies against ANR1 and ANR2 (Elisa determines antibody titer).
Example 4 identification of polyclonal antibodies against ANR1 and ANR2
ElISA antibody potency
1. Coating: the detection antigens prepared in the first step of example 2(ANR 1-KLH and ANR2-KLH detection antigens) were diluted to 1 μ g/mL with CBS (ELISA antigen coating buffer) and added to an ELISA plate at 4 ℃ overnight at 100 μ L per well.
2. And (3) sealing: the coating solution was discarded, 200. mu.L of blocking solution (5% skim milk powder by mass) was added to each well, and the mixture was left at 37 ℃ for 1.5 hours.
3. Adding a sample: the blocking solution was discarded, and the sample (serum or antibody) was added thereto, and 100. mu.L of the microplate was added to each well, followed by standing at 37 ℃ for 1 hour.
4. Washing: rinsed 10 times with tap water and patted dry.
5. Adding a secondary antibody: the enzyme-labeled goat anti-rabbit (purchased from Qiaozhaoyao) is diluted to the working concentration by using a confining liquid, an enzyme-labeled plate is added into each hole with the volume of 100 mu L, and the mixture is placed for 30 minutes at 37 ℃.
6. Washing: rinsed 10 times with tap water and patted dry.
7. Addition of TMB chromogenic substrate: add microplate to 100uL per well and incubate at 37 ℃ for 15 minutes.
8. Adding a stop solution: add 50. mu.L of 2M H per well2SO4And (3) solution.
9. Reading: enzyme-linked immunosorbent assay (OD)450nmAnd (6) reading.
In the embodiment, ANR1 and ANR2 antigen polypeptide are coupled with BSA (a coupling agent is glutaraldehyde) to serve as detection antigens, an ELISA plate is coated, non-immune rabbit-derived rabbit serum diluted by 1:1250 serves as negative control, the rabbit-derived serum and purified antibody are diluted in a multiple ratio, an ELISA method is used for detection, and the positive judgment is made when the ratio of the detection antigens to the negative serum is greater than 2.1. The results are shown in tables 1 and 2.
As can be seen from table 1, the titer of the purified polyclonal antibody against ANR1 reached 1: 80000.
TABLE 1 anti-ANR 1 antibody titers
As can be seen from Table 2, the titer of the purified polyclonal antibody against ANR2 reached 1: 409600.
TABLE 2 anti-ANR 2 antibody titers
Western Blot identification of polyclonal antibodies against ANR1 and ANR2
1g of fresh tea leaves was ground thoroughly in liquid nitrogen containing water-insoluble PVPP (cross-linked polyvinylpyrrolidone). 10mL of a precooled 10% TCA/acetone solution (containing 0.07% beta-mercaptoethanol in volume fraction and 1mmol/L PMSF) was added and precipitated at-20 ℃ for 3 h. Followed by centrifugation at 12000 Xg for 15min at 4 ℃ and discarding the supernatant. The above acetone washing operation was repeated 2 to 3 times. Protein electrophoresis was performed using SDS-PAGE, and the gel was stained with Coomassie Brilliant blue R-250 for 3-5 h. Transferring the protein in the gel to a PVDF membrane by a wet transfer printing technology, sealing the membrane by using 5% of skimmed milk powder by mass fraction, and gently shaking for 10-14 h at 4 ℃. Adding 1: the 5000-diluted polyclonal antibodies of ANR1 and ANR2 in example 3 are incubated at 4 ℃ for 10-14 h, and washed 3 times with TBST. Adding 1:5000 diluted secondary antibody (goat secondary antibody from Yaozha) and shaking gently at 26 deg.C for 1h, washing with TBST for 3 times, adding appropriate amount of developer, and developing with developer.
As shown in FIG. 1, the polyclonal antibodies against ANR1 and ANR2 of the present invention detected protein bands around 40KD, which matched the molecular weights of the ANR1(36.23kDa) and ANR2(37.50kDa) proteins.
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.
SEQUENCE LISTING
<110> southern China university of agriculture
<120> tea tree anthocyanin reductase protein antigen polypeptide, antibody, detection kit and application thereof
<130> 1
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 14
<212> PRT
<213> Artificial
<220>
<223> anthocyanidin reductase 1 polypeptide
<400> 1
Asn Gln Lys Lys Thr Ser His Leu Leu Ala Leu Lys Gly Ser
1 5 10
<210> 2
<211> 15
<212> PRT
<213> Artificial
<220>
<223> anthocyanidin reductase 2 polypeptides
<400> 2
Asn Phe Ala Ser Glu Asp Pro Glu Asn Asp Met Ile Lys Pro Ala
1 5 10 15
<210> 3
<211> 1014
<212> DNA
<213> Artificial
<220>
<223> ANR1 Gene sequence
<400> 3
atggaagccc aaccgacagc tccgaaggcc gcatgtgttg ttggtggcac cggcttcgtg 60
gcggcgacgc tcatcaagtt gttgcttgag aaaggctatg cggtcaacac cactgtccga 120
gacccaggca atcagaaaaa gacctctcac cttctagcac taaagggttc aggcaaccta 180
aaaatcttcc gagcagacct caccgatgaa cagagctttg acgcccctgt agcgggttgt 240
gacctggtct tccatgtcgc tacaccagtc aactttgctt ccgaggatcc agagaatgac 300
atgataaaac cagcaattca aggagtagtc aatgttctaa aagcttgtgc aaaagcagga 360
acggttaaac gtgtcatttt aacatcatca gcagctgctg tatcgatcaa taagctcaat 420
gggaccggcc tggtcatgga tgagagtcac tggactgaca ccgagttttt gaattctgcg 480
aagccgccca cttgggggta ccctttatcg aaaacactag ctgagaaagc tgcttggaag 540
tttgccgaag aaaataacat taatcttatc actgtcatcc caactctcat ggccggtccg 600
tcacttactg cagatgtccc tagcagtatt ggtcttgcca tgtccttgat cacagggaat 660
gaatttctca taaatgggtt gaaaggtatg caaatgctgt caggcccaat ctccatctcc 720
cacgtggagg acgtttgtcg tgcccacgtg tttgtggcag agaaagaatc ggcctctggt 780
cgatacattt gttgcgctgt caataccagt gttcccgagc tagccaagtt cctcaacaaa 840
agatatccag agtacaatgt ccctactgat tttggagatt ttccatcaaa agcgaagttg 900
atcctctcgt ctgagaagct taccaaagag ggatttagtt tcaagtatgg gatcgaagaa 960
atttacgatc aatctgtgga gtacttcaag gctaagggga ttttgaagaa ttga 1014
<210> 4
<211> 1050
<212> DNA
<213> Artificial
<220>
<223> ANR2 Gene sequence
<400> 4
atggcaatgg caatggcaac aacaacaaca acaacaacaa ccaaaccgat gatcggagcg 60
aaggcggcgt gtgtggttgg cggcaccggc ttcgtggctg ccacccttgt gaagatgttg 120
ctagagagag gatattccgt caacaccact gtcagggacc ccgataataa gaaaaacttc 180
tctcacctcg tagcactgga gggtatggga aacttaaaaa tcttccgagc agacctaact 240
gatgaacaga gctttgatgc ccccgtagcc ggttgtgacc ttgtttttga tgttgcaacc 300
ccagttaatt ttgcttctga agatccagag aatgacatga taaagccggc aatccaagga 360
gtgcttaatg ttttaaaagc ctgcgcgaaa gcaggaacgg ttaaacgtgt cattttaaca 420
tcatcagcag cctctgtaac gattaatcag cttgatggaa cggggcttgt catggatgag 480
agtcactggt cagatgtcga gtttttgact tctgtgaagc cacccacttg ggggtatcct 540
gtatcaaaga cactagcaga gaaagcagcg tggaaatttg ctgaagaaaa taaccttaac 600
ctcataactg tcgtccctac tcttacagct ggtccttctc ttacatcgga agttcctaat 660
agtattgaac ttgccatgtc cttgatcaca gggaatgaat tcctcataga tggactgaaa 720
ggtatgcaga tactgtcagg ttcgatctca attacccacg tagaggatgt ttgtggtgcg 780
cacatatttg tggcggagaa agaatcagct tgtggtcgat acatttgttg tggtgtcaat 840
tccagtgttc cagagcttgc aaggttcttg aacaaaagat acccccagta caatgttcct 900
accaattttg gagatttgcc gtccaaagcc aagttgatca tctcatctga aaagcttatc 960
aaagaaggat ttagtttcaa gtatgggatt gaagaaattt ttgaccactc agtggcctat 1020
ttgaagacta aggggctttt gcagaactga 1050
Claims (3)
1. The tea tree anthocyanin reductase protein antigen polypeptide is characterized by being at least one of tea tree anthocyanin reductase 1 antigen polypeptide and anthocyanin reductase 2 protein antigen polypeptide, wherein the amino acid sequence of the tea tree anthocyanin reductase 1 antigen polypeptide is shown as SEQ ID No.1, and the amino acid sequence of the tea tree anthocyanin reductase 2 antigen polypeptide is shown as SEQ ID No. 2.
2.An immune antigen of tea tree anthocyanin reductase protein, which is characterized in that the immune antigen is obtained by coupling the tea tree anthocyanin reductase protein antigen polypeptide of claim 1 with carrier protein through amido bond;
the carrier protein bag is ovalbumin or hemocyanin.
3. A detection antigen of tea tree anthocyanin reductase protein is characterized in that the detection antigen is obtained by coupling the tea tree anthocyanin reductase protein antigen polypeptide of claim 1 with carrier protein through amido bond;
the carrier protein is bovine serum albumin.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010921512.7A CN112175917B (en) | 2020-09-04 | 2020-09-04 | Tea tree anthocyanin reductase protein antigen polypeptide, antibody, detection kit and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010921512.7A CN112175917B (en) | 2020-09-04 | 2020-09-04 | Tea tree anthocyanin reductase protein antigen polypeptide, antibody, detection kit and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112175917A CN112175917A (en) | 2021-01-05 |
| CN112175917B true CN112175917B (en) | 2021-08-10 |
Family
ID=73924284
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010921512.7A Active CN112175917B (en) | 2020-09-04 | 2020-09-04 | Tea tree anthocyanin reductase protein antigen polypeptide, antibody, detection kit and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112175917B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007044992A2 (en) * | 2005-10-13 | 2007-04-19 | Cornell University | Polynucleotides encoding phenylpropanoid and flavonoid biosynthetic pathway enzymes in coffee |
| CN103146719A (en) * | 2013-02-21 | 2013-06-12 | 吉首大学 | Vitis bellula anthocyanidin reductase gene, protein coded by same and application of vitis bellula anthocyanidin reductase gene |
| CN107312783A (en) * | 2017-05-17 | 2017-11-03 | 运城学院 | Complete sequence of raspberry anthocyanidin reductase gene and preparation method thereof |
-
2020
- 2020-09-04 CN CN202010921512.7A patent/CN112175917B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007044992A2 (en) * | 2005-10-13 | 2007-04-19 | Cornell University | Polynucleotides encoding phenylpropanoid and flavonoid biosynthetic pathway enzymes in coffee |
| CN103146719A (en) * | 2013-02-21 | 2013-06-12 | 吉首大学 | Vitis bellula anthocyanidin reductase gene, protein coded by same and application of vitis bellula anthocyanidin reductase gene |
| CN107312783A (en) * | 2017-05-17 | 2017-11-03 | 运城学院 | Complete sequence of raspberry anthocyanidin reductase gene and preparation method thereof |
Non-Patent Citations (3)
| Title |
|---|
| Correlation analysis between total catechins (or anthocyanins) and expression levels of genes involved in flavonoids biosynthesis in tea plant with purple leaf.;Zhou et al;《Acta Agronomica Sinica》;20161231;全文 * |
| Functional Characterization of Proanthocyanidin Pathway Enzymes from Tea and Their Application for Metabolic Engineering;Pang et al;《PLANT PHYSIOLOGY》;20130331;全文 * |
| Influence of shade on flavonoid biosynthesis in tea (Camellia sinensis (L.) O. Kuntze);Wang et al;《SCIENTIA HORTICULTURAE》;20120615;全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112175917A (en) | 2021-01-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102633864B (en) | GPC3 antigen polypeptide, anti-GPC3 polyclonal antibody and application thereof | |
| JP7058018B2 (en) | Anti-MRJP4 monoclonal antibody pair, ELISA kit for MRJP4 detection and colloidal gold immunodetection test strip | |
| CN101283093A (en) | Method for determination of SARS virus nucleocapsid protein, reagent kit for the determination, test device, monoclonal antibody directed against SARS virus nucleocapsid protein, and hybridoma capable | |
| CN111732664B (en) | Novel coronavirus recombinant protein, rabbit-human chimeric antibody, preparation method and application thereof | |
| CN110272502B (en) | Immunogen, hybridoma cell secreting anti-cardiac troponin I monoclonal antibody, preparation method, monoclonal antibody and application | |
| CN113683702B (en) | Preparation method and application of polyclonal antibody of striped bamboo shark single-domain antibody | |
| CN104744580B (en) | A kind of TgVP1 extracellular regions antigen polypeptide, the polyclonal antibody of anti-TgVP1 and its application | |
| CN104865391A (en) | Anti-Mulerian hormone (AMH) enzyme-linked immunosorbent assay reagent | |
| CN112175917B (en) | Tea tree anthocyanin reductase protein antigen polypeptide, antibody, detection kit and application thereof | |
| KR100905066B1 (en) | The recombinant proteins for the diagnosis of diseases infected from Mycoplasma pneumoniae and the diagnostic kits comprising the same | |
| US20220144912A1 (en) | Leptin immunogens, hybridoma cells, monoclonal antibodies, polyclonal antibodies and use thereof | |
| CN111690623B (en) | Tea tree flavanonol 4-reductase protein antigen polypeptide, antibody, detection kit and application thereof | |
| CN107892713A (en) | The monoclonal antibody of the anti-main albumen 3 of royal jelly and the enzyme linked immunological kit for detecting the main albumen 3 of royal jelly | |
| CN102336814A (en) | Polypeptide sequence for preparing anti-liver-neoplasm marker CK-19 antibody, polyclonal antibody and application thereof | |
| CN113832132B (en) | Solder tip SVMP protein specific short peptide, solder tip SVMP protein antibody and snake bite detection kit | |
| CN104744581B (en) | A kind of toxoplasma protein TgVP1 intracellular regions antigen polypeptide, the polyclonal antibody of resisting toxoplasmosis TgVP1 and its application | |
| Natori et al. | Heymann nephritis in rats induced by human renal tubular antigens: characterization of antigen and antibody specificities. | |
| CN105859838B (en) | A kind of Escherichia coli O 157: H7 protein I vy polypeptide, anti-Ivy polyclonal antibody and its application | |
| Lehr et al. | Lectin from the lichen Peltigera membranacea (Ach.) Nyl.: characterization and function | |
| CN109651497B (en) | Grass carp FoxO1 polypeptide antigen and antibody, and preparation method and application thereof | |
| CN117169499B (en) | Double-antibody sandwich ELISA detection kit for Gatavirus and application thereof | |
| CN101928334B (en) | Preparation method of mouse Ehf polypeptide and antibody thereof | |
| CN101928332A (en) | Preparation method of Human HNRPA0 polypeptide and antibody thereof | |
| CN110577595A (en) | anti-TTF 1 protein monoclonal antibody and application thereof | |
| CN114990074B (en) | Hybridoma cell strain, anti-human fumarate hydratase monoclonal antibody and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |